ID: 1151535986

View in Genome Browser
Species Human (GRCh38)
Location 17:74738950-74738972
Sequence CATAGTGGGTAGAAGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 383
Summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 352}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151535986_1151535993 -3 Left 1151535986 17:74738950-74738972 CCCTCCTCCTTCTACCCACTATG 0: 1
1: 0
2: 1
3: 29
4: 352
Right 1151535993 17:74738970-74738992 ATGGAAACCATGCCACAGAAAGG 0: 1
1: 0
2: 1
3: 28
4: 318
1151535986_1151535997 28 Left 1151535986 17:74738950-74738972 CCCTCCTCCTTCTACCCACTATG 0: 1
1: 0
2: 1
3: 29
4: 352
Right 1151535997 17:74739001-74739023 TCTTCCTAAAGTCACACAGTAGG 0: 1
1: 1
2: 6
3: 62
4: 417
1151535986_1151535994 3 Left 1151535986 17:74738950-74738972 CCCTCCTCCTTCTACCCACTATG 0: 1
1: 0
2: 1
3: 29
4: 352
Right 1151535994 17:74738976-74738998 ACCATGCCACAGAAAGGTTAAGG 0: 1
1: 0
2: 3
3: 19
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151535986 Original CRISPR CATAGTGGGTAGAAGGAGGA GGG (reversed) Intronic
900665128 1:3810111-3810133 TTTATTGGGTAGCAGGAGGAGGG - Intergenic
901059919 1:6467257-6467279 CAGTGAGGGTAGAAGTAGGATGG + Exonic
905164584 1:36071491-36071513 AATAGTGTGGAAAAGGAGGATGG - Exonic
905362645 1:37431086-37431108 CAGAGTGGATAGGAGAAGGAGGG + Intergenic
906610933 1:47202003-47202025 CATTGTGGGGAGAGGGAGCATGG + Intergenic
907347071 1:53791026-53791048 GGTAGAGGGTAGGAGGAGGATGG - Intronic
907393557 1:54174400-54174422 CCTACTATGTAGAAGGAGGATGG - Exonic
907443084 1:54490373-54490395 AATAGTTGGTAGCAAGAGGATGG + Intergenic
907706257 1:56835069-56835091 CACAGATGGTAGAAGGAGCAAGG - Intergenic
908000145 1:59671522-59671544 CAGAGTAGGTGGAGGGAGGAAGG + Intronic
908204552 1:61832177-61832199 GGTAGAGGGTAGAAGGAGGGTGG + Intronic
908565032 1:65345702-65345724 CCTGGTGGGTAGTAGGAGGTTGG - Intronic
910835538 1:91505248-91505270 CATTGTGGCTAGAATGGGGAAGG + Intronic
911037869 1:93569419-93569441 CATGGTGGGCAGCAGGAGGAAGG - Intronic
911049673 1:93660110-93660132 CATAGAGTGTAGTGGGAGGAAGG - Intronic
914850661 1:151311520-151311542 CATTTTGGGTAGAAGGTGGTGGG + Intronic
920092461 1:203464318-203464340 AAGTGTGGGCAGAAGGAGGAAGG - Intergenic
922268101 1:224006266-224006288 CATACTTGGTAGAGGGAGGTAGG - Intergenic
923010304 1:230083163-230083185 CAGAGTGGGGAGCAGGATGATGG + Intronic
924493035 1:244558735-244558757 CAGAGTGGGCAGGAGGAGAAGGG - Intronic
1063225759 10:4013414-4013436 CAAAGTGGGGAGGAGAAGGAAGG - Intergenic
1063430954 10:5987871-5987893 CAGAGTGGGGAGAAGGCGGGTGG + Intergenic
1064362284 10:14677092-14677114 CCTTGTGGATAGAAAGAGGAGGG - Intronic
1064823413 10:19366054-19366076 CATACTGGGGAGTAGGGGGAAGG + Intronic
1065423020 10:25568107-25568129 CAAAGTGGGTTGGAGAAGGAAGG + Intronic
1066725596 10:38389343-38389365 CATACTTGGTAGAGGGAGGTAGG + Intergenic
1067475664 10:46564271-46564293 CATATTGGGTGTAAGGAGGCAGG + Intergenic
1067619072 10:47777504-47777526 CATATTGGGTGTAAGGAGGCAGG - Intergenic
1067908118 10:50315542-50315564 GATAGTGGGCAGATGGAGGAAGG - Intronic
1069060626 10:63891072-63891094 CAAAGGGGAAAGAAGGAGGAGGG - Intergenic
1070041120 10:72781090-72781112 TGTAGTGGGCAGAAAGAGGATGG + Intronic
1070354586 10:75627303-75627325 CAAAGTGGGAAGCAGGTGGAAGG + Intronic
1070712299 10:78691568-78691590 TAGAGTGGGTAGATGGAAGATGG + Intergenic
1071796896 10:89017723-89017745 CAGCGAGGGCAGAAGGAGGAAGG - Intergenic
1072009370 10:91290241-91290263 CAGAGTGGGAAGCAGGAGGAGGG + Intergenic
