ID: 1151517136

View in Genome Browser
Species Human (GRCh38)
Location 17:74603904-74603926
Sequence CAGCAGACACAGCTGGGCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 541
Summary {0: 1, 1: 0, 2: 5, 3: 50, 4: 485}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151517129_1151517136 8 Left 1151517129 17:74603873-74603895 CCTAAGACAACAGACGCAGCTGC 0: 1
1: 0
2: 1
3: 13
4: 119
Right 1151517136 17:74603904-74603926 CAGCAGACACAGCTGGGCCTGGG 0: 1
1: 0
2: 5
3: 50
4: 485
1151517128_1151517136 26 Left 1151517128 17:74603855-74603877 CCAAGAAAACAATCTGAACCTAA 0: 1
1: 0
2: 4
3: 25
4: 261
Right 1151517136 17:74603904-74603926 CAGCAGACACAGCTGGGCCTGGG 0: 1
1: 0
2: 5
3: 50
4: 485

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151517136 Original CRISPR CAGCAGACACAGCTGGGCCT GGG Intergenic
900245749 1:1635290-1635312 CTGCTGGCACAGCTGGGGCTGGG + Intronic
900256979 1:1702447-1702469 CTGCTGGCACAGCTGGGGCTGGG + Intronic
900285895 1:1900146-1900168 CAGCCACCCCAGCTGGGCCTTGG + Intergenic
900321557 1:2086874-2086896 CAGCAGACCCAGCCAGGCCAGGG + Intronic
900399528 1:2467340-2467362 CAGCAGAGGCTGCTGGGCCCGGG + Intronic
900409159 1:2505040-2505062 CAGCAGAGACTGCAGGGCCTGGG + Exonic
900474069 1:2868165-2868187 CAGCAGCCATAGGTGGCCCTGGG - Intergenic
900640732 1:3687019-3687041 CAGCAGAGCCAGGAGGGCCTAGG + Intronic
900664558 1:3806026-3806048 AAGAAAAGACAGCTGGGCCTGGG + Intergenic
900716567 1:4148838-4148860 CACCATGCACAGCTGGGTCTTGG - Intergenic
900959770 1:5911415-5911437 CAGCAGAGACAGCGGGCACTCGG + Intronic
901151812 1:7108415-7108437 CCGCAGACCCAGATGGCCCTGGG + Intronic
901400928 1:9014768-9014790 CAGCACAGACAGGTGGCCCTCGG + Exonic
901529040 1:9842288-9842310 CAGGAACCACAGCAGGGCCTGGG + Intergenic
901862141 1:12081220-12081242 CAGCAGAGTGAGCAGGGCCTGGG + Intronic
902795098 1:18795806-18795828 CTGCAGCCACAGCTAGGCTTTGG - Intergenic
902813860 1:18904861-18904883 GAGTAGACACAGCCGGGGCTGGG + Exonic
903063797 1:20687254-20687276 CAGCAGACACAGTGGAGCCACGG + Intronic
903242020 1:21989282-21989304 CAGCACTGCCAGCTGGGCCTTGG - Exonic
903245528 1:22012470-22012492 CAGCACTGCCAGCTGGGCCTTGG - Exonic
903672037 1:25042147-25042169 CAGCATCCACAGCTGGCACTGGG + Intergenic
903931634 1:26865450-26865472 CAGCTCACCCGGCTGGGCCTGGG + Intergenic
903938640 1:26913677-26913699 CAGCAGCCGCCGCTGGTCCTGGG + Exonic
904371310 1:30049143-30049165 AAGGAGAAACAGCTGGGGCTGGG - Intergenic
904420609 1:30388714-30388736 CAGAGGACACAGCTGGCTCTTGG - Intergenic
904784237 1:32973409-32973431 CAGCAGACACAGCGGGGGATGGG + Intergenic
905925502 1:41746700-41746722 CAGCAGACACTGTTGGAGCTTGG + Intronic
906666168 1:47623655-47623677 CAGCAGAGAGAGCCTGGCCTGGG + Intergenic
907558470 1:55366542-55366564 CAGCAGTCAGAGCAGAGCCTTGG - Intergenic
909018279 1:70403511-70403533 CAGGAACCACAGCTGGGCCCTGG + Intergenic
909823940 1:80101567-80101589 CAGGAGACAAAGGTGGGACTAGG - Intergenic
912332267 1:108830577-108830599 CAGAAGGCACAGCTCGGACTGGG + Exonic
914451643 1:147798069-147798091 CTGCAGTCACAGCTGGGCTCAGG + Intergenic
915345416 1:155194716-155194738 CCGCACACAAAGCTGCGCCTCGG - Intergenic
915937237 1:160096692-160096714 CAGGCCACACAGCTGGGCATGGG - Intronic
916661532 1:166926318-166926340 CAGCTGACACAGCTGATTCTTGG - Intronic
917737915 1:177937213-177937235 CTGCAGACACACCTGGGCCCTGG - Exonic
919647217 1:200107075-200107097 CTGCACCCACAGCTGGCCCTTGG - Intronic
919791266 1:201292403-201292425 TGGCAGACACAGCTTGCCCTGGG - Intronic
920315540 1:205073620-205073642 AAGCTGAGTCAGCTGGGCCTGGG - Intronic
920417717 1:205810013-205810035 CAGCAGGCAAAGGTGGCCCTGGG + Intronic
920674661 1:208030678-208030700 GAGCCGACACAGATGGGCCCAGG - Intronic
920733023 1:208505694-208505716 CAGCTGAAACCACTGGGCCTTGG + Intergenic
921644817 1:217601903-217601925 TATCAGATACTGCTGGGCCTTGG - Intronic
922575551 1:226658809-226658831 CAGAAGCAACTGCTGGGCCTGGG + Intronic
922847704 1:228702424-228702446 CAGGAGGCAAAGCTGGGCCAGGG + Intergenic
923255871 1:232220942-232220964 AGGCACACACAGCTGGGCCATGG + Intergenic
924453614 1:244200426-244200448 AAGGGGACAGAGCTGGGCCTGGG + Intergenic
1063034458 10:2271717-2271739 GAGTAGACACAGCTTGGCCAAGG + Intergenic
1064881576 10:20060560-20060582 CATCAGCAACACCTGGGCCTAGG - Intronic
1065169697 10:23014184-23014206 ATTCAGACACAACTGGGCCTTGG + Intronic
1066116214 10:32242733-32242755 CAGCAGGCACACCTGCGCCTTGG - Intergenic
1067093916 10:43286051-43286073 AAGGAGCCACAGCTGGCCCTGGG + Intergenic
1067287075 10:44914520-44914542 AAGCAGACACAGCTGGGAAATGG + Intronic
1067803357 10:49375855-49375877 CAGCAGCCAGAGCTCGGCATGGG + Intronic
1068875858 10:61996013-61996035 CTACAGGCACAGCTGGGGCTTGG - Intronic
1069258754 10:66367037-66367059 CAGCCCACACACCCGGGCCTGGG + Intronic
1069461625 10:68600212-68600234 CAGGAGACATAACTGAGCCTAGG - Intronic
1069630328 10:69893678-69893700 CAGTGGAAACAGCTGGACCTTGG + Intronic
