ID: 1151509492

View in Genome Browser
Species Human (GRCh38)
Location 17:74549597-74549619
Sequence ACAGACAGGCAGAAGGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151509492_1151509502 14 Left 1151509492 17:74549597-74549619 CCCTCCACCTTCTGCCTGTCTGT No data
Right 1151509502 17:74549634-74549656 TGGCCACACAAATCCCTGTGAGG No data
1151509492_1151509498 -6 Left 1151509492 17:74549597-74549619 CCCTCCACCTTCTGCCTGTCTGT No data
Right 1151509498 17:74549614-74549636 GTCTGTGAACCCAGGTCCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151509492 Original CRISPR ACAGACAGGCAGAAGGTGGA GGG (reversed) Intergenic
No off target data available for this crispr