1072439892 10:95445056-95445078 CTGAGAGGGTAGAAGGAGAATGG + Intronic
1072747721 10:97953111-97953133 CATGGTGGGTGCAAGGAGGAAGG - Intronic
1073068143 10:100776237-100776259 CATAGGGAGTAAAAGGAGGCAGG - Intronic
1074075736 10:110122589-110122611 AATAGTGGTTACAAGGAGGTGGG - Intronic
1074570657 10:114621136-114621158 AATAGTGGATAAAAAGAGGATGG - Intronic
1075721818 10:124591978-124592000 CAAGGTGGGGAGAAGGAGGCAGG - Intronic
1075907429 10:126093768-126093790 CATGGTGTGTACAAGGAAGAGGG - Intronic
1076468240 10:130700586-130700608 AACAGTGGGTGGAAGGAGCAAGG + Intergenic
1077455984 11:2681214-2681236 AAGAGTGGGTAGAAGGAAGCAGG + Intronic
1077921861 11:6647340-6647362 CAGAGCTGGAAGAAGGAGGAGGG + Intronic
1078746282 11:14118665-14118687 GATAATGGGGAGAAGTAGGATGG - Intronic
1079613029 11:22456844-22456866 CATGGAGGTTAGAAGGAAGATGG - Intergenic
1079771928 11:24473577-24473599 TATAGAGGATAGAATGAGGAAGG + Intergenic
1081340760 11:41924424-41924446 CATTGTGGGGAGAGGGAGGAAGG - Intergenic
1083293668 11:61703652-61703674 GTGAGTGGGTAGATGGAGGATGG + Intronic
1083675624 11:64323235-64323257 CAAGGTGGGTAGCAGGAGTAGGG + Intergenic
1083704449 11:64504419-64504441 CATATTTGGTTGAAAGAGGAGGG - Intergenic
1084162770 11:67359090-67359112 CATGGTGGGCAGAAGTAGAAGGG - Intronic
1084190421 11:67496139-67496161 GATAAAGGGGAGAAGGAGGAGGG - Intronic
1084941466 11:72615488-72615510 CAGAGTGGGTAGAGGGAGGGAGG + Intronic
1085300161 11:75453170-75453192 CAGACTGGGGAGGAGGAGGAAGG + Intronic
1085751614 11:79167240-79167262 CACAGTGGGAAGAAGGGAGAAGG + Intronic
1085808012 11:79654210-79654232 GACAGTGGGAAGGAGGAGGAAGG + Intergenic
1086348165 11:85919062-85919084 CATAGTGGGTTAATGGGGGAGGG - Intronic
1088560617 11:111112104-111112126 AAAAGGGGGGAGAAGGAGGAAGG + Intergenic
1089061034 11:115626275-115626297 GATAGTGAATAGAAAGAGGAGGG - Intergenic
1089254413 11:117186708-117186730 CCTAGGGGGTTGGAGGAGGAAGG + Intronic
1089477670 11:118778567-118778589 CTTACTGGGTTGGAGGAGGAGGG + Intronic
1089477950 11:118780987-118781009 CTTACTGGGTTGGAGGAGGAGGG + Intronic
1089545846 11:119224816-119224838 CATGTTGAGTAGGAGGAGGAGGG + Intronic
1089693189 11:120199287-120199309 CACAGTGGGAAGAAGGAGTCCGG + Intergenic
1090505656 11:127310841-127310863 CATAGTGGGTATAAAGAGAACGG - Intergenic
1090789431 11:130077887-130077909 AATAGTGGGTAGAAGCAGCAAGG - Intronic
1091443989 12:533081-533103 CACTGTGGGGAGGAGGAGGATGG - Intronic
1092787255 12:12038306-12038328 CATAGTGGGAGCAGGGAGGATGG + Intergenic
1092892428 12:12981186-12981208 CAGGGTGGGTAGGAGGAGGGAGG + Intronic
1095477912 12:42604586-42604608 CATAGCGGGTAGAGAGAGCAGGG - Intergenic
1095854170 12:46842380-46842402 CATAGTGTGGAGGAGGAGGAGGG + Intergenic
1097922475 12:65090970-65090992 CATTGTGGGTATAGGGAGTAAGG + Intronic
1098275067 12:68804805-68804827 CACAGTGGGAAGGAGGAGAAGGG + Intergenic
1098342497 12:69467202-69467224 CCTAGTGGGTAGAGGCAGGCGGG + Intergenic
1098834372 12:75403675-75403697 CAAAGGTGGTATAAGGAGGAAGG - Intronic
1099567454 12:84270709-84270731 CAAAGTGGGTAGAAAAAGAATGG + Intergenic
1099958070 12:89370610-89370632 CCTAGAGGGAAGAGGGAGGAGGG - Intergenic
1100574987 12:95882719-95882741 AAGAATGGGTAGAAGGAGAAGGG - Intronic
1103724358 12:122990399-122990421 CCTGGTGGGTAGAGGGAGGGAGG - Intronic
1104058528 12:125248801-125248823 CACAGTGGGCAGAGGGAGAAGGG - Intronic
1106218321 13:27722541-27722563 AATAGTGGTTAAAAGGGGGAAGG - Intergenic
1106418263 13:29564080-29564102 AATAGTGGGGAGAAAGAGGAAGG + Intronic
