ID: 1151515845

View in Genome Browser
Species Human (GRCh38)
Location 17:74594969-74594991
Sequence CCCTAATCTTTTGACACGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151515838_1151515845 -8 Left 1151515838 17:74594954-74594976 CCCAGACCACCATACCCCTAATC No data
Right 1151515845 17:74594969-74594991 CCCTAATCTTTTGACACGGCAGG No data
1151515836_1151515845 1 Left 1151515836 17:74594945-74594967 CCAATATGCCCCAGACCACCATA No data
Right 1151515845 17:74594969-74594991 CCCTAATCTTTTGACACGGCAGG No data
1151515837_1151515845 -7 Left 1151515837 17:74594953-74594975 CCCCAGACCACCATACCCCTAAT No data
Right 1151515845 17:74594969-74594991 CCCTAATCTTTTGACACGGCAGG No data
1151515834_1151515845 21 Left 1151515834 17:74594925-74594947 CCTTTACTCTGAGGGTACACCCA No data
Right 1151515845 17:74594969-74594991 CCCTAATCTTTTGACACGGCAGG No data
1151515835_1151515845 2 Left 1151515835 17:74594944-74594966 CCCAATATGCCCCAGACCACCAT No data
Right 1151515845 17:74594969-74594991 CCCTAATCTTTTGACACGGCAGG No data
1151515839_1151515845 -9 Left 1151515839 17:74594955-74594977 CCAGACCACCATACCCCTAATCT No data
Right 1151515845 17:74594969-74594991 CCCTAATCTTTTGACACGGCAGG No data
1151515833_1151515845 22 Left 1151515833 17:74594924-74594946 CCCTTTACTCTGAGGGTACACCC No data
Right 1151515845 17:74594969-74594991 CCCTAATCTTTTGACACGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151515845 Original CRISPR CCCTAATCTTTTGACACGGC AGG Intergenic