ID: 1151515841

View in Genome Browser
Species Human (GRCh38)
Location 17:74594963-74594985
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151515841_1151515847 1 Left 1151515841 17:74594963-74594985 CCATACCCCTAATCTTTTGACAC No data
Right 1151515847 17:74594987-74595009 GCAGGCCCCTAAACCAGTGTAGG No data
1151515841_1151515848 2 Left 1151515841 17:74594963-74594985 CCATACCCCTAATCTTTTGACAC No data
Right 1151515848 17:74594988-74595010 CAGGCCCCTAAACCAGTGTAGGG No data
1151515841_1151515853 21 Left 1151515841 17:74594963-74594985 CCATACCCCTAATCTTTTGACAC No data
Right 1151515853 17:74595007-74595029 AGGGTTTATCTCCCAGCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151515841 Original CRISPR GTGTCAAAAGATTAGGGGTA TGG (reversed) Intergenic