ID: 1151515530

View in Genome Browser
Species Human (GRCh38)
Location 17:74592583-74592605
Sequence TCCTCTCCCTGCACTCCTCA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 565
Summary {0: 1, 1: 0, 2: 2, 3: 49, 4: 513}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151515530_1151515535 26 Left 1151515530 17:74592583-74592605 CCATGAGGAGTGCAGGGAGAGGA 0: 1
1: 0
2: 2
3: 49
4: 513
Right 1151515535 17:74592632-74592654 GGACTCACACCCAGCCTTGCTGG 0: 1
1: 0
2: 0
3: 27
4: 218
1151515530_1151515533 5 Left 1151515530 17:74592583-74592605 CCATGAGGAGTGCAGGGAGAGGA 0: 1
1: 0
2: 2
3: 49
4: 513
Right 1151515533 17:74592611-74592633 TTGGGAAGACCACAGTGCACAGG 0: 1
1: 0
2: 2
3: 22
4: 169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151515530 Original CRISPR TCCTCTCCCTGCACTCCTCA TGG (reversed) Exonic