1069722478 10:70558555-70558577 CAGCACACACATCAGGGCCGTGG + Intronic
1071060971 10:81570698-81570720 CAGCAAACACTCCTGAGCCTGGG + Intergenic
1072781544 10:98255119-98255141 GAGAACACACAGCTGGGCCTTGG + Intronic
1072866648 10:99068994-99069016 CAGTAAAGACAGCTGGGACTTGG - Intronic
1073568993 10:104560133-104560155 CAGCAAACACAGATGAGGCTGGG - Intergenic
1074892356 10:117746255-117746277 CAAGAGACACAGCGGGGCATGGG - Intergenic
1075175867 10:120160558-120160580 AAGCAGACACAGCTCTGCCAAGG - Intergenic
1075876537 10:125811005-125811027 CAGCACAAGCAGCAGGGCCTTGG - Intronic
1076419687 10:130322139-130322161 AAGAAAAGACAGCTGGGCCTGGG - Intergenic
1076691609 10:132226556-132226578 CAGCAGCCCCAGCTGAGACTGGG - Intronic
1076806115 10:132859667-132859689 GAGCAGCCACAGCAGGGCCCTGG + Intronic
1076991612 11:278868-278890 CAGCAGACACTGCCAGGCCCAGG - Intronic
1077020741 11:416175-416197 AAGCAGGCACAGCAGGGCCCAGG + Intronic
1077087938 11:763953-763975 CAGGAGCCACAGCTGGGCAGTGG - Intronic
1077143960 11:1036635-1036657 CAGCAGCCACCGCTGGACCATGG + Exonic
1077319641 11:1935500-1935522 CCGCAGGCAAAGCTGGGACTGGG + Intronic
1077536794 11:3128399-3128421 CAGCAGTCACAGCTCAGCCTTGG + Intronic
1077701231 11:4444060-4444082 CAGCTAACACAGCTGGGACCAGG + Intergenic
1077706594 11:4492829-4492851 AAGAAAAGACAGCTGGGCCTGGG + Intergenic
1077892659 11:6430716-6430738 CATCAGAAACAACAGGGCCTGGG - Intergenic
1078281886 11:9910751-9910773 TAGAAAACACAGCTGGGGCTGGG + Intronic
1078658111 11:13261174-13261196 CCGCAGACAGAGCTGAGCCCTGG + Intergenic
1079275720 11:19035368-19035390 CAGCGAAAACATCTGGGCCTGGG - Intergenic
1081330512 11:41794278-41794300 CAGGAGGCACACCTGGGCCAGGG - Intergenic
1082689102 11:56277999-56278021 AAGAAAAGACAGCTGGGCCTGGG - Intergenic
1083185788 11:61017218-61017240 CAGGAGGGACAGCTGGGGCTGGG + Intronic
1083791579 11:64989461-64989483 CAGCAACCACAGCGGGGCCAAGG + Exonic
1084202852 11:67573392-67573414 AAGAAAAGACAGCTGGGCCTGGG - Intergenic
1084217662 11:67659003-67659025 AAGAAAACACAGCTGGGCCCAGG + Intergenic
1084360359 11:68665040-68665062 CACCAGACACAGCTGGGGACTGG + Intergenic
1084392488 11:68887147-68887169 CAGGAGGCAGAGCTGGGCCAGGG + Intergenic
1085245808 11:75099525-75099547 CAGGAGAAACACCTGAGCCTGGG + Intergenic
1089139110 11:116272271-116272293 CTGAGGACCCAGCTGGGCCTGGG + Intergenic
1089748956 11:120636745-120636767 CAGGAGAATCACCTGGGCCTGGG + Intronic
1089940810 11:122414847-122414869 CAGGAGGCATAGCTGGACCTGGG + Intergenic
1090550066 11:127809477-127809499 CAGCAGACAAAGCCATGCCTGGG + Intergenic
1090653623 11:128826188-128826210 CAGCAGGCAGAGCAGGGCCTAGG + Intergenic
1090820167 11:130334977-130334999 CAGGAGGCACAGCTGGGCCAGGG + Intergenic
1091438202 12:490909-490931 CTGCAGACCCATCTGGGCCTGGG - Intronic
1091466854 12:692255-692277 CAGGAGGCACAGCTGGGCCAGGG + Intergenic
1091496366 12:976539-976561 CAGCAGTCCCAGCTGAGCCCAGG + Intronic
1091601122 12:1918303-1918325 CAGCAGCCACAGGAGGGCCGAGG + Exonic
1091672857 12:2465600-2465622 GAGCAGACTGAGCTGGGTCTTGG + Intronic
1092071835 12:5637557-5637579 CAGCTGATGCAGCTGGTCCTTGG - Intronic
1093639341 12:21508088-21508110 CTGCAGACACAGATGCCCCTTGG + Intronic
1094202721 12:27809794-27809816 CAGAAGAAACAGCTGGGTGTAGG - Intergenic
1095988195 12:48014806-48014828 CAGGAGGCAGAGCTGGGACTGGG - Intergenic
1096366065 12:51029379-51029401 CTGCAGAGACAGCTTTGCCTTGG - Intergenic
1096550981 12:52371372-52371394 CAGCTGACACAGCTGCTCCCTGG + Intergenic
1098387577 12:69935103-69935125 CAGCAGGCACAGCCCTGCCTGGG - Intronic
1098678532 12:73321467-73321489 AAGCAGGCACAGCTGGGCTGGGG - Intergenic
1100094931 12:91022593-91022615 CAGGAGGATCAGCTGGGCCTGGG - Intergenic
1100441297 12:94619537-94619559 CATCAGACTCAGCTGAGCCCAGG + Intronic
1101832543 12:108270658-108270680 CTGCAGAGACAGCCAGGCCTGGG - Intergenic
1101897831 12:108769244-108769266 CAACAGACAGATCTGGGGCTGGG + Intergenic
1102557137 12:113734462-113734484 GAGAATACACAGCTGGTCCTTGG + Intergenic
1103025945 12:117574090-117574112 CAGCAGCCTCAGCATGGCCTGGG + Intronic
1103218677 12:119224796-119224818 CAGCAGAGACAGCCAGTCCTGGG - Intergenic
1103220303 12:119238892-119238914 CAGCATACCCTGCTGGGCCCAGG + Intergenic
1103852463 12:123942121-123942143 CAGCAGGCACAGAGGGCCCTGGG + Intronic
1104579886 12:130003447-130003469 CAGCGGGCAAAGCAGGGCCTTGG - Intergenic
1105287177 13:19013920-19013942 AAGAAAAGACAGCTGGGCCTGGG - Intergenic
1105783017 13:23720874-23720896 CACCGCACACAGCTGGGACTGGG + Intergenic
1106500806 13:30327138-30327160 CAGCAGAAACAACCGGGCATTGG - Intergenic
1106768642 13:32940848-32940870 GAGCACAGACAGCTGGGCCCAGG - Intergenic
1106770566 13:32957496-32957518 CAGCTGGCCCAGCTGGGGCTGGG + Intergenic
1108020356 13:46121802-46121824 GAGTAGACACTGCAGGGCCTTGG + Intergenic
1108869986 13:54973019-54973041 CAAGAGGCACAGCTGGGCCAGGG + Intergenic
