ID: 1151510754

View in Genome Browser
Species Human (GRCh38)
Location 17:74558136-74558158
Sequence TATTGATGTACGCAACAATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151510754_1151510759 18 Left 1151510754 17:74558136-74558158 CCAAATTGTTGCGTACATCAATA No data
Right 1151510759 17:74558177-74558199 CTGGAGTGGCATTCTGTGGTAGG No data
1151510754_1151510758 14 Left 1151510754 17:74558136-74558158 CCAAATTGTTGCGTACATCAATA No data
Right 1151510758 17:74558173-74558195 AGTGCTGGAGTGGCATTCTGTGG No data
1151510754_1151510755 -1 Left 1151510754 17:74558136-74558158 CCAAATTGTTGCGTACATCAATA No data
Right 1151510755 17:74558158-74558180 AGCTTGCTCCTCTCTAGTGCTGG No data
1151510754_1151510756 4 Left 1151510754 17:74558136-74558158 CCAAATTGTTGCGTACATCAATA No data
Right 1151510756 17:74558163-74558185 GCTCCTCTCTAGTGCTGGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151510754 Original CRISPR TATTGATGTACGCAACAATT TGG (reversed) Intergenic