ID: 1151515849

View in Genome Browser
Species Human (GRCh38)
Location 17:74594992-74595014
Sequence TAAACCCTACACTGGTTTAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151515849_1151515858 28 Left 1151515849 17:74594992-74595014 CCCCTAAACCAGTGTAGGGTTTA No data
Right 1151515858 17:74595043-74595065 GCTAGCCTCTTCTTGTTATCAGG No data
1151515849_1151515853 -8 Left 1151515849 17:74594992-74595014 CCCCTAAACCAGTGTAGGGTTTA No data
Right 1151515853 17:74595007-74595029 AGGGTTTATCTCCCAGCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151515849 Original CRISPR TAAACCCTACACTGGTTTAG GGG (reversed) Intergenic