ID: 1151515858

View in Genome Browser
Species Human (GRCh38)
Location 17:74595043-74595065
Sequence GCTAGCCTCTTCTTGTTATC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151515852_1151515858 20 Left 1151515852 17:74595000-74595022 CCAGTGTAGGGTTTATCTCCCAG No data
Right 1151515858 17:74595043-74595065 GCTAGCCTCTTCTTGTTATCAGG No data
1151515850_1151515858 27 Left 1151515850 17:74594993-74595015 CCCTAAACCAGTGTAGGGTTTAT No data
Right 1151515858 17:74595043-74595065 GCTAGCCTCTTCTTGTTATCAGG No data
1151515856_1151515858 -3 Left 1151515856 17:74595023-74595045 CCTCTGGAGCACATCCAGTTGCT No data
Right 1151515858 17:74595043-74595065 GCTAGCCTCTTCTTGTTATCAGG No data
1151515855_1151515858 1 Left 1151515855 17:74595019-74595041 CCAGCCTCTGGAGCACATCCAGT No data
Right 1151515858 17:74595043-74595065 GCTAGCCTCTTCTTGTTATCAGG No data
1151515849_1151515858 28 Left 1151515849 17:74594992-74595014 CCCCTAAACCAGTGTAGGGTTTA No data
Right 1151515858 17:74595043-74595065 GCTAGCCTCTTCTTGTTATCAGG No data
1151515854_1151515858 2 Left 1151515854 17:74595018-74595040 CCCAGCCTCTGGAGCACATCCAG No data
Right 1151515858 17:74595043-74595065 GCTAGCCTCTTCTTGTTATCAGG No data
1151515851_1151515858 26 Left 1151515851 17:74594994-74595016 CCTAAACCAGTGTAGGGTTTATC No data
Right 1151515858 17:74595043-74595065 GCTAGCCTCTTCTTGTTATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151515858 Original CRISPR GCTAGCCTCTTCTTGTTATC AGG Intergenic