ID: 1151536897

View in Genome Browser
Species Human (GRCh38)
Location 17:74744336-74744358
Sequence CATGATCACCACGTCCCTCT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 1, 2: 0, 3: 3, 4: 89}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151536897_1151536902 6 Left 1151536897 17:74744336-74744358 CCCAGAGGGACGTGGTGATCATG 0: 1
1: 1
2: 0
3: 3
4: 89
Right 1151536902 17:74744365-74744387 GGCAACAAGGTGAGTGGCTCCGG 0: 1
1: 0
2: 0
3: 19
4: 172
1151536897_1151536900 -7 Left 1151536897 17:74744336-74744358 CCCAGAGGGACGTGGTGATCATG 0: 1
1: 1
2: 0
3: 3
4: 89
Right 1151536900 17:74744352-74744374 GATCATGCTGCTAGGCAACAAGG 0: 1
1: 0
2: 0
3: 2
4: 135
1151536897_1151536906 13 Left 1151536897 17:74744336-74744358 CCCAGAGGGACGTGGTGATCATG 0: 1
1: 1
2: 0
3: 3
4: 89
Right 1151536906 17:74744372-74744394 AGGTGAGTGGCTCCGGGGCAGGG 0: 1
1: 0
2: 0
3: 29
4: 299
1151536897_1151536904 8 Left 1151536897 17:74744336-74744358 CCCAGAGGGACGTGGTGATCATG 0: 1
1: 1
2: 0
3: 3
4: 89
Right 1151536904 17:74744367-74744389 CAACAAGGTGAGTGGCTCCGGGG 0: 1
1: 0
2: 0
3: 10
4: 119
1151536897_1151536905 12 Left 1151536897 17:74744336-74744358 CCCAGAGGGACGTGGTGATCATG 0: 1
1: 1
2: 0
3: 3
4: 89
Right 1151536905 17:74744371-74744393 AAGGTGAGTGGCTCCGGGGCAGG 0: 2
1: 0
2: 2
3: 26
4: 255
1151536897_1151536903 7 Left 1151536897 17:74744336-74744358 CCCAGAGGGACGTGGTGATCATG 0: 1
1: 1
2: 0
3: 3
4: 89
Right 1151536903 17:74744366-74744388 GCAACAAGGTGAGTGGCTCCGGG 0: 1
1: 0
2: 1
3: 17
4: 177
1151536897_1151536901 0 Left 1151536897 17:74744336-74744358 CCCAGAGGGACGTGGTGATCATG 0: 1
1: 1
2: 0
3: 3
4: 89
Right 1151536901 17:74744359-74744381 CTGCTAGGCAACAAGGTGAGTGG 0: 1
1: 0
2: 2
3: 14
4: 132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151536897 Original CRISPR CATGATCACCACGTCCCTCT GGG (reversed) Exonic
900848308 1:5121340-5121362 CACGATCACCAGGTCCCTGCAGG - Intergenic
903324294 1:22561021-22561043 CATGCCCACCAAGTCCCTCAAGG + Intergenic
903435095 1:23343793-23343815 GATCATCAGCACATCCCTCTCGG + Intronic
904056281 1:27672500-27672522 CCTGATCACCAGCTCCCCCTGGG + Intergenic
911564881 1:99452168-99452190 CATGCTCACCACATCTCTATTGG - Intergenic
913007516 1:114649422-114649444 TATGATCACACCGTGCCTCTGGG - Intronic
915224453 1:154402304-154402326 AATGATGACCAAGTCCCTTTTGG + Intergenic
916754506 1:167756115-167756137 CAAGATTACCAAATCCCTCTCGG - Intronic
917535223 1:175869747-175869769 CATGTTCCCCACCTCCCTCCAGG + Intergenic
924246916 1:242094202-242094224 CCTCATCATCATGTCCCTCTGGG - Intronic
1065988418 10:30981090-30981112 CATGCTCTCCACGTGCCTCCTGG - Intronic
1071260175 10:83912494-83912516 CATGATCAGCACATGCCTCCTGG - Intergenic
1073858126 10:107701435-107701457 CCAGATCACCAGGTCTCTCTTGG + Intergenic
1081582575 11:44362327-44362349 CGTGATCAACACGTCCCACGAGG + Intergenic
