ID: 1151515855 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 17:74595019-74595041 |
Sequence | ACTGGATGTGCTCCAGAGGC TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1151515855_1151515860 | 30 | Left | 1151515855 | 17:74595019-74595041 | CCAGCCTCTGGAGCACATCCAGT | No data | ||
Right | 1151515860 | 17:74595072-74595094 | TAGCATGATGTCATAAACACAGG | No data | ||||
1151515855_1151515858 | 1 | Left | 1151515855 | 17:74595019-74595041 | CCAGCCTCTGGAGCACATCCAGT | No data | ||
Right | 1151515858 | 17:74595043-74595065 | GCTAGCCTCTTCTTGTTATCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1151515855 | Original CRISPR | ACTGGATGTGCTCCAGAGGC TGG (reversed) | Intergenic | ||