1106576342 13:30979108-30979130 AATCCTGGGTAGAAGGAAGAGGG - Intergenic
1107564632 13:41589577-41589599 CTTTGTGGGGAGAGGGAGGAAGG - Intronic
1108002282 13:45915311-45915333 CAGAGTGGGTACAGGGAGCAGGG - Intergenic
1108668438 13:52655491-52655513 GATAGTGGATAGCAGGAAGATGG + Intronic
1108953490 13:56120075-56120097 CACAGTGGGTAGTAGGAAGGTGG - Intergenic
1109083848 13:57944174-57944196 GATAATGGGTAGAGGCAGGAGGG + Intergenic
1110910924 13:80962087-80962109 CATATTTGGTAGAACAAGGAAGG - Intergenic
1111303883 13:86381810-86381832 CTTAGAGGGTAGAAGCAAGATGG - Intergenic
1111608972 13:90578732-90578754 AATAATGGGTAGAAGCTGGAAGG - Intergenic
1111695264 13:91615310-91615332 CATACTAGTTAGAAGAAGGAGGG + Intronic
1112247836 13:97750552-97750574 CAGAGAGGGGAGAAAGAGGAGGG - Intergenic
1112581941 13:100683902-100683924 ACTAGTGGGTAGAAGTTGGAAGG + Intergenic
1112617870 13:101023899-101023921 GATAGTCACTAGAAGGAGGATGG - Intergenic
1113187187 13:107701923-107701945 CATATTGGTTGGAAAGAGGAGGG + Intronic
1115451890 14:33557376-33557398 CATTGTGGGTAGAAGACAGAGGG - Intronic
1115778337 14:36741004-36741026 AATAGTGGGTAGACAGGGGAAGG + Intronic
1116479938 14:45385468-45385490 CATACCCGGAAGAAGGAGGAAGG + Intergenic
1117292201 14:54344759-54344781 CAGAGTGGGGAGGAGGAGCATGG - Intergenic
1117621917 14:57595907-57595929 GATAGTGGGTTGAGGGTGGAGGG + Intronic
1117654067 14:57936594-57936616 TCTAGTGGGTAGAGGGAGGTAGG + Intronic
1117833025 14:59772515-59772537 AATATTGGGGAGAAAGAGGAAGG - Intronic
1118150418 14:63183070-63183092 CACAGTGGGTAATAGGATGAAGG - Intergenic
1119216798 14:72875635-72875657 CATGGTGGGGAGCAGGAGGCTGG - Intronic
1120806077 14:88752622-88752644 AATACTGGGTAGAAGAAGGTGGG + Intronic
1121489128 14:94345535-94345557 CATGGTGGGAAGAGGGAAGAAGG - Intergenic
1123154368 14:106210147-106210169 CAGAGCGGGTGGAAGGAGGCTGG - Intergenic
1124592442 15:31065268-31065290 CAGAGTGGGTAGAATGGGGATGG - Intronic
1124787850 15:32698674-32698696 CAGAGTGGCTGGAAGGAGAAGGG + Intergenic
1125303900 15:38288481-38288503 AATAGTGGAGAGAAGGTGGATGG + Intronic
1125450192 15:39799845-39799867 CAGACTGGGTAGAAGAGGGAGGG - Intronic
1125858832 15:42978367-42978389 CAGAGTAGGTAAAATGAGGATGG + Intronic
1127690216 15:61388070-61388092 CAAAGAGGGTAGAGGCAGGAAGG + Intergenic
1128343365 15:66837895-66837917 CATGGTGGGGAGAGGGAGTATGG + Intergenic
1129697363 15:77748253-77748275 CAAGGTGGGGAGGAGGAGGACGG - Intronic
1129966521 15:79740733-79740755 CAAAGTGGAAAGAAAGAGGAAGG - Intergenic
1131962263 15:97802022-97802044 CACTTTGAGTAGAAGGAGGAAGG + Intergenic
1132019051 15:98344780-98344802 GATAGTGGATGGATGGAGGATGG + Intergenic
1134040099 16:11061861-11061883 CAGAGTTGGGAGACGGAGGAAGG - Intronic
1134392607 16:13833357-13833379 CTTGGTGGTTAGAAGGAAGATGG - Intergenic
1135049983 16:19185016-19185038 CATTGTAGGTAGAAGGATGTGGG + Intronic
1135509171 16:23067658-23067680 ATTAGTGCGTAGAAGGAGGAAGG - Exonic
1135671141 16:24376623-24376645 CATGGTGGGGAGAGGGAAGAAGG - Intergenic
1135870097 16:26141838-26141860 CATAGGTGGTAGAAGGAGCCTGG - Intergenic
1135879953 16:26245530-26245552 CATAGAGAGGAGAAGGAGGCTGG + Intergenic
1137023888 16:35454844-35454866 CATTGTGGTGACAAGGAGGATGG - Intergenic
1137068895 16:35881228-35881250 CATGGTGGCCAGAAGGAGGTAGG - Intergenic
1137402099 16:48162247-48162269 CAGAGTGGGTAGAATGGTGAGGG + Intergenic
1137627130 16:49916307-49916329 CAGAGTGGGAACAAGGAGGGTGG - Intergenic
1138150973 16:54656725-54656747 CACAGTGAGTAGATGGAAGAAGG + Intergenic
1138804433 16:60077717-60077739 CATAGTTGGGAGATGGAGGAAGG - Intergenic
