ID: 1151515837

View in Genome Browser
Species Human (GRCh38)
Location 17:74594953-74594975
Sequence ATTAGGGGTATGGTGGTCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151515837_1151515847 11 Left 1151515837 17:74594953-74594975 CCCCAGACCACCATACCCCTAAT No data
Right 1151515847 17:74594987-74595009 GCAGGCCCCTAAACCAGTGTAGG No data
1151515837_1151515848 12 Left 1151515837 17:74594953-74594975 CCCCAGACCACCATACCCCTAAT No data
Right 1151515848 17:74594988-74595010 CAGGCCCCTAAACCAGTGTAGGG No data
1151515837_1151515845 -7 Left 1151515837 17:74594953-74594975 CCCCAGACCACCATACCCCTAAT No data
Right 1151515845 17:74594969-74594991 CCCTAATCTTTTGACACGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151515837 Original CRISPR ATTAGGGGTATGGTGGTCTG GGG (reversed) Intergenic