ID: 1151515839

View in Genome Browser
Species Human (GRCh38)
Location 17:74594955-74594977
Sequence AGATTAGGGGTATGGTGGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151515839_1151515845 -9 Left 1151515839 17:74594955-74594977 CCAGACCACCATACCCCTAATCT No data
Right 1151515845 17:74594969-74594991 CCCTAATCTTTTGACACGGCAGG No data
1151515839_1151515848 10 Left 1151515839 17:74594955-74594977 CCAGACCACCATACCCCTAATCT No data
Right 1151515848 17:74594988-74595010 CAGGCCCCTAAACCAGTGTAGGG No data
1151515839_1151515853 29 Left 1151515839 17:74594955-74594977 CCAGACCACCATACCCCTAATCT No data
Right 1151515853 17:74595007-74595029 AGGGTTTATCTCCCAGCCTCTGG No data
1151515839_1151515847 9 Left 1151515839 17:74594955-74594977 CCAGACCACCATACCCCTAATCT No data
Right 1151515847 17:74594987-74595009 GCAGGCCCCTAAACCAGTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151515839 Original CRISPR AGATTAGGGGTATGGTGGTC TGG (reversed) Intergenic