ID: 1151510759

View in Genome Browser
Species Human (GRCh38)
Location 17:74558177-74558199
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151510754_1151510759 18 Left 1151510754 17:74558136-74558158 CCAAATTGTTGCGTACATCAATA No data
Right 1151510759 17:74558177-74558199 CTGGAGTGGCATTCTGTGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151510759 Original CRISPR CTGGAGTGGCATTCTGTGGT AGG Intergenic
No off target data available for this crispr