ID: 1151538336

View in Genome Browser
Species Human (GRCh38)
Location 17:74750930-74750952
Sequence CAGATTCCTGCATGTTTTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 209
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 192}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151538334_1151538336 -5 Left 1151538334 17:74750912-74750934 CCTGGGTGAGCACAGACTCAGAT 0: 1
1: 0
2: 1
3: 17
4: 173
Right 1151538336 17:74750930-74750952 CAGATTCCTGCATGTTTTGGAGG 0: 1
1: 0
2: 0
3: 16
4: 192

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151538336 Original CRISPR CAGATTCCTGCATGTTTTGG AGG Intronic
904130185 1:28269989-28270011 CATTTTTCTGCATGTTTTGAAGG - Intronic
905673348 1:39807849-39807871 CTGGTTCTTGCATTTTTTGGTGG + Intergenic
907695555 1:56724225-56724247 CAGTTTGCTGAATGTTTTGGAGG + Intronic
908912414 1:69087633-69087655 AAGTCTCCTGAATGTTTTGGGGG + Intergenic
912712242 1:111958311-111958333 CAGGGTCCTGCAGGGTTTGGGGG - Intronic
912902292 1:113664664-113664686 CAGAATCCTCAATGTTTTGCTGG - Intronic
914324899 1:146603094-146603116 CATATACATGCATGTTTTCGTGG + Intergenic
914454489 1:147823241-147823263 CATATACCTGCATGTCTTTGAGG + Intergenic
916711584 1:167415463-167415485 TTCATTCCTGCCTGTTTTGGGGG + Intronic
916869012 1:168892235-168892257 CATATTCTTGTATATTTTGGGGG + Intergenic
919004862 1:191884407-191884429 CTGGTTCTTTCATGTTTTGGGGG - Intergenic
919347451 1:196403098-196403120 CACATACATGCATGTTTTTGTGG - Intronic
919674670 1:200369470-200369492 CAGATCCCTGCATGTAGGGGTGG - Intergenic
923080770 1:230652353-230652375 AAGATTCCTCCATGTCTTTGTGG + Intronic
923558209 1:235018480-235018502 CAGATTCCTCCATGTTTGCTGGG - Intergenic
1063089396 10:2848804-2848826 CTGATTCCAGCAAGTTTTGCTGG - Intergenic
1063630366 10:7728047-7728069 CAGATTTCTGCATATTGTGGAGG - Intronic
1064355344 10:14612496-14612518 AAGATTCCAGCTTGTTCTGGTGG + Intronic
1068359509 10:55957877-55957899 CACATTCATGCATGTGTTTGGGG + Intergenic
1068532085 10:58200748-58200770 AGGATTCCTGTATGTTTTCGGGG - Intronic
1070790429 10:79186055-79186077 CAGGTCCCTGGATGTTTTTGAGG + Intronic
1071923481 10:90377640-90377662 CAGTTTCCTTCATGATTTGAAGG - Intergenic
1074578660 10:114695302-114695324 TTGATTCCTGCATGTTTTAAGGG - Intergenic
1078077569 11:8175597-8175619 CAGATTCCAGCCTGGTCTGGAGG - Intergenic
1079163014 11:18012411-18012433 CCGGTTCTTGCATGTGTTGGGGG - Intronic
1079556750 11:21768207-21768229 CACATTCATGCATATTTTTGAGG + Intergenic
1081390988 11:42528610-42528632 CAGGTTACTGCATGTTTCTGGGG - Intergenic
1083206575 11:61153367-61153389 CACACTTCTGCATGTTTGGGAGG - Intronic
1083948188 11:65937842-65937864 CAGATTCTTGCCTGTTCTGGAGG + Intergenic
1084941806 11:72617076-72617098 CAGAGTCCTGCTTGTCTTTGGGG + Intronic
1086265962 11:84998424-84998446 CACAGTTCTGCATGTCTTGGAGG - Intronic
1087789856 11:102394395-102394417 CTGATTTGTGCATTTTTTGGTGG + Intergenic
1087961650 11:104358077-104358099 CAAATTCTCCCATGTTTTGGAGG + Intergenic
1091156236 11:133376912-133376934 CATCTTCATGCATGTTTTGCAGG + Intronic
1091416880 12:295572-295594 CAGATTCTTGCATATCATGGAGG - Exonic
1091658354 12:2362422-2362444 CTGAATCCTACATGTTTTTGTGG + Intronic
1093890188 12:24510768-24510790 CAGATACCAGCATGATTTTGAGG + Intergenic
1095667045 12:44814622-44814644 CAGATTCTGGCCTGTTTTTGAGG - Intronic
1099015774 12:77342432-77342454 AAGATGCAAGCATGTTTTGGAGG - Intergenic
1101202042 12:102446678-102446700 TAGATTCCTGAATTTTTTGAAGG + Intronic
1102529906 12:113538569-113538591 AAGATTCCAACATGTTTTTGAGG - Intergenic
1104469265 12:129016353-129016375 CAGGCTCCTCCATGTTTTGCAGG - Intergenic
1105850659 13:24332527-24332549 CAGACTCATCCATGTTTTCGTGG + Intergenic
1106435700 13:29721426-29721448 CAGGGTCCTGCCTGTTTTGCTGG + Intergenic
1106790889 13:33153906-33153928 TAGGTTCCTGAATGTCTTGGAGG - Intronic
1111777643 13:92684701-92684723 CACTTTTCTGCATGTTTTGTGGG + Intronic
1112166004 13:96920200-96920222 CATAGTCCTGTATTTTTTGGAGG - Intergenic
1113337027 13:109386457-109386479 AAGATCCATTCATGTTTTGGTGG - Intergenic
1114251769 14:20967994-20968016 CAGATCCAGGCATGTTTTGAAGG + Intergenic
1115438641 14:33406412-33406434 CAGATTTCTGACTCTTTTGGGGG - Intronic
1117673291 14:58129631-58129653 TAGACTCCTGGATGTATTGGAGG - Intronic
1117916066 14:60679460-60679482 CAGATTCATGAATGTTTCTGTGG - Intergenic
1122003541 14:98684052-98684074 CAGATCCCTGCCTGTGTTGCTGG - Intergenic