ID: 1151515837 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 17:74594953-74594975 |
Sequence | ATTAGGGGTATGGTGGTCTG GGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1151515837_1151515848 | 12 | Left | 1151515837 | 17:74594953-74594975 | CCCCAGACCACCATACCCCTAAT | No data | ||
Right | 1151515848 | 17:74594988-74595010 | CAGGCCCCTAAACCAGTGTAGGG | No data | ||||
1151515837_1151515847 | 11 | Left | 1151515837 | 17:74594953-74594975 | CCCCAGACCACCATACCCCTAAT | No data | ||
Right | 1151515847 | 17:74594987-74595009 | GCAGGCCCCTAAACCAGTGTAGG | No data | ||||
1151515837_1151515845 | -7 | Left | 1151515837 | 17:74594953-74594975 | CCCCAGACCACCATACCCCTAAT | No data | ||
Right | 1151515845 | 17:74594969-74594991 | CCCTAATCTTTTGACACGGCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1151515837 | Original CRISPR | ATTAGGGGTATGGTGGTCTG GGG (reversed) | Intergenic | ||