1139560931 16:67741643-67741665 AATACTTGGTAGAAGGATGAAGG - Intronic
1139734277 16:68973855-68973877 CATAGTGAGTGGAACGAAGATGG - Intronic
1140853252 16:78954301-78954323 CTGAGTGGATAGAAGGTGGATGG + Intronic
1140857477 16:78990687-78990709 CATAGAGGAAAGAAGGAAGAAGG + Intronic
1141083737 16:81076910-81076932 AAGGGTGGGTAGACGGAGGACGG - Intronic
1141753520 16:85975692-85975714 TATAGAGGTTAGAAGGAGGAAGG - Intergenic
1142032340 16:87844783-87844805 CAGAGTGGTTGGAAGGCGGAAGG - Intronic
1142266173 16:89064919-89064941 CATGGTGGGTAGCAAGAGGCAGG - Intergenic
1142304577 16:89278302-89278324 CCCAGTGGGTAGGAGGAGGTGGG + Intronic
1143303447 17:5927913-5927935 CATATCTGGTAGCAGGAGGAAGG + Intronic
1143861891 17:9897261-9897283 GCTGGAGGGTAGAAGGAGGAGGG - Exonic
1143986029 17:10915208-10915230 CATAGTCAATAGAAGGAGAAAGG + Intergenic
1144573538 17:16415504-16415526 CTTAGTGGCTAGAAGGGGGAGGG + Intergenic
1144693082 17:17281458-17281480 GATAGTGGGCAAAAGAAGGAAGG + Intergenic
1145987355 17:29055998-29056020 CATTGTAGGTATAAGGAGGCTGG + Intronic
1146623610 17:34419395-34419417 CTGAGAGGGTAGGAGGAGGAAGG + Intergenic
1146637822 17:34519093-34519115 AATGGAGGCTAGAAGGAGGAGGG + Intergenic
1146884741 17:36463625-36463647 CATTGAGGGTGGAGGGAGGAAGG + Intergenic
1148208127 17:45792270-45792292 CAGAGTTGGCAGAAAGAGGAAGG - Intronic
1148251316 17:46083543-46083565 CATGGTGGGTACATGGAGGTGGG + Intronic
1148487450 17:47999916-47999938 CTCAGTGGGTGGCAGGAGGATGG + Intergenic
1151181183 17:72329792-72329814 CACAGTGGCCAGAAGGAAGATGG - Intergenic
1151535986 17:74738950-74738972 CATAGTGGGTAGAAGGAGGAGGG - Intronic
1152361977 17:79837040-79837062 CGGAGAGGGTAGAAGGGGGAAGG - Intronic
1152515414 17:80820704-80820726 CAGACTGGGGAGAAGGAGGAGGG + Intronic
1152677892 17:81651027-81651049 CACAGTGGGCAGGAGGGGGAGGG + Exonic
1155115999 18:22767599-22767621 TATAGTGGGTAGAAGGCAGCAGG - Intergenic
1156363291 18:36403240-36403262 AAAGGTGGGTAGAGGGAGGAGGG - Intronic
1156892531 18:42206361-42206383 CAGGGTGGGGAGAAGGGGGAGGG - Intergenic
1157482732 18:48065959-48065981 CTTATTGGGAAGGAGGAGGAGGG - Intronic
1157707464 18:49819415-49819437 CAAAGTGGGTGGAAGAAGGTGGG - Intronic
1157750702 18:50175583-50175605 CATAGACAGTAAAAGGAGGAAGG - Intronic
1161627767 19:5337141-5337163 CTTAATGGGTAGCAGGGGGAAGG + Intronic
1162459955 19:10808951-10808973 CATAGGAGATAGAAGGAGGAGGG - Intronic
1162791429 19:13065084-13065106 AATGGAGGGTAGGAGGAGGAAGG - Intronic
1163407798 19:17134216-17134238 CATAGTGGGAAAGGGGAGGAAGG - Intronic
1163685618 19:18710222-18710244 CTGGGTGGGTAGATGGAGGAAGG - Intronic
1164627329 19:29738148-29738170 CACAGTGGGTAGCAGGAGCCAGG - Intergenic
1165093594 19:33398871-33398893 CCTTGTGGGTAAAAGGAAGAGGG - Intronic
1165906203 19:39196361-39196383 CAGAGTGGGGAGGGGGAGGAGGG + Intergenic
1167354267 19:48993555-48993577 CAAAGTGGGGAGGAGGAGGAGGG + Exonic
1168654441 19:58117444-58117466 CACAGTGGGTAGGAAGGGGAAGG + Intronic
925372358 2:3356025-3356047 CATGTTGGGGTGAAGGAGGAAGG + Intronic
925545499 2:5011402-5011424 CAAAGTGAGTAGAAGAAGGAGGG - Intergenic
927842240 2:26453151-26453173 AAGAGTGGGAAGAAGGGGGATGG - Intronic
928344286 2:30476344-30476366 AATAGTGGGTAGGAGGTGAATGG + Intronic
928494094 2:31813816-31813838 AATACTGGGTAGAAGAAGGTGGG - Intergenic
928884320 2:36130700-36130722 CATAGTGGATGGAAAGAGGCAGG + Intergenic
929564887 2:42978137-42978159 GAGAGTGGGAAGAAGGAAGAGGG + Intergenic
930234345 2:48874591-48874613 CATAGTTTGTAGAAGGAAGGAGG + Intergenic