1081988730 11:47326236-47326258 TATTATCACCACATACCTCTTGG + Intronic
1084125927 11:67098995-67099017 CATTACCACCTCCTCCCTCTGGG + Intergenic
1089395721 11:118135561-118135583 CAACATCACCACCTCCCCCTAGG + Exonic
1090828157 11:130402391-130402413 CCAGATCACCAGGTCCCTCCAGG - Intergenic
1095369622 12:41451743-41451765 CATGATCACCAGGTCCCCTCTGG + Intronic
1096805468 12:54138481-54138503 CTTGATCACCAGGTATCTCTGGG - Intergenic
1102493741 12:113305139-113305161 CACTATCACCAGTTCCCTCTAGG - Intronic
1104505837 12:129331350-129331372 CATCAGCACCAGGTCCCTGTAGG + Intronic
1109673446 13:65639831-65639853 CATTGTCACCATGTTCCTCTTGG + Intergenic
1112238551 13:97658289-97658311 CATGACCCCCACGGCCCTCTAGG - Intergenic
1121582158 14:95039347-95039369 CCTGACCCCCACGTCCCTCATGG - Intergenic
1124090213 15:26592330-26592352 CAAGATCACCACATCCATATTGG + Intronic
1130985814 15:88843699-88843721 CAAGATCCCCTCTTCCCTCTAGG - Intronic
1134015260 16:10883632-10883654 TAGGATTTCCACGTCCCTCTTGG + Intronic
1141839959 16:86567955-86567977 CTTGATCACCACCTTCTTCTCGG - Exonic
1141908977 16:87045633-87045655 CATGCACACCCCGTCCCTGTGGG - Intergenic
1144720516 17:17466414-17466436 CATGATCATCACGTTCTCCTTGG - Intergenic
1147743554 17:42681912-42681934 CCTAATCCCCACCTCCCTCTCGG - Intronic
1151469182 17:74307283-74307305 CAGGTCCACCAAGTCCCTCTAGG - Intronic
1151536897 17:74744336-74744358 CATGATCACCACGTCCCTCTGGG - Exonic
1156617401 18:38803663-38803685 TATGATCACCACAGCCATCTGGG + Intergenic
1158455010 18:57598317-57598339 CATGACCACCACCTCCCACCAGG - Intergenic
1158855817 18:61542595-61542617 CATGGTCACCACATCCTTCCAGG - Intronic
1162936050 19:13982105-13982127 CAGGACCACCACTTACCTCTGGG + Exonic
1165427182 19:35752687-35752709 CATGAACCCCACTTGCCTCTTGG - Intronic
925050854 2:814315-814337 CATAATCACCTCCTGCCTCTGGG - Intergenic
926603259 2:14869706-14869728 CTTGGTTTCCACGTCCCTCTTGG + Intergenic
926913874 2:17875629-17875651 CATCATAATCACGACCCTCTGGG - Intergenic
932279007 2:70473339-70473361 CCTGCTCACCAAGTCTCTCTGGG - Intronic
935847065 2:107177370-107177392 CGTGATCAACACTGCCCTCTGGG + Intergenic
937868025 2:126768471-126768493 CATGGTCACCATGACCTTCTGGG + Intergenic
939768898 2:146289917-146289939 CATTATAACCTCCTCCCTCTTGG - Intergenic
941594284 2:167456350-167456372 CATGATCAACACCTCCCACCAGG + Intergenic
1170648556 20:18218255-18218277 CATGACCACCCCGACCCACTCGG + Intergenic
1171192179 20:23166521-23166543 CATTATCCCCACTTCCCTCCTGG - Intergenic
1174994656 20:55552310-55552332 CATGATCACTAAGTCCTTGTAGG - Intergenic
1176097457 20:63350829-63350851 CATGTTCACCAGGTCGATCTTGG + Exonic
1176741107 21:10603037-10603059 CATGATGACCACTTCACTATGGG - Intronic
1181327817 22:22064208-22064230 CTTGGTCACCACCTCCTTCTGGG - Intergenic
1183788603 22:40046417-40046439 CATCATCACCACGTCCCACGTGG - Intronic