1111075535 13:83230290-83230312 CAGCAGACACCATTGGGCTTTGG - Intergenic
1112076270 13:95916524-95916546 AAGCAGACAGAACTGGGCCGAGG + Intronic
1113263766 13:108593918-108593940 TGGCAGACACAGCTGGCCCATGG + Intergenic
1113416386 13:110131651-110131673 AAGCAGACACCGTTGTGCCTGGG - Intergenic
1113518966 13:110924766-110924788 CAGCAGACAGAGCTGGGTCCAGG - Intergenic
1113775453 13:112942498-112942520 AAGAAAAGACAGCTGGGCCTGGG - Intronic
1113812968 13:113153490-113153512 CAGCAGGCACAGCTGGGTCCAGG + Intergenic
1114550751 14:23531569-23531591 CTGCAGACGCCTCTGGGCCTGGG + Exonic
1114570636 14:23665022-23665044 CAGCAGAGGCAGCTGCCCCTAGG + Intergenic
1114572429 14:23681873-23681895 CAGCAGACACTCCCGTGCCTGGG + Intergenic
1114735820 14:25042835-25042857 GAGCTGACACAGTTGGCCCTTGG - Intronic
1115990617 14:39146037-39146059 CAGGAGAATCAGCTGGACCTGGG - Intergenic
1116743860 14:48792736-48792758 CAGCAGTCTGAGCTGGACCTGGG + Intergenic
1116915364 14:50520067-50520089 CATAAGACAAAGCTGGGGCTGGG + Intronic
1117466752 14:56001524-56001546 GAACAGACACAGAAGGGCCTGGG - Intergenic
1118223809 14:63880181-63880203 CAGGAGACTCACCTGAGCCTAGG - Intronic
1118822036 14:69352131-69352153 CAGCTGCCACTGCTGGGCCTGGG - Exonic
1119386634 14:74261431-74261453 CTGCAGACCTGGCTGGGCCTGGG + Exonic
1119430577 14:74565682-74565704 CTGTAGACACAGTTGGGGCTGGG + Intronic
1120863424 14:89275283-89275305 CAGCAGACACAGCTGGCTGAAGG + Intronic
1121263303 14:92582100-92582122 TAGGAGGCACAGATGGGCCTAGG + Intronic
1121514833 14:94542677-94542699 CAGCAGACACCCCTGAACCTGGG - Intergenic
1122317842 14:100836176-100836198 CAGCCGACCCAGCCGGGCCACGG - Intergenic
1122690220 14:103528753-103528775 CAGCAGTGACAGCCAGGCCTTGG + Intergenic
1122755943 14:103980202-103980224 AAGAAAAGACAGCTGGGCCTGGG + Intronic
1122796847 14:104210313-104210335 GAGCAGACAGAGCCGGGCCACGG - Intergenic
1122859666 14:104576910-104576932 CAGCAGAGAGAGCTGGGCTCAGG + Intronic
1122859683 14:104577008-104577030 CAGCAGAGAGAGCTGGGCTCAGG + Intronic
1202890065 14_KI270722v1_random:148408-148430 AAGAAAACACAGTTGGGCCTGGG + Intergenic
1124254112 15:28127229-28127251 CTGCAGACGCAGCTGGGCATAGG + Intronic
1124349378 15:28943967-28943989 CAGCAGACACAGTAGGGAGTTGG - Intronic
1125882937 15:43209310-43209332 CATCATACACAGGTCGGCCTCGG + Exonic
1126921909 15:53536075-53536097 CAAGAGGCACAGCTGGGACTTGG + Intronic
1127284011 15:57517002-57517024 CAGCTGCCAAAGCTGGGCCTGGG - Intronic
1127534086 15:59873865-59873887 CAGCAGCCACAGCTTGGCTGGGG - Intergenic
1127641220 15:60917608-60917630 CAGCAAACACAGCTGCCCCTCGG - Intronic
1127906417 15:63379626-63379648 CTGCAGACCCAGCTGGTACTGGG + Intronic
1128257973 15:66212309-66212331 CAGCACACAGAGGTGGGACTTGG + Intronic
1128916469 15:71567257-71567279 CCCCAGACACAGCTGAGCCAAGG + Intronic
1129189862 15:73930937-73930959 CAGGAGACCCAGCTGGGCCTGGG - Intronic
1129245843 15:74278195-74278217 GGGCAGACACAGCTGAGCCTTGG + Intronic
1129263671 15:74382698-74382720 CAGCACACAGAGCTGAGCATGGG + Intergenic
1129456114 15:75676942-75676964 CACCACACTCAGCTGGGCCCGGG + Exonic
1129494926 15:75970471-75970493 CAGGGTACAGAGCTGGGCCTTGG + Intronic
1129600276 15:76994707-76994729 GAGCAGACACAGCTGTGCTCTGG - Intronic
1129670773 15:77606566-77606588 CAGCACCCAGAGCTGGGGCTGGG - Intergenic
1129741542 15:77991990-77992012 CAGCAGCCAGCCCTGGGCCTGGG - Intronic
1129844117 15:78760414-78760436 CAGCAGCCAGCCCTGGGCCTGGG + Intronic
1130289861 15:82589229-82589251 CAGAACAAACAGCAGGGCCTTGG - Intronic
1130886445 15:88096477-88096499 CAGGAGACTCAGGTGGGCCAGGG - Intronic
1130894594 15:88160281-88160303 AAGGAGTCACAGCTGTGCCTAGG + Intronic
1131142049 15:89984863-89984885 TAGGAAACACAGCTGGGCCAGGG - Intergenic
1131172937 15:90191237-90191259 CAGCGGACGCACCTGGGACTTGG + Intronic
1131267300 15:90924262-90924284 CTGCAGACCCAGCTGGTCCTGGG - Intergenic
1131526647 15:93158175-93158197 CAGAAGCCACAGCTGAGCCCAGG - Intergenic
1132453867 16:12005-12027 GAGCAGTCACAGCTCGGCTTTGG - Intergenic
1132634974 16:939589-939611 CCGCAGACACAGCAGGGTCGAGG - Intronic
1133812370 16:9170503-9170525 CAGGGGACAGAGCTGGTCCTGGG + Intergenic
1134103442 16:11469139-11469161 GTGCAGACACAGGTGGGCCTAGG + Intronic
1134227071 16:12399502-12399524 GAGCAGGCAGGGCTGGGCCTTGG + Intronic
1134270797 16:12731416-12731438 CAGCAGAGACTGCTGGGGCATGG + Intronic
1134308696 16:13056903-13056925 AAGTAGACACAGCGGGGCTTAGG + Intronic
1135667847 16:24351030-24351052 CAGGAGACAGAGCTGGCCCCTGG - Intronic
1136247496 16:28984324-28984346 CATCTGCCACAGCTGGCCCTGGG + Exonic
1136280241 16:29204105-29204127 CAGCAGCCACAAGTGGGACTCGG - Intergenic
1136402937 16:30028364-30028386 GAACAGACACAGGGGGGCCTGGG + Intronic
1136548113 16:30966555-30966577 AAGCAGGCACAGATGGGCCTGGG + Intronic
1137553321 16:49455076-49455098 CAGCAGACATAGGTGCCCCTTGG + Intergenic