930621801 2:53651823-53651845 CATAGGGGGAAGGAGGAGGTGGG - Intronic
931500038 2:62855451-62855473 GTTCCTGGGTAGAAGGAGGAAGG + Intronic
931874213 2:66494782-66494804 CTTTGTGGGTAGAAGAAGGAAGG + Intronic
932214576 2:69958593-69958615 CGTGCTGGGTAGAAGGAGGGAGG - Intergenic
932354876 2:71060338-71060360 CATAGTGAGAAGGAGCAGGAAGG - Intergenic
935413372 2:102788739-102788761 CACACTGGGCAGAAGGGGGAGGG - Intronic
935699554 2:105799818-105799840 CATAGTGGCAAGATGGCGGAGGG - Intronic
936844385 2:116813155-116813177 CATGGTTGGTAGTAGGAGGAAGG + Intergenic
936958721 2:118050267-118050289 CATATTGGGTGGCAGGAAGAGGG - Intergenic
937005046 2:118503785-118503807 TAGAGTGGGAAGAGGGAGGAAGG + Intergenic
937111847 2:119372700-119372722 CTTTGTGGGGAGGAGGAGGATGG + Intergenic
937261623 2:120590253-120590275 CGTAGTGGGTAGAAGGAGCATGG + Intergenic
940192557 2:151057956-151057978 TAAAGTGGGAAGTAGGAGGATGG + Intergenic
941232823 2:162932270-162932292 GATAGAGGGTAGAAGATGGATGG - Intergenic
944218568 2:197279655-197279677 CAAACTAGGAAGAAGGAGGAAGG - Intronic
945205852 2:207331390-207331412 CATAGGGTGTGGAAGGAGAAAGG - Intergenic
945363152 2:208916771-208916793 CATCTTGTGTAGAATGAGGAAGG - Intergenic
946343470 2:219088041-219088063 CATAATGGCTAGAAGGAAAAAGG + Intronic
946885527 2:224218620-224218642 CACAGTGGTTGGGAGGAGGAGGG + Intergenic
946945754 2:224820359-224820381 CAAAGTGTGGAGCAGGAGGAAGG + Intronic
948402485 2:237693703-237693725 CATAGATGGCAGGAGGAGGATGG + Intronic
948678282 2:239611883-239611905 CCTGGTGGGCAGAAGGAGGCCGG + Intergenic
948721563 2:239904090-239904112 CAAAGGGGGCAAAAGGAGGAGGG + Intronic
1169914243 20:10671755-10671777 CAAAATGGGTGGAAGGAAGATGG - Intronic
1170083877 20:12507728-12507750 CATGTTGGGTAGGAGGAGGTTGG + Intergenic
1170704509 20:18733176-18733198 CTCAGTGGGCAGAAGGAGGGTGG + Intronic
1171237440 20:23539143-23539165 AAAAGTGGGAAGCAGGAGGAGGG - Intergenic
1171724838 20:28606902-28606924 ACTAGAGGGGAGAAGGAGGAAGG + Intergenic
1171753225 20:29076148-29076170 ACTAGAGGGGAGAAGGAGGAAGG - Intergenic
1171789029 20:29501412-29501434 ACTAGAGGGGAGAAGGAGGAAGG + Intergenic
1171858499 20:30373086-30373108 ACTAGAGGGGAGAAGGAGGAAGG - Intergenic
1173766117 20:45611199-45611221 CCTAGGGAGTAGAGGGAGGACGG - Intronic
1175056275 20:56201496-56201518 CATCATGGGGAGAGGGAGGAAGG + Intergenic
1176899857 21:14427117-14427139 CATAGAGAGTAGTAGAAGGATGG + Intergenic
1178262806 21:31115817-31115839 CATTGTTGGTAGAAGGAAAAAGG - Intergenic
1178444235 21:32623973-32623995 GATAGTGGATAGAAGGGGGATGG + Intergenic
1179823071 21:43948209-43948231 CACCGTTGGTAGAAGGTGGAAGG - Intronic
1180298396 22:10965593-10965615 ACTAGAGGGGAGAAGGAGGAAGG + Intergenic
1180410021 22:12598208-12598230 ACTAGAGGGGAGAAGGAGGAAGG - Intergenic
1181265194 22:21627010-21627032 ATGAGTGGGTAGAAGCAGGAAGG + Intergenic
1182848090 22:33447799-33447821 GAGAGTGGGTGGAAGGAGGAAGG + Intronic
1183168640 22:36167130-36167152 AAGAGTGGGAAGGAGGAGGAGGG + Intergenic
1184586637 22:45452519-45452541 CATAGTGGACAGAAGGAAGGGGG - Intergenic
1184613554 22:45622263-45622285 ATTAGTGGGTAGAAGCAGGTGGG + Intergenic
951185518 3:19708027-19708049 CATAGTGGGTAGTGGTAAGAAGG + Intergenic
952828435 3:37543327-37543349 CATGGTGGGTGGAATGAGCATGG + Intronic
954535255 3:51355033-51355055 GATACTGGGTGGGAGGAGGAGGG + Intronic
954935391 3:54322098-54322120 CATTGGGAGTGGAAGGAGGAGGG + Intronic
955503827 3:59611395-59611417 CACAGTGGGTGAAAGGAGAAAGG + Intergenic
