ID: 1151515855 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 17:74595019-74595041 |
| Sequence | ACTGGATGTGCTCCAGAGGC TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1151515855_1151515860 | 30 | Left | 1151515855 | 17:74595019-74595041 | CCAGCCTCTGGAGCACATCCAGT | No data | ||
| Right | 1151515860 | 17:74595072-74595094 | TAGCATGATGTCATAAACACAGG | No data | ||||
| 1151515855_1151515858 | 1 | Left | 1151515855 | 17:74595019-74595041 | CCAGCCTCTGGAGCACATCCAGT | No data | ||
| Right | 1151515858 | 17:74595043-74595065 | GCTAGCCTCTTCTTGTTATCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1151515855 | Original CRISPR | ACTGGATGTGCTCCAGAGGC TGG (reversed) | Intergenic | ||