ID: 1151515846

View in Genome Browser
Species Human (GRCh38)
Location 17:74594970-74594992
Sequence GCCTGCCGTGTCAAAAGATT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151515846_1151515848 -5 Left 1151515846 17:74594970-74594992 CCTAATCTTTTGACACGGCAGGC No data
Right 1151515848 17:74594988-74595010 CAGGCCCCTAAACCAGTGTAGGG No data
1151515846_1151515853 14 Left 1151515846 17:74594970-74594992 CCTAATCTTTTGACACGGCAGGC No data
Right 1151515853 17:74595007-74595029 AGGGTTTATCTCCCAGCCTCTGG No data
1151515846_1151515847 -6 Left 1151515846 17:74594970-74594992 CCTAATCTTTTGACACGGCAGGC No data
Right 1151515847 17:74594987-74595009 GCAGGCCCCTAAACCAGTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151515846 Original CRISPR GCCTGCCGTGTCAAAAGATT AGG (reversed) Intergenic