ID: 1151515835

View in Genome Browser
Species Human (GRCh38)
Location 17:74594944-74594966
Sequence ATGGTGGTCTGGGGCATATT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151515835_1151515848 21 Left 1151515835 17:74594944-74594966 CCCAATATGCCCCAGACCACCAT No data
Right 1151515848 17:74594988-74595010 CAGGCCCCTAAACCAGTGTAGGG No data
1151515835_1151515845 2 Left 1151515835 17:74594944-74594966 CCCAATATGCCCCAGACCACCAT No data
Right 1151515845 17:74594969-74594991 CCCTAATCTTTTGACACGGCAGG No data
1151515835_1151515842 -2 Left 1151515835 17:74594944-74594966 CCCAATATGCCCCAGACCACCAT No data
Right 1151515842 17:74594965-74594987 ATACCCCTAATCTTTTGACACGG No data
1151515835_1151515847 20 Left 1151515835 17:74594944-74594966 CCCAATATGCCCCAGACCACCAT No data
Right 1151515847 17:74594987-74595009 GCAGGCCCCTAAACCAGTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151515835 Original CRISPR ATGGTGGTCTGGGGCATATT GGG (reversed) Intergenic