ID: 1151515836

View in Genome Browser
Species Human (GRCh38)
Location 17:74594945-74594967
Sequence TATGGTGGTCTGGGGCATAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151515836_1151515842 -3 Left 1151515836 17:74594945-74594967 CCAATATGCCCCAGACCACCATA No data
Right 1151515842 17:74594965-74594987 ATACCCCTAATCTTTTGACACGG No data
1151515836_1151515848 20 Left 1151515836 17:74594945-74594967 CCAATATGCCCCAGACCACCATA No data
Right 1151515848 17:74594988-74595010 CAGGCCCCTAAACCAGTGTAGGG No data
1151515836_1151515847 19 Left 1151515836 17:74594945-74594967 CCAATATGCCCCAGACCACCATA No data
Right 1151515847 17:74594987-74595009 GCAGGCCCCTAAACCAGTGTAGG No data
1151515836_1151515845 1 Left 1151515836 17:74594945-74594967 CCAATATGCCCCAGACCACCATA No data
Right 1151515845 17:74594969-74594991 CCCTAATCTTTTGACACGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151515836 Original CRISPR TATGGTGGTCTGGGGCATAT TGG (reversed) Intergenic