ID: 1151523495

View in Genome Browser
Species Human (GRCh38)
Location 17:74647853-74647875
Sequence CGGTGGTGTCCTTTATCTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151523495_1151523501 6 Left 1151523495 17:74647853-74647875 CCTGGAGATAAAGGACACCACCG No data
Right 1151523501 17:74647882-74647904 CTCAGATGCCCCAAGCTAAATGG No data
1151523495_1151523505 22 Left 1151523495 17:74647853-74647875 CCTGGAGATAAAGGACACCACCG No data
Right 1151523505 17:74647898-74647920 TAAATGGACCCAGCAAAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151523495 Original CRISPR CGGTGGTGTCCTTTATCTCC AGG (reversed) Intergenic
No off target data available for this crispr