956122059 3:65976381-65976403 CACTGTGGGGAGACGGAGGAGGG + Intronic
956863249 3:73345425-73345447 CACAGTGGGCAGAAGGAACAGGG + Intergenic
957557330 3:81779567-81779589 CATGGTGGCAAGAAGGAGAAGGG + Intergenic
957729059 3:84108409-84108431 TTTAGTGGGGAGAGGGAGGAAGG + Intergenic
958085363 3:88798739-88798761 CATGGTGGGTAGAGGGATGCTGG - Intergenic
960253697 3:115487331-115487353 CAAAGTGGGTGGAGGTAGGAGGG - Intergenic
960960860 3:123069094-123069116 CTTAGCGGGTAGGAGGTGGAGGG + Intronic
961265049 3:125634921-125634943 CTTGGTGGGGAGAAGGAAGATGG + Intergenic
962360840 3:134741471-134741493 CATAGGGGGAAGCAGGAGCAGGG - Intronic
963059296 3:141211958-141211980 CTTGGTGGGTAGAAGCAAGATGG - Intergenic
963682622 3:148398708-148398730 AATATTGGGTAGAAGGAAAAAGG + Intergenic
965807701 3:172559052-172559074 CACAGTGGGTAGAAAGGGGTGGG - Intergenic
968435870 4:588757-588779 CATGGTGGGACGACGGAGGAAGG - Intergenic
968809712 4:2794354-2794376 CAGAGTGGGAAGAACCAGGAGGG - Intronic
969039122 4:4280935-4280957 CAGAATAGGTAGCAGGAGGAAGG - Intronic
969173759 4:5384126-5384148 CGAAGTGAGTGGAAGGAGGATGG + Intronic
969179154 4:5424051-5424073 CAGAGTGGGTACCAGGAGCAGGG - Intronic
969637347 4:8377008-8377030 CATGGAAGGTGGAAGGAGGAAGG - Intronic
971052809 4:22880184-22880206 CAAAATGGGTAGATGGAAGATGG - Intergenic
971072209 4:23107471-23107493 GGTAGTGAATAGAAGGAGGAAGG - Intergenic
972350955 4:38235880-38235902 CATACTGAGTAGACGGAGGAGGG + Intergenic
973560951 4:52134673-52134695 CAAAGTTGGTAGGAGGAAGAAGG + Intergenic
974705036 4:65503109-65503131 ACTAGAGGGAAGAAGGAGGAAGG + Intronic
975170363 4:71225610-71225632 CATGTTGGGTAGAGGTAGGAAGG + Intronic
976350701 4:84056788-84056810 CACAGTGGCTAGAAGTTGGAGGG - Intergenic
976605415 4:86977989-86978011 AATCGTGGGTGGAAGGAAGATGG + Intronic
976667485 4:87612434-87612456 CTAAGTGGGCAGAAGTAGGAGGG + Exonic
977077951 4:92482321-92482343 CTTAGAGGGCAGAGGGAGGAAGG + Intronic
978875699 4:113637992-113638014 CATATTTGGGAGAAGGAGGATGG - Intronic
980097364 4:128504988-128505010 AATAGTGGGTAGAAGAGGGTGGG - Intergenic
982042505 4:151409513-151409535 TTTAGAGGGTTGAAGGAGGAGGG + Intronic
982194708 4:152899300-152899322 CATAGGGAATAGAAAGAGGAGGG - Intronic
983618251 4:169731668-169731690 GGCAGTGGGTAGAAGGTGGAGGG + Intronic
983742184 4:171149656-171149678 CATACTGGCAAGGAGGAGGAAGG - Intergenic
985436635 4:189936807-189936829 ACTAGAGGGGAGAAGGAGGAAGG - Intergenic
985485549 5:146397-146419 CATAGTGGGGAGAGGATGGAGGG - Intronic
986565047 5:9104728-9104750 CAGAGCGGGTGGAAGGAGCAGGG - Intronic
986672467 5:10154902-10154924 CATTGTGGGTGGGAGGTGGAGGG - Intergenic
987928807 5:24376329-24376351 CATAGTATGTAAAAGAAGGAAGG + Intergenic
988612390 5:32739220-32739242 GATAGTGGGTATACTGAGGAGGG - Intronic
988778250 5:34496448-34496470 CCTAGTGGGCAGAAATAGGAAGG + Intergenic
988796084 5:34655141-34655163 CCTAGTAGGGAGAGGGAGGAAGG + Intergenic
990390871 5:55319028-55319050 CATTATGGGAAGAAAGAGGAAGG - Intronic
991651986 5:68865112-68865134 CAGAGTGGGCAGAAGCAGGGTGG + Intergenic
992093327 5:73338844-73338866 CAGAGCGGGGAGAGGGAGGAGGG + Intergenic
992590168 5:78286433-78286455 CTTACTGGGCAGAAGGTGGAAGG - Intronic
995322288 5:110849723-110849745 AATACTGGGTAGAATGAGTATGG + Intergenic
995434363 5:112119260-112119282 CATAATGAGTTGATGGAGGAGGG + Intergenic
997339110 5:133128647-133128669 AATGGTGGGTTGATGGAGGATGG + Intergenic
997403364 5:133620716-133620738 CACAGTGGTTAGGTGGAGGAAGG - Intergenic
997864404 5:137448368-137448390 GATGTTTGGTAGAAGGAGGATGG - Intronic
