ID: 1151515840

View in Genome Browser
Species Human (GRCh38)
Location 17:74594960-74594982
Sequence TCAAAAGATTAGGGGTATGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151515840_1151515847 4 Left 1151515840 17:74594960-74594982 CCACCATACCCCTAATCTTTTGA No data
Right 1151515847 17:74594987-74595009 GCAGGCCCCTAAACCAGTGTAGG No data
1151515840_1151515853 24 Left 1151515840 17:74594960-74594982 CCACCATACCCCTAATCTTTTGA No data
Right 1151515853 17:74595007-74595029 AGGGTTTATCTCCCAGCCTCTGG No data
1151515840_1151515848 5 Left 1151515840 17:74594960-74594982 CCACCATACCCCTAATCTTTTGA No data
Right 1151515848 17:74594988-74595010 CAGGCCCCTAAACCAGTGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151515840 Original CRISPR TCAAAAGATTAGGGGTATGG TGG (reversed) Intergenic