ID: 1151515847

View in Genome Browser
Species Human (GRCh38)
Location 17:74594987-74595009
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151515840_1151515847 4 Left 1151515840 17:74594960-74594982 CCACCATACCCCTAATCTTTTGA No data
Right 1151515847 17:74594987-74595009 GCAGGCCCCTAAACCAGTGTAGG No data
1151515843_1151515847 -4 Left 1151515843 17:74594968-74594990 CCCCTAATCTTTTGACACGGCAG No data
Right 1151515847 17:74594987-74595009 GCAGGCCCCTAAACCAGTGTAGG No data
1151515839_1151515847 9 Left 1151515839 17:74594955-74594977 CCAGACCACCATACCCCTAATCT No data
Right 1151515847 17:74594987-74595009 GCAGGCCCCTAAACCAGTGTAGG No data
1151515844_1151515847 -5 Left 1151515844 17:74594969-74594991 CCCTAATCTTTTGACACGGCAGG No data
Right 1151515847 17:74594987-74595009 GCAGGCCCCTAAACCAGTGTAGG No data
1151515846_1151515847 -6 Left 1151515846 17:74594970-74594992 CCTAATCTTTTGACACGGCAGGC No data
Right 1151515847 17:74594987-74595009 GCAGGCCCCTAAACCAGTGTAGG No data
1151515838_1151515847 10 Left 1151515838 17:74594954-74594976 CCCAGACCACCATACCCCTAATC No data
Right 1151515847 17:74594987-74595009 GCAGGCCCCTAAACCAGTGTAGG No data
1151515836_1151515847 19 Left 1151515836 17:74594945-74594967 CCAATATGCCCCAGACCACCATA No data
Right 1151515847 17:74594987-74595009 GCAGGCCCCTAAACCAGTGTAGG No data
1151515837_1151515847 11 Left 1151515837 17:74594953-74594975 CCCCAGACCACCATACCCCTAAT No data
Right 1151515847 17:74594987-74595009 GCAGGCCCCTAAACCAGTGTAGG No data
1151515841_1151515847 1 Left 1151515841 17:74594963-74594985 CCATACCCCTAATCTTTTGACAC No data
Right 1151515847 17:74594987-74595009 GCAGGCCCCTAAACCAGTGTAGG No data
1151515835_1151515847 20 Left 1151515835 17:74594944-74594966 CCCAATATGCCCCAGACCACCAT No data
Right 1151515847 17:74594987-74595009 GCAGGCCCCTAAACCAGTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151515847 Original CRISPR GCAGGCCCCTAAACCAGTGT AGG Intergenic