1184799727 22:46752170-46752192 CTTGATCACCACGTCCCTCTTGG - Intergenic
950756474 3:15177584-15177606 CATGTTGACCACGTCTCTCCAGG - Intergenic
954728008 3:52632504-52632526 CATGATCAACTCGAACCTCTGGG - Intronic
955905769 3:63806135-63806157 TTTGATCACCATATCCCTCTTGG - Intergenic
958500864 3:94906777-94906799 CATAAGCACCAAGTACCTCTGGG + Intergenic
962292507 3:134148264-134148286 CATGATCACAAGGTCCCAGTAGG - Intronic
968931274 4:3580820-3580842 CATGATCACCAGATCACTGTAGG - Intronic
972382905 4:38535955-38535977 CAAGATGACTATGTCCCTCTGGG + Intergenic
973175348 4:47198585-47198607 CATGATCCTCATGTCCTTCTGGG - Intronic
975406748 4:73998869-73998891 CAGGGTTACAACGTCCCTCTCGG - Intergenic
977809573 4:101345333-101345355 CATGATACACAAGTCCCTCTGGG - Intronic
978348825 4:107800051-107800073 CAGAATCACAACGTCCCACTAGG - Intergenic
982718229 4:158831172-158831194 AATGATGACCTCCTCCCTCTTGG - Intronic
986829617 5:11561160-11561182 GATGATAATCAAGTCCCTCTTGG - Intronic
1001768467 5:174273867-174273889 CATGATCTCCAGGTGGCTCTTGG + Intergenic
1001948662 5:175800660-175800682 GATGCTCACCAAGTCCCTTTGGG - Intronic
1005469468 6:26147925-26147947 CATGGTCTCCACGTGCATCTTGG + Intergenic
1007882541 6:45183625-45183647 CATGATCAACAACTCCCACTAGG + Intronic
1008024792 6:46623068-46623090 CAAGATCACCATTTCCTTCTTGG - Intronic
1016000748 6:139038752-139038774 CATGTTAATCACTTCCCTCTAGG - Intronic
1017393846 6:153973295-153973317 GATGATCAGCACGCCCCTCCAGG - Intergenic
1018834808 6:167474749-167474771 CATGGGCACCACCACCCTCTGGG + Intergenic
1021728230 7:23570839-23570861 GATCATCCCCACGTCCATCTGGG - Intergenic
1025576293 7:62646507-62646529 CTTTATCACCACGTGCCTCAAGG + Intergenic
1034072416 7:148199066-148199088 TATGAACTCCACCTCCCTCTGGG - Intronic
1036557936 8:9876384-9876406 CATGATCACCAAGTACCCCGTGG - Intergenic
1036691499 8:10947541-10947563 CCTGATCACCAGGGCCCTCTCGG - Intronic
1038457902 8:27689821-27689843 CATGAGCACAACTTCCTTCTAGG + Intergenic
1051431987 9:16988661-16988683 CATTCTCACCACTTCCTTCTTGG - Intergenic
1055499954 9:76893461-76893483 CCTGATCACCATGTCACCCTGGG - Intronic
1058341435 9:103902530-103902552 CATTCTCACCACCTCCCTCCTGG + Intergenic
1061355412 9:130100948-130100970 CATGAGCACCACTTCCTTCAGGG - Intronic
1186340447 X:8640113-8640135 CATCATCACCATATCCCTCATGG + Intronic
1187063332 X:15809009-15809031 CATGAGCTCCATGTCTCTCTTGG - Intronic
1187810909 X:23175563-23175585 CATTCTCACCACCTTCCTCTTGG + Intergenic
1189472806 X:41327392-41327414 TTTGTTCACCACGTCCCTCCCGG - Intergenic
1191257729 X:58286956-58286978 CATCGTGACCACGTCCCTCGGGG - Intergenic
1196723750 X:118878015-118878037 CAGGATGACCACGTCTCTGTGGG + Intergenic
1197571591 X:128156833-128156855 TATGATGATCACCTCCCTCTGGG + Intergenic
1201396764 Y:13556732-13556754 CAGGCTCTCCACTTCCCTCTGGG - Intergenic