ID: 1151515853

View in Genome Browser
Species Human (GRCh38)
Location 17:74595007-74595029
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151515838_1151515853 30 Left 1151515838 17:74594954-74594976 CCCAGACCACCATACCCCTAATC No data
Right 1151515853 17:74595007-74595029 AGGGTTTATCTCCCAGCCTCTGG No data
1151515851_1151515853 -10 Left 1151515851 17:74594994-74595016 CCTAAACCAGTGTAGGGTTTATC No data
Right 1151515853 17:74595007-74595029 AGGGTTTATCTCCCAGCCTCTGG No data
1151515849_1151515853 -8 Left 1151515849 17:74594992-74595014 CCCCTAAACCAGTGTAGGGTTTA No data
Right 1151515853 17:74595007-74595029 AGGGTTTATCTCCCAGCCTCTGG No data
1151515843_1151515853 16 Left 1151515843 17:74594968-74594990 CCCCTAATCTTTTGACACGGCAG No data
Right 1151515853 17:74595007-74595029 AGGGTTTATCTCCCAGCCTCTGG No data
1151515839_1151515853 29 Left 1151515839 17:74594955-74594977 CCAGACCACCATACCCCTAATCT No data
Right 1151515853 17:74595007-74595029 AGGGTTTATCTCCCAGCCTCTGG No data
1151515844_1151515853 15 Left 1151515844 17:74594969-74594991 CCCTAATCTTTTGACACGGCAGG No data
Right 1151515853 17:74595007-74595029 AGGGTTTATCTCCCAGCCTCTGG No data
1151515840_1151515853 24 Left 1151515840 17:74594960-74594982 CCACCATACCCCTAATCTTTTGA No data
Right 1151515853 17:74595007-74595029 AGGGTTTATCTCCCAGCCTCTGG No data
1151515850_1151515853 -9 Left 1151515850 17:74594993-74595015 CCCTAAACCAGTGTAGGGTTTAT No data
Right 1151515853 17:74595007-74595029 AGGGTTTATCTCCCAGCCTCTGG No data
1151515846_1151515853 14 Left 1151515846 17:74594970-74594992 CCTAATCTTTTGACACGGCAGGC No data
Right 1151515853 17:74595007-74595029 AGGGTTTATCTCCCAGCCTCTGG No data
1151515841_1151515853 21 Left 1151515841 17:74594963-74594985 CCATACCCCTAATCTTTTGACAC No data
Right 1151515853 17:74595007-74595029 AGGGTTTATCTCCCAGCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151515853 Original CRISPR AGGGTTTATCTCCCAGCCTC TGG Intergenic