ID: 1151515842

View in Genome Browser
Species Human (GRCh38)
Location 17:74594965-74594987
Sequence ATACCCCTAATCTTTTGACA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151515835_1151515842 -2 Left 1151515835 17:74594944-74594966 CCCAATATGCCCCAGACCACCAT No data
Right 1151515842 17:74594965-74594987 ATACCCCTAATCTTTTGACACGG No data
1151515834_1151515842 17 Left 1151515834 17:74594925-74594947 CCTTTACTCTGAGGGTACACCCA No data
Right 1151515842 17:74594965-74594987 ATACCCCTAATCTTTTGACACGG No data
1151515836_1151515842 -3 Left 1151515836 17:74594945-74594967 CCAATATGCCCCAGACCACCATA No data
Right 1151515842 17:74594965-74594987 ATACCCCTAATCTTTTGACACGG No data
1151515833_1151515842 18 Left 1151515833 17:74594924-74594946 CCCTTTACTCTGAGGGTACACCC No data
Right 1151515842 17:74594965-74594987 ATACCCCTAATCTTTTGACACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151515842 Original CRISPR ATACCCCTAATCTTTTGACA CGG Intergenic