998153228 5:139769162-139769184 CATAGTCTGAAGAAGGAGCATGG + Intergenic
998194810 5:140059297-140059319 CATATTTGGTAGTAGGAAGAAGG - Intergenic
998429950 5:142062213-142062235 CATAGTAGGTAGTAGGGGGAAGG + Intergenic
998516306 5:142757677-142757699 CAGAGTGGGCAGAGGGAGAAGGG + Intergenic
1003047405 6:2746376-2746398 CATAGAGGAAAGAAGGAAGATGG + Intronic
1003584683 6:7376686-7376708 CAGAGTTGGAGGAAGGAGGAGGG - Intronic
1005152531 6:22768656-22768678 AACAGTGGTTAGAAGAAGGAAGG - Intergenic
1005388902 6:25313488-25313510 CATAGTGGGCAGAAAGATGGGGG + Intronic
1006088903 6:31616252-31616274 CACAGTGGGAGGAAGGAGAATGG + Intronic
1006574131 6:35031530-35031552 CAAAATGGGGAGGAGGAGGAAGG - Intronic
1007377440 6:41466538-41466560 AAGAGAGGGAAGAAGGAGGAAGG + Intergenic
1007937029 6:45741584-45741606 CAGAGTGGGCAGAAACAGGAGGG - Intergenic
1008761964 6:54862296-54862318 CACAGTGGGTCACAGGAGGAGGG + Intronic
1009043951 6:58215232-58215254 CATAGTGGGGGAGAGGAGGAGGG - Intergenic
1009511736 6:64559899-64559921 GGTAGAGGGTACAAGGAGGAAGG - Intronic
1010534801 6:77013382-77013404 GAAAGTGGTTAAAAGGAGGAAGG + Intergenic
1011737874 6:90330986-90331008 CTTGGTGGGGAGGAGGAGGATGG + Intergenic
1012391178 6:98741668-98741690 CATACTGGGTTCATGGAGGAGGG + Intergenic
1012685468 6:102242859-102242881 GAAAGGGAGTAGAAGGAGGAGGG - Intergenic
1013164184 6:107575018-107575040 CACAGTGGGCAGAAGCAGCATGG - Intronic
1013196922 6:107852184-107852206 CAAAGAGGGAAGAAGCAGGATGG - Intergenic
1014266466 6:119283618-119283640 CTTGGTGGGTGGAAGGAGCAGGG + Intronic
1014346817 6:120280792-120280814 GATAGTGGGTGGAAGGAAGGAGG + Intergenic
1016480604 6:144476804-144476826 CATAGTGGATAGTTCGAGGAGGG + Intronic
1016891693 6:149014105-149014127 CAGAGTGAGGAGAAGGAGGCAGG + Intronic
1017564831 6:155672304-155672326 CATAGTGTGTGGAAGGAGGTGGG + Intergenic
1017709383 6:157153363-157153385 ATCAGTGTGTAGAAGGAGGAGGG - Intronic
1018116544 6:160591381-160591403 CATATTTGGCAGAAGGTGGAAGG - Intronic
1018996554 6:168714716-168714738 GATGGTGGGGAGGAGGAGGATGG + Intergenic
1019536699 7:1533206-1533228 CACAGTGCGGAGAAGCAGGAAGG - Intronic
1021496873 7:21284590-21284612 CATAGTGTGTTGGAGGATGAGGG + Intergenic
1021785865 7:24152079-24152101 CAGACTGGGGAGAAGGAGAAGGG - Intergenic
1022545077 7:31179639-31179661 CATACAGGGTAGAAGGTGAAAGG + Intergenic
1022791592 7:33694579-33694601 CATAGAGGGAAGAAGCAAGAAGG - Intergenic
1023006506 7:35875548-35875570 CATACTTGGTAGAGGGAGGTAGG - Intronic
1024067709 7:45755415-45755437 CATACTTGGTAGAGGGAGGTAGG + Intergenic
1024581064 7:50801531-50801553 AATAGTGGGAAGAAGGTAGAAGG - Intergenic
1024818995 7:53304976-53304998 CCTAGTGGGTATAATGAAGATGG + Intergenic
1030253911 7:107484900-107484922 CAGACTGTGTAGAAAGAGGAGGG + Intronic
1030876999 7:114825968-114825990 CATACAGGGTTGAAAGAGGAGGG + Intergenic
1031334470 7:120510838-120510860 GGTTGGGGGTAGAAGGAGGAGGG - Intronic
1032412785 7:131710896-131710918 ATCAGTGGGTAGTAGGAGGAAGG - Intergenic
1032945483 7:136847269-136847291 CTTACTGGGTAGCAAGAGGAGGG - Intergenic
1033208794 7:139445021-139445043 CTTAGTGGAAAGGAGGAGGAAGG - Intergenic
1033246452 7:139720416-139720438 CACAGTGCGTAGATGGAGGTCGG - Intronic
1033463301 7:141567153-141567175 CAGAGTGTGTAGAATGAGAATGG - Intronic
1033595744 7:142856598-142856620 CACTCTAGGTAGAAGGAGGATGG + Intronic
1034347917 7:150398278-150398300 CAGCGTGGGTTGAGGGAGGAGGG + Exonic
1036425403 8:8641386-8641408 CAGAGTGTGTAGGAGGAGGGAGG - Intergenic
1036975389 8:13405291-13405313 CACAGAGGGGAGAAGGAGGGAGG - Intronic