1138155150 16:54696159-54696181 CAGCAGACATAGCTGGGCCCTGG - Intergenic
1138336851 16:56260210-56260232 CAGTAGCGAGAGCTGGGCCTGGG - Intronic
1138417381 16:56879249-56879271 CACCAGACACAGTGGGGGCTGGG + Intronic
1138490848 16:57375655-57375677 CAGGACACACAGCTGGGCAATGG + Intronic
1138549822 16:57741505-57741527 CAGCAGACAGGGCAGGGCATGGG - Intronic
1139340813 16:66266882-66266904 CAGCAGTGACAGCTCAGCCTCGG + Intergenic
1139428053 16:66895449-66895471 CAGGAGACCCAGCTTGGGCTGGG - Intronic
1139706950 16:68747343-68747365 CTGCAGAGGCAGCTGGGCCAGGG + Intronic
1139823909 16:69742174-69742196 CTGCAGACCCAGCGGGGCATGGG + Exonic
1139923375 16:70473081-70473103 CAGCATCCACAGCAGGTCCTGGG - Exonic
1140416008 16:74774469-74774491 CAGCAGGTACAGCCGGGCCGGGG - Exonic
1141159641 16:81620569-81620591 CTGCACACACAGCTGGACTTAGG - Intronic
1141771085 16:86090024-86090046 CTGCAGAGTCACCTGGGCCTGGG - Intergenic
1142231548 16:88902464-88902486 CTCCGGACACAGCTGGCCCTGGG - Intronic
1142847497 17:2689363-2689385 CAGAACACACAGGTGAGCCTGGG + Intergenic
1142978058 17:3656862-3656884 CAGAAGACACGGCAGAGCCTGGG + Intronic
1144585182 17:16483351-16483373 CAGCACAGACAGGTTGGCCTCGG + Intronic
1144676540 17:17165865-17165887 CTGCTCACGCAGCTGGGCCTCGG - Intronic
1144730510 17:17523308-17523330 CAGCAGTCATCGCTGGGGCTGGG - Intronic
1145242077 17:21245901-21245923 CAGTGGCCACAGCTGGGCCTTGG - Intronic
1146816113 17:35943804-35943826 CAGAAGTAGCAGCTGGGCCTGGG + Intergenic
1147243716 17:39107370-39107392 CTGCAGAGACAGCTGGGTCTTGG - Intronic
1147310607 17:39593923-39593945 CACCATACCCAGCTGAGCCTAGG - Intergenic
1147643479 17:42019626-42019648 CAGCAGACACTGAAGGGCCTGGG - Intronic
1147649096 17:42051777-42051799 CAGCAGCCACTGGTGGGGCTGGG - Intronic
1148070852 17:44907717-44907739 TAGCAGACACAGTTGGGGATGGG - Intronic
1148109662 17:45137334-45137356 CAGCACCCAGAGGTGGGCCTGGG - Intronic
1149485183 17:57036995-57037017 AGGCAGCCACAGCTGGGTCTGGG + Intergenic
1150107456 17:62472770-62472792 CAGGAGAGACAGGTGGACCTGGG + Intronic
1150272286 17:63874187-63874209 CAGCTGACTCAGGTGGGCCCAGG - Intronic
1150275833 17:63897084-63897106 CAGCTGACTCAGGTGGGCCCAGG - Intergenic
1150277962 17:63911768-63911790 CAGCTGACTCAGGTGGGCCCAGG - Intronic
1150410437 17:64937090-64937112 CAGCAGACACATCTGAGCCGAGG + Intergenic
1151380136 17:73720091-73720113 CAGAAGGCACAGCCAGGCCTGGG - Intergenic
1151476417 17:74346526-74346548 TACCAGCCACAGCTGGGCCTGGG + Intronic
1151517131 17:74603880-74603902 CAACAGACGCAGCTGCACCTGGG + Intergenic
1151517136 17:74603904-74603926 CAGCAGACACAGCTGGGCCTGGG + Intergenic
1151517141 17:74603952-74603974 AAGCAGAAACAGCTGTGCCTGGG + Intergenic
1151517147 17:74604000-74604022 CAGCAGACCCAGCTTCACCTGGG + Intergenic
1151624256 17:75266821-75266843 CAGCAGCAGCAGCTGGGCCAGGG + Exonic
1151807733 17:76417024-76417046 CAGCACACACAGCTGGGGAGTGG - Intronic
1151902021 17:77022585-77022607 CAGCAGCCCCAGCTGTACCTGGG - Intergenic
1152239284 17:79153120-79153142 GGGCAGACACAGCTGGACCAGGG - Intronic
1152377507 17:79926454-79926476 CAGGCCACACAGCTGGGCTTTGG + Intergenic
1152401622 17:80070040-80070062 CACCAGACCGAGCTGAGCCTGGG - Intronic
1152423449 17:80206174-80206196 TGGCAAACTCAGCTGGGCCTGGG + Intronic
1152439058 17:80294225-80294247 CAGCTGGCACAGATGGCCCTTGG - Intronic
1152880541 17:82812219-82812241 CAGGACCCACAGCTGGGCCCGGG - Intronic
1154199328 18:12288242-12288264 CAGCTGAGACAGCTGGGGCGGGG + Intergenic
1155932516 18:31722611-31722633 CAGCAGGCTCAGCTTAGCCTAGG + Intergenic
1156370640 18:36468768-36468790 TGGCAGCCACAGCAGGGCCTGGG - Intronic
1156414311 18:36871823-36871845 CAGCAGACACAGCTGGAAATGGG + Intronic
1157066562 18:44357047-44357069 CAGCAGTCCCAGCTTGACCTGGG - Intergenic
1157204709 18:45688280-45688302 AAGGAGCCACAGCGGGGCCTGGG - Intergenic
1157238096 18:45982788-45982810 CAGAACACACAACTGGGGCTGGG - Intergenic
1158224527 18:55186901-55186923 CAGAAGACACACCTGGGAATGGG + Intergenic
1159908914 18:74125100-74125122 CAGCTGACACTGATGGGCATAGG + Intronic
1160439998 18:78882559-78882581 CACCAGAGACAGCAGGACCTGGG - Intergenic
1161038579 19:2098356-2098378 CAGCAAGCTCACCTGGGCCTGGG + Intronic
1161067938 19:2247723-2247745 CAGCAGGCACGGGTGGGGCTAGG - Intronic
1161914215 19:7216672-7216694 CAGGAGTCAGAGCAGGGCCTTGG - Intronic
1162087117 19:8255602-8255624 CAGGAGAGACAGCTGGGGCTGGG - Exonic
1162290526 19:9776658-9776680 AAGAAAAGACAGCTGGGCCTGGG - Intronic
1163075607 19:14888468-14888490 AAGAAAAGACAGCTGGGCCTGGG + Intergenic
1163328428 19:16620187-16620209 CAGCATAAACAGCTGGACCCAGG + Intronic
1163582219 19:18145666-18145688 CAGCAGACCCAGCCTGGGCTGGG + Intronic
1163616125 19:18329620-18329642 CATCAGATACAGCTGGGCTCAGG - Intergenic
1163786746 19:19278763-19278785 CAGCTGACAAAGATGGGCCGGGG - Exonic
1164708864 19:30340076-30340098 CAGCAGACACTCCTGGAGCTGGG - Intronic
1165059448 19:33197970-33197992 CAGCAGACAGGGCTGGGGCTAGG - Intronic
1165140617 19:33697867-33697889 CTGAAGACACAGCCGGCCCTGGG + Intronic
1166126938 19:40720594-40720616 GAGCAGACAAAGCTGGGCCATGG - Intronic
1166217940 19:41348337-41348359 CAGCAGACGCAGCTCTGCCCGGG + Exonic
1166356202 19:42229058-42229080 CAGAAGACAGGGCTGGACCTGGG + Intergenic
1166664378 19:44669970-44669992 CAGCACACACAACTGGGCACTGG + Intronic
1166697257 19:44859143-44859165 CATCAGACAGAGCTGGGCAGTGG + Intronic
1166854638 19:45777490-45777512 CCGGAGACACGGCTGGGCCGGGG - Exonic
1167053580 19:47095106-47095128 CAGCAGGCAATCCTGGGCCTGGG - Intronic
1167206817 19:48108076-48108098 AAGAAAAGACAGCTGGGCCTGGG - Intronic
1167377020 19:49117822-49117844 CAACACAGACAGCTGAGCCTGGG - Intronic
1167392833 19:49207852-49207874 AAGAAAAGACAGCTGGGCCTGGG + Intronic
1167667958 19:50833609-50833631 CCCCAGACCCAGCTGGGACTGGG - Intronic
1168107049 19:54172066-54172088 CAGAAGACAGCGATGGGCCTGGG + Exonic
1168351810 19:55680341-55680363 CAGCAGGAACAGCCAGGCCTGGG - Intronic
925183759 2:1833305-1833327 TAGCAGACGCAGCAGAGCCTAGG - Intronic
925409399 2:3631467-3631489 CACTGGGCACAGCTGGGCCTGGG - Intronic
926615245 2:14990963-14990985 GAGCAGGGACAGCTGAGCCTGGG + Intergenic
927012449 2:18919240-18919262 CAGGAGACACAGCTGACACTGGG + Intergenic
927056938 2:19373925-19373947 CAGCAGACGAAGCTGTACCTGGG + Intergenic
927217737 2:20677974-20677996 CAGCAGCAGCAGCTGGGCTTGGG + Intergenic
929997504 2:46837953-46837975 GAGCAGGCAGAGCTGGGCTTAGG + Intronic
930786619 2:55277521-55277543 CAGAAGACACAGCCGAGCCCAGG - Intergenic
932559500 2:72854977-72854999 CAACAGACACAGCTGAGCGGGGG - Intergenic
932918784 2:75885804-75885826 GAGCACACACACCTGGCCCTGGG - Intergenic
933834171 2:86232296-86232318 CAGCAGGCACAACTGGACCTGGG - Intronic
934247609 2:90321677-90321699 CTGCAGACACAGCTTCTCCTCGG - Intergenic
934261716 2:91480924-91480946 CTGCAGACACAGCTTCTCCTCGG + Intergenic
934784133 2:96992404-96992426 CACCAGGGACAGCAGGGCCTGGG - Intronic
935275700 2:101474061-101474083 CATCAGAAAGCGCTGGGCCTGGG + Intronic
935667230 2:105523253-105523275 CAGGAGACTCAGTTGAGCCTGGG + Intergenic
935712914 2:105914952-105914974 TAGTAGACACTGCTGGGGCTGGG - Intergenic
937716510 2:125038769-125038791 CAGCAGAAAGATCTGGGACTCGG + Intergenic
938114659 2:128594980-128595002 CAGCATACACAGCCAGGACTGGG + Intergenic
938130834 2:128714600-128714622 CATGTGACCCAGCTGGGCCTTGG + Intergenic
938192513 2:129296614-129296636 CACCAGACACTGCTGGGCTGGGG - Intergenic
938767605 2:134470764-134470786 CAGGAGAGCCATCTGGGCCTGGG - Intronic
938783050 2:134602773-134602795 CAGAAGACCCAGGAGGGCCTGGG - Intronic
944022796 2:195126062-195126084 CCGCAGCCTCAGCTGGGGCTTGG + Intergenic
946061570 2:216946252-216946274 CAGCAGGCCCTGCTGAGCCTAGG - Intergenic
946275821 2:218630824-218630846 CAGAAGCCACAGCAGAGCCTGGG - Intronic
947551668 2:231050911-231050933 CAGGAGCCCCAGCTGGGGCTGGG - Intergenic
947802301 2:232937517-232937539 CAGAAGACAGAGCAAGGCCTGGG - Intronic
948358565 2:237400643-237400665 CAGGAGAGACATCTGGTCCTGGG - Intronic
948543146 2:238704064-238704086 CAGCAGCTGCAGCTGGGGCTAGG + Intergenic
949053913 2:241914327-241914349 CAGCATCCCCACCTGGGCCTGGG - Intergenic
949064151 2:241979689-241979711 CAGCAAACACAGCCCGGCCCTGG - Intergenic
1171199997 20:23233171-23233193 CAGCAGTCACAGCTGGGGTTGGG - Intergenic
1171322240 20:24256393-24256415 CAAGAGACACAGCAGGGCATGGG + Intergenic
1172910997 20:38408709-38408731 CTGGAGAAACAGCTGGGCTTTGG - Intergenic
1173665031 20:44757199-44757221 CAGCAGGTACAGCTGGGCTTGGG + Intronic
1174453564 20:50634421-50634443 CACCAGACACAGCTAGGAGTGGG - Intronic
1175625579 20:60486063-60486085 CAGCAGAGGCAGCTGGGGGTGGG + Intergenic
1175681461 20:60991837-60991859 CCGGAGACACATCTGGGTCTGGG + Intergenic
1175794315 20:61762042-61762064 CAGCAGAGCCAGGTGGGCCCTGG - Intronic
1175874595 20:62223398-62223420 CAGCAGCAGCAGGTGGGCCTTGG - Intergenic
1176265738 20:64208406-64208428 GAGCAGAGCCAGCTGGGCCTGGG + Exonic
1177083290 21:16669312-16669334 CAGCAGATACAGCTGTTTCTAGG + Intergenic
1178886644 21:36490007-36490029 TAAGAGATACAGCTGGGCCTGGG - Intronic
1180074226 21:45454683-45454705 CAGCACCCACTGCTGTGCCTGGG + Intronic
1180143775 21:45908757-45908779 CAGGAGACAGAGCTGGGCTTTGG - Intronic
1180149301 21:45939630-45939652 GTGCAGACACCGCTGGGCCATGG + Intronic
1180167266 21:46036623-46036645 CAGAATTCAGAGCTGGGCCTGGG + Intergenic
1180247497 21:46557914-46557936 CTGCAGAGACAGGTGGGCCGTGG - Intronic
1180730113 22:17974956-17974978 TAGAAGACAGAGCTGGGCCCAGG + Intronic
1180940137 22:19655552-19655574 CAGTAAACCCAACTGGGCCTTGG - Intergenic
1181021674 22:20106801-20106823 CAGCACACACAGCTGGGCTCAGG - Intronic
1181031314 22:20149944-20149966 CAACAGTCCCAGGTGGGCCTGGG - Exonic
1181035542 22:20168240-20168262 CAGAACACAGAGCTGGGACTCGG - Intergenic
1181576847 22:23800709-23800731 CACCAGACACAGCACGGCCATGG - Intronic
1181849161 22:25737453-25737475 CAGAAGACACAGTTGGGTCAGGG + Intergenic
1182513426 22:30836734-30836756 CAGCAGACACAGCAGGCAATTGG + Intronic
1183172820 22:36200484-36200506 CGGCAGCCACAGCAGGGGCTAGG - Intronic
1183177375 22:36234008-36234030 CGGCAGCCACAGCAGGGGCTGGG - Intronic
1183820091 22:40339176-40339198 CAGCAAACAAAGGAGGGCCTGGG - Intergenic
1184158848 22:42686292-42686314 CTGCAGGCACAGCTGGGCCTAGG - Intergenic
1184352169 22:43951699-43951721 CAGCAGCTGCAGCTGGGCCTTGG - Intronic
1184507586 22:44913776-44913798 CTGCAGACTGAGCAGGGCCTGGG + Intronic
1184658274 22:45952923-45952945 CAGCAGACACAGCTGGGAGGCGG - Intronic
1184726144 22:46347799-46347821 CAGCAGAAGCAGCAGGGGCTGGG - Intronic
1185023863 22:48396536-48396558 CAGCAGACAGTGCTGGGAGTGGG + Intergenic
1185094501 22:48798896-48798918 CAGGAGAAACAGCTGAGCATGGG - Intronic
949414173 3:3799028-3799050 AACCAGACACAGTTCGGCCTGGG - Intronic
949965838 3:9355496-9355518 CAGCATATTCAGCAGGGCCTAGG - Intronic
950202883 3:11057311-11057333 CAGCTGACCCAGCTGGGTCAGGG - Intergenic
950476531 3:13218677-13218699 CGACAGACACCTCTGGGCCTGGG - Intergenic
950589912 3:13929701-13929723 CAGCAGGGGCAGCTGGCCCTAGG - Intergenic
950921017 3:16694974-16694996 CAGGAGGCATAGCTGGGCCAGGG - Intergenic
951228800 3:20152261-20152283 CAGCTGACAAAACTGGGACTGGG - Intronic
952754592 3:36855372-36855394 CAGCAGCGCCAGCTCGGCCTGGG + Exonic
952970458 3:38647664-38647686 CACCAGAGACAGCTGGGGATGGG - Intronic
954145537 3:48632625-48632647 CAGTAGACACAGGTGGGACAGGG - Intronic
956956665 3:74348991-74349013 CAGGAGACACATGTGAGCCTAGG + Intronic
957048484 3:75394574-75394596 CAGGAGCCACAGCGGGCCCTGGG + Intergenic
957409493 3:79819642-79819664 CAGAGGACAAAGCTGGACCTTGG + Intergenic
960162471 3:114365435-114365457 CAGCAGGCAGAGCTGGCCCAGGG - Intronic
961214598 3:125149320-125149342 CAGTAGAGACAGCTGGGTTTTGG + Intronic
961235154 3:125359954-125359976 CAGCTGGCACAACTGGGCCTGGG + Intronic
961370450 3:126425439-126425461 CAGCAAACCCATCTGAGCCTGGG - Intronic
961427361 3:126858593-126858615 AGGCAAACACAGGTGGGCCTGGG - Intronic
961530178 3:127535889-127535911 CAGCAGACACAGCTGTGTGCTGG - Intergenic
961545641 3:127630927-127630949 GGGCAGTTACAGCTGGGCCTGGG - Intronic
961572178 3:127807098-127807120 CAGCAAAACCATCTGGGCCTGGG + Intronic
963103019 3:141623621-141623643 CAGCAGCCACAGGCGGGCCAAGG - Intergenic
964087450 3:152835132-152835154 CTCCGGACAGAGCTGGGCCTGGG + Exonic
965310124 3:167116554-167116576 GAGGAGGCACAGCTGGGCCAGGG - Intergenic
965664625 3:171079929-171079951 CAGCAGACACTGCTTTGCATTGG - Intronic
965806003 3:172542585-172542607 CAGCAGAGACTGCTGGACCATGG - Intergenic
966012492 3:175098155-175098177 CAGCAGACACAGAAGGGTATAGG - Intronic
968264543 3:197352676-197352698 CTGCAGACACAGCGGGGGCAGGG - Intergenic
968456598 4:703685-703707 CAGCAGACTCAGGATGGCCTGGG + Intergenic
968502515 4:957502-957524 CAGCAAACACAGGAGAGCCTCGG + Intronic
968529661 4:1084635-1084657 CAGCAGAATCACCTGAGCCTTGG + Intronic
968563917 4:1299376-1299398 GAGCAGCAGCAGCTGGGCCTGGG - Intronic
969617642 4:8262818-8262840 CAGCACCCACAGCTGGGCCTGGG + Intergenic
969840439 4:9877809-9877831 CAGCAGACCCAGAAGAGCCTGGG - Intronic
969884669 4:10204759-10204781 CAGCAGTCACACATGAGCCTTGG - Intergenic
970155680 4:13139686-13139708 CAGCAGAGACAGGTGGCTCTTGG - Intergenic
971604020 4:28633885-28633907 CAGAAGATACTGCTGGTCCTTGG - Intergenic
974027519 4:56746715-56746737 CAGCTCACTCAGCTGGGACTAGG + Intergenic
974240023 4:59235311-59235333 AAGAAAAGACAGCTGGGCCTGGG + Intergenic
974493450 4:62596023-62596045 AAGAAAAGACAGCTGGGCCTGGG - Intergenic
975348204 4:73318393-73318415 CTGGTGACACAGCTGGGCATTGG - Intergenic
976751618 4:88456045-88456067 CAACTGACAAGGCTGGGCCTGGG - Intergenic
977069987 4:92373413-92373435 GGGCTGACACAGCTGGGCCATGG - Intronic
978308059 4:107353912-107353934 AAGAAAAGACAGCTGGGCCTGGG + Intergenic
978502590 4:109424821-109424843 AAGGAAACACAGCTGGGCCCAGG - Intergenic
980493424 4:133560324-133560346 CAGCTTCCACAGCTGGGACTAGG + Intergenic
981701673 4:147614202-147614224 CAACAGTCACAGCTGAGCCCAGG - Intergenic
981809625 4:148759066-148759088 AGGTAAACACAGCTGGGCCTGGG - Intergenic
984255232 4:177382217-177382239 AAGGAGGCAGAGCTGGGCCTGGG - Intergenic
985291301 4:188390948-188390970 AAGAAAAGACAGCTGGGCCTGGG + Intergenic
985427310 4:189843492-189843514 CAGCAGCTGCGGCTGGGCCTAGG - Intergenic
985683825 5:1271367-1271389 CTGCAGACACACATGGGCTTAGG + Intronic
985709504 5:1420276-1420298 GAGGAGACTCAGCTGGGCCATGG - Intronic
985922235 5:2986421-2986443 CTGCAGACACTGCTGGGCTGGGG - Intergenic
987037578 5:14033452-14033474 CTGTAGATACAGCTGGTCCTGGG - Intergenic
991016699 5:61940860-61940882 CAGCAGCCATGGCTGAGCCTAGG - Intergenic
992030423 5:72715775-72715797 CAGCAGACCCAGCTCAGCCATGG + Intergenic
993729746 5:91408389-91408411 CAGTAGAAAGAGCTGGGCTTTGG - Intergenic
994516214 5:100775538-100775560 AAGAAAAGACAGCTGGGCCTGGG - Intergenic
996642062 5:125767426-125767448 CAGCAAAGACATCTGGCCCTGGG + Intergenic
996791107 5:127294019-127294041 CAGCATATACAGCTGGGTCATGG - Intronic
997195010 5:131973505-131973527 CAGCAGCCAGAGCTGGGTCAGGG - Intronic
997580704 5:135015018-135015040 CAGCAGACCCATCTGGGGCCAGG - Intergenic
998500700 5:142630259-142630281 CAGCTAACACAGCTGGGACTAGG - Intronic
999028259 5:148260025-148260047 CAGCAGAAAAAGCTGAGCCCTGG + Intergenic
999254049 5:150199757-150199779 CTTCAGGCACAGCTGGGTCTAGG + Intronic
1000028003 5:157376829-157376851 CTGCAGACTCTGCAGGGCCTAGG + Intronic
1000930983 5:167251182-167251204 GAGCACACAAAGCTGGACCTTGG - Intergenic
1001555098 5:172631735-172631757 CTGCAGCCTCAGCTGGTCCTGGG + Intergenic
1001936274 5:175708092-175708114 CAGAACACACAGCTGGGTGTGGG + Intergenic
1002079551 5:176729152-176729174 GAGCAGGCAAAGCTGGGCCAAGG - Intergenic
1002560268 5:180076917-180076939 CTGCAGCCACAGCTGGGGGTGGG - Intergenic
1005670280 6:28098914-28098936 CAGGAGATACAGCTGGGCCAGGG - Intergenic
1005815064 6:29543910-29543932 CAGTAGAGACATCTGGGCCTGGG + Intergenic
1006011783 6:31048377-31048399 CAGCAGAGGGAGCTGGGGCTGGG + Intergenic
1006394425 6:33777882-33777904 CAGGAGGCACAGCAGGGGCTTGG - Intronic
1006799167 6:36748563-36748585 CAGCCTACACAGGTGGGCCCAGG - Intronic
1006915624 6:37592005-37592027 GGGCACACACAGCTGGGCCGGGG + Intergenic
1007075592 6:39064303-39064325 CAGCAGTCAGAACTGGGTCTCGG - Intronic
1007097572 6:39223308-39223330 CAGCTGCCACTGCGGGGCCTTGG - Intronic
1007323608 6:41043935-41043957 CAGCAGGTGCAGCAGGGCCTGGG - Exonic
1007594586 6:43043652-43043674 CTGCAGACATGGCTGTGCCTTGG - Intronic
1008466737 6:51839972-51839994 AAGAAGACAGAGCTGGGGCTTGG - Intronic
1009975138 6:70664051-70664073 AAGCAGACACAGCTATTCCTGGG - Intergenic
1010862542 6:80931371-80931393 CAGGAGAATCACCTGGGCCTGGG - Intergenic
1011575177 6:88789698-88789720 CACCAAACACAGTTGGGCCAAGG + Intronic
1011594140 6:88999942-88999964 CAGGAGATACAGCTGGGTCAGGG - Intergenic
1012169608 6:96002219-96002241 GAGCTGTCACAGCTTGGCCTGGG - Intergenic
1013470334 6:110458351-110458373 AAGAAAAGACAGCTGGGCCTGGG - Intronic
1014205744 6:118652792-118652814 CATCAGAAACAGCTGACCCTTGG - Exonic
1014644661 6:123958363-123958385 GAGCAGACACTGCTGTCCCTGGG - Intronic
1014796061 6:125725597-125725619 CAGCAGACAGAGCTGGGAAATGG - Intergenic
1015169008 6:130230276-130230298 CAGCAGTAACAGCTGGGCAGGGG + Intronic
1015301760 6:131660461-131660483 CAGCAGACAAAGAAGGGCCAGGG + Intronic
1016323144 6:142870115-142870137 CTGCAGACCCAGGTGGGTCTTGG - Intronic
1018742797 6:166743515-166743537 CAGCAGAAAGTGCTGGTCCTTGG + Intronic
1018985504 6:168633647-168633669 CAGGAGACACAGAAGGGCCAAGG + Intronic
1019292150 7:256069-256091 CGGCAGAGGGAGCTGGGCCTGGG + Intronic
1019306450 7:337590-337612 TTGCAGACACAGGTGGGCATGGG - Intergenic
1019447269 7:1077892-1077914 CAGCAGCCCCAGCGCGGCCTCGG + Intronic
1019693696 7:2432644-2432666 CAGCCGGAACAGCCGGGCCTTGG - Exonic
1019802811 7:3100812-3100834 CAGCAAACACTGCAGGGCCGGGG + Intergenic
1019838423 7:3414075-3414097 CAGCAGAGATAGCTATGCCTTGG + Intronic
1020568114 7:9822791-9822813 GAGCAGCCACAGCTGTGCCCAGG + Intergenic
1022158132 7:27680794-27680816 CAGCAGAAAGACCTGGACCTAGG - Intergenic
1022417056 7:30187608-30187630 CAGCAGCCTGAGCTGTGCCTTGG + Intergenic
1022942426 7:35253722-35253744 GAGCAGTCACAGCGGGGCCAGGG + Exonic
1023048043 7:36228596-36228618 CTGCAGACACAGCTGGGGCCAGG + Intronic
1024425126 7:49216293-49216315 CCGCAGTCACAGCTGATCCTGGG - Intergenic
1024770677 7:52718327-52718349 CATCAGACACTGCAGAGCCTCGG + Intergenic
1024786334 7:52911593-52911615 GGGCAGCCACAGCTGTGCCTGGG + Intergenic
1027365681 7:77455481-77455503 CAGCAGACACAGCTGTTCTGAGG - Intergenic
1027426013 7:78062193-78062215 AAGCAGAAACAACAGGGCCTGGG + Intronic
1027631555 7:80612010-80612032 CAGCACTCACTGCTTGGCCTTGG - Intronic
1030703079 7:112662429-112662451 CAGCAGTCTGAGCTGGACCTGGG - Intergenic
1030752167 7:113241681-113241703 CAGCAGCCTCAGCTGTACCTTGG - Intergenic
1033587794 7:142787247-142787269 GAGCAGTCACAGCTGAGCCCAGG + Intergenic
1033828196 7:145218413-145218435 CAGGAGCCATAGCTGGGTCTAGG + Intergenic
1034515149 7:151571162-151571184 CAGGAGACTCGCCTGGGCCTGGG - Intronic
1034557539 7:151859616-151859638 CAGCAGACCCAGCCGGGCTTGGG - Intronic
1035048513 7:155984519-155984541 CTGCAGAGATACCTGGGCCTGGG + Intergenic
1035128806 7:156631623-156631645 TAGGAGACAAAGCTGGGCCAAGG - Intergenic
1035303964 7:157917854-157917876 CAGCAGGCCGAGCTGGGGCTGGG + Intronic
1035383066 7:158452626-158452648 CAGCGGACACCTCTGGGCTTGGG + Intronic
1037516633 8:19638269-19638291 CAGCAGACACAGTTGAGGCAGGG - Intronic
1038346961 8:26741611-26741633 CAGCAGAGACACCTGTGCCATGG + Intergenic
1039745677 8:40424121-40424143 CAGCAGAAACAGCAGCTCCTTGG - Intergenic
