ID: 1151523209

View in Genome Browser
Species Human (GRCh38)
Location 17:74645898-74645920
Sequence AGAATGGTGTGAACCCCAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2703
Summary {0: 18, 1: 377, 2: 450, 3: 646, 4: 1212}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151523204_1151523209 0 Left 1151523204 17:74645875-74645897 CCTACTCGGGAGGCTGAGGCAAG 0: 42
1: 1100
2: 3120
3: 3275
4: 3353
Right 1151523209 17:74645898-74645920 AGAATGGTGTGAACCCCAGGGGG 0: 18
1: 377
2: 450
3: 646
4: 1212
1151523201_1151523209 4 Left 1151523201 17:74645871-74645893 CCCACCTACTCGGGAGGCTGAGG 0: 993
1: 105910
2: 293918
3: 225450
4: 121505
Right 1151523209 17:74645898-74645920 AGAATGGTGTGAACCCCAGGGGG 0: 18
1: 377
2: 450
3: 646
4: 1212
1151523203_1151523209 3 Left 1151523203 17:74645872-74645894 CCACCTACTCGGGAGGCTGAGGC 0: 911
1: 100187
2: 265964
3: 218395
4: 132820
Right 1151523209 17:74645898-74645920 AGAATGGTGTGAACCCCAGGGGG 0: 18
1: 377
2: 450
3: 646
4: 1212

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151523209 Original CRISPR AGAATGGTGTGAACCCCAGG GGG Intergenic
Too many off-targets to display for this crispr