1037710390 8:21350903-21350925 CACAGTGGGAAGGAGGAGGGAGG + Intergenic
1038549898 8:28458210-28458232 AATGGTGGGTGGAAGGAGGGAGG - Intronic
1040868549 8:52076344-52076366 TTTAGTGGGTAGAAAGAGTATGG - Intergenic
1041521984 8:58767246-58767268 CATTGTGGGTAAAGAGAGGAAGG + Intergenic
1041568906 8:59313574-59313596 CAGAGAGGGTGGAAGGAAGATGG - Intergenic
1041693831 8:60714947-60714969 CATAGTGGGGAGGGGCAGGAGGG + Intronic
1041862167 8:62526887-62526909 AGTAGTGGGTAGATGTAGGAAGG - Intronic
1041976712 8:63807575-63807597 CATAATGGGTAGAAAGTGGGTGG - Intergenic
1042238596 8:66639953-66639975 CATAGAGGGTGGGAGGAGGGAGG + Intronic
1043284181 8:78509183-78509205 AAAAGGGGTTAGAAGGAGGAGGG - Intergenic
1046709413 8:117493032-117493054 GACAGAGGGTAGAAGGAGGGAGG - Intergenic
1047690328 8:127345858-127345880 CCAAGTGGGTGGAGGGAGGAAGG - Intergenic
1048293435 8:133197559-133197581 CATAGAGAGGAGGAGGAGGAGGG - Intronic
1048529613 8:135235470-135235492 CACAGTTGGTACAGGGAGGAGGG - Intergenic
1049269080 8:141684593-141684615 CACAGTGGGTACAAGGAAGTTGG + Intergenic
1049274739 8:141714527-141714549 TATAGGAGGTAGAAGGAAGATGG + Intergenic
1049569180 8:143360414-143360436 CATAGTGCTTGGGAGGAGGAGGG + Intergenic
1052459685 9:28746983-28747005 AATACTGGGTAGAAAGAAGAGGG + Intergenic
1052495957 9:29224488-29224510 GAGAGAGGGTAGAAGTAGGAGGG + Intergenic
1053724763 9:40988273-40988295 ACTAGAGGGGAGAAGGAGGAAGG - Intergenic
1054341209 9:63863726-63863748 ACTAGAGGGGAGAAGGAGGAAGG + Intergenic
1054715471 9:68553440-68553462 AAAAATGGGTAGAAGAAGGAAGG + Intergenic
1055813673 9:80180464-80180486 AAAAGTAGGTAGAAGGAAGACGG - Intergenic
1056144004 9:83711250-83711272 AATAATGGGTACAAGGAGGTGGG - Intergenic
1056364192 9:85886566-85886588 CATAGTGAGTGGAAGGAAAATGG - Intergenic
1057168640 9:92947582-92947604 CACAGTGGGCAGCAGGAGGCTGG - Exonic
1057686961 9:97243429-97243451 GATAGTGGATAGCAGGAAGATGG + Intergenic
1058078559 9:100676171-100676193 CAGAGTTGGAAGAAGGAGGTGGG + Intergenic
1060059543 9:120446771-120446793 CATCTTGGGAAGAAGGAAGAAGG - Intronic
1060073331 9:120569861-120569883 CATGGTGGGTTGGAGTAGGATGG + Intronic
1060418839 9:123453002-123453024 AAAAGTGGGAGGAAGGAGGAGGG + Intronic
1061185820 9:129052597-129052619 CAGCGGAGGTAGAAGGAGGAGGG + Intronic
1203450044 Un_GL000219v1:103717-103739 ACTAGAGGGGAGAAGGAGGAAGG + Intergenic
1185688344 X:1948492-1948514 AGGAGAGGGTAGAAGGAGGAGGG + Intergenic
1185688622 X:2134014-2134036 AGGAGAGGGTAGAAGGAGGAGGG + Intergenic
1186611935 X:11146096-11146118 CACAGTTAGGAGAAGGAGGAAGG + Intronic
1188026562 X:25216328-25216350 GAAAGGGGGGAGAAGGAGGAAGG - Intergenic
1188425893 X:30046347-30046369 CATAGGGGGAAGAATGAGGTTGG + Intergenic
1190060962 X:47211410-47211432 GATAGTGGGAAGGAGGAGGAGGG - Intronic
1190477577 X:50843037-50843059 CTTAGTGGTTAGAAGCAAGACGG + Intergenic
1190515714 X:51221849-51221871 GATAGTGGGTAGACAAAGGATGG - Intergenic
1190727769 X:53201811-53201833 GATGGTGGGGAGAAGCAGGAGGG - Intronic
1192221615 X:69201068-69201090 GAGAGTGGATTGAAGGAGGACGG - Intergenic
1192586630 X:72324244-72324266 CATAGTGGGCCAAAGGAGGAAGG + Intergenic
1195252254 X:103060528-103060550 AAAAGTGGGAGGAAGGAGGAAGG + Intergenic
1196164703 X:112526085-112526107 CACATTGGGTTGAAGGAGAATGG - Intergenic
1197916968 X:131546186-131546208 AATTGGGGGTAGAGGGAGGAAGG - Intergenic
1198305941 X:135383159-135383181 CATAGCGGGAAGCAGCAGGAGGG - Intergenic
1199716338 X:150509567-150509589 CAGAGTATGTAGAAGGAGGGAGG - Intronic