1040550429 8:48433053-48433075 CAGCAGGCACAGCTGCACCCAGG - Intergenic
1041205401 8:55494232-55494254 CAGCACCCACAGCTGGCACTAGG + Intronic
1042688010 8:71462653-71462675 GAGAAGGCAGAGCTGGGCCTGGG - Intronic
1043738448 8:83775973-83775995 CAGGAGTCTGAGCTGGGCCTTGG + Intergenic
1043875794 8:85484603-85484625 CAGCAGACACAGATGGAGCCAGG - Intergenic
1045801633 8:106108857-106108879 CAGAAGGCACAGCTGGGTCTGGG + Intergenic
1046638952 8:116703807-116703829 AAGAAAAGACAGCTGGGCCTGGG - Intronic
1048961975 8:139587601-139587623 CAGCAGACACACCTCTGACTTGG + Intergenic
1049122168 8:140748398-140748420 CAGCAGACTCACTTGAGCCTGGG + Intronic
1049217059 8:141413086-141413108 CAGCAGACACAGCTGACTCCAGG - Intronic
1049427204 8:142542781-142542803 CAGCACACCCAGCAGGGCCAGGG - Intronic
1049435044 8:142582594-142582616 CAGCAGAGACAGCTAGGGCGTGG + Intergenic
1049558362 8:143295105-143295127 CAGAAGGCAGAGCTGGGCCGTGG + Intronic
1049578104 8:143398769-143398791 CAGTACCCACAGCTGGGCCTGGG - Intergenic
1049753640 8:144297752-144297774 CAGCAGATACAGCTTTGACTTGG + Intronic
1049846516 8:144804599-144804621 AAGAAAAGACAGCTGGGCCTGGG + Intronic
1049881412 8:145066687-145066709 AAGAAAAGACAGCTGGGCCTGGG - Intergenic
1050774219 9:9239759-9239781 CAGGAGTCACAACTGGGCCAGGG - Intronic
1050913643 9:11104812-11104834 CAGGAGGCACACCTGGGCCAGGG - Intergenic
1051836258 9:21341479-21341501 CAGGGGAGACAGCAGGGCCTAGG - Intergenic
1053164506 9:35835064-35835086 CAGGGGACACAGCTGTGCCTGGG + Exonic
1055813424 9:80178109-80178131 CAGCAGCCAGAGCTGTACCTGGG + Intergenic
1056549061 9:87636259-87636281 CAGGGGACACAGCAGGGCCTGGG - Intronic
1057206311 9:93175043-93175065 CAGCACACAGGGTTGGGCCTGGG + Intergenic
1058040686 9:100298420-100298442 AAGCACGCACAGCTGAGCCTGGG - Intronic
1059029233 9:110672355-110672377 CTGAAGACCCAGCTGGGGCTAGG + Intronic
1059395083 9:114029025-114029047 CACCTGCCACAGCTGTGCCTGGG + Intronic
1060661672 9:125408399-125408421 CAGCTGCCACCGCTGGGCCTCGG + Intergenic
1060895957 9:127217604-127217626 CAGCAGAGCCACCAGGGCCTTGG + Intronic
1060967187 9:127717838-127717860 AAGGAGACAGAGCTGGGCCCAGG - Intronic
1061037207 9:128120507-128120529 CAGGGCACACAGCTGGGCCGTGG - Intergenic
1061579238 9:131526773-131526795 CTGCAGACACAGCTGTCCCCAGG - Intronic
1061785590 9:133026049-133026071 AAGAAAAGACAGCTGGGCCTGGG - Intergenic
1061805940 9:133137873-133137895 CACCAGCCACGGCTGTGCCTTGG - Intronic
1061964430 9:134005052-134005074 CTGGGGACACAGCTGGGCATGGG - Intergenic
1062004203 9:134231139-134231161 CTGCAGACACAGGCGGACCTGGG + Intergenic
1062270798 9:135707476-135707498 CAGCAGCCACAGCGTGGCCGGGG + Intronic
1062436789 9:136549963-136549985 CTGCAGGCACCCCTGGGCCTGGG - Intergenic
1062477360 9:136735334-136735356 CAGCAGAGACAGCTGCGGCCGGG - Intergenic
1062484322 9:136767184-136767206 AAGAAAAGACAGCTGGGCCTGGG - Intergenic
1062577139 9:137214100-137214122 CAGCAGACCCAACCTGGCCTGGG + Intronic
1185724140 X:2405702-2405724 CAGGAGAAACACTTGGGCCTGGG + Intronic
1186109208 X:6238046-6238068 TAGCACAGACATCTGGGCCTAGG + Intergenic
1186858919 X:13652286-13652308 CGGCAGTCACAGCTGGGCCTTGG + Intergenic
1186863635 X:13697155-13697177 CAGCAGACAAAGCTAGGGGTTGG - Intronic
1187312621 X:18160240-18160262 CAGCAGACAAGGGTGGGACTAGG - Intergenic
1187888266 X:23909003-23909025 TGGCAGTCACAGCTGGGCCTTGG - Intronic
1188934236 X:36153769-36153791 CAGCAGACCCAGGTGTGGCTTGG - Intergenic
1189471947 X:41321622-41321644 CAGCAGGGACACCTGGGCCAAGG - Intergenic
1189664927 X:43343795-43343817 CAGTGGACCCAGCTGGGCGTGGG - Intergenic
1192758171 X:74067262-74067284 CAGCAGGGACACCTGGGCCAAGG + Intergenic
1193611318 X:83634850-83634872 AAGAAAAGACAGCTGGGCCTGGG + Intergenic
1193986552 X:88248848-88248870 CAGCATAGACACCTGGGCATGGG + Intergenic
1194128616 X:90051175-90051197 CAGGAGATAGAGCTGGGCCAGGG - Intergenic
1195368553 X:104150427-104150449 TGGCACTCACAGCTGGGCCTTGG + Intronic
1196075470 X:111570921-111570943 CAGGAGGCACAGCTGGGTCAGGG - Intergenic
1197569510 X:128131740-128131762 CAGAAGACAAAGCTGAGCTTTGG + Intergenic
1199196101 X:145032709-145032731 CAGCAGCCAGAGCTGTACCTTGG - Intergenic
1199442193 X:147881013-147881035 CAGGAGGCAGAGCTGGGCCAGGG - Intergenic
1199610025 X:149605156-149605178 TAGCAGACCCAGCTGTGCATAGG + Intronic
1199927375 X:152481113-152481135 CAGAAGACACACCTGAGGCTCGG + Intergenic
1200684132 Y:6245042-6245064 CAGCGGGCACAGCTTGGCCCTGG - Intergenic
1201048503 Y:9909344-9909366 CAGCGGGCACAGCTTGGCCCTGG + Intergenic
1201059924 Y:10036445-10036467 CAGCAGGCACAGCCTGGCCCTGG + Intergenic
1201708202 Y:16959829-16959851 AAGAAAAGACAGCTGGGCCTGGG - Intergenic
1201748436 Y:17405782-17405804 AAGAAAAGACAGCTGGGCCTGGG - Intergenic
1202115877 Y:21468425-21468447 CAGCGGGCACAGCTTGGCCCTGG + Intergenic
1202197147 Y:22307671-22307693 CAGCAGGCCCAGCCTGGCCTTGG - Intergenic