ID: 1151520656

View in Genome Browser
Species Human (GRCh38)
Location 17:74627019-74627041
Sequence ACTTTTAAGGGGATTGTAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151520650_1151520656 -1 Left 1151520650 17:74626997-74627019 CCCTGAGAAGTTCTGGGCTGGGA No data
Right 1151520656 17:74627019-74627041 ACTTTTAAGGGGATTGTAGAGGG No data
1151520643_1151520656 14 Left 1151520643 17:74626982-74627004 CCCTCAAATCCATCTCCCTGAGA No data
Right 1151520656 17:74627019-74627041 ACTTTTAAGGGGATTGTAGAGGG No data
1151520646_1151520656 5 Left 1151520646 17:74626991-74627013 CCATCTCCCTGAGAAGTTCTGGG No data
Right 1151520656 17:74627019-74627041 ACTTTTAAGGGGATTGTAGAGGG No data
1151520651_1151520656 -2 Left 1151520651 17:74626998-74627020 CCTGAGAAGTTCTGGGCTGGGAC No data
Right 1151520656 17:74627019-74627041 ACTTTTAAGGGGATTGTAGAGGG No data
1151520644_1151520656 13 Left 1151520644 17:74626983-74627005 CCTCAAATCCATCTCCCTGAGAA No data
Right 1151520656 17:74627019-74627041 ACTTTTAAGGGGATTGTAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151520656 Original CRISPR ACTTTTAAGGGGATTGTAGA GGG Intergenic
No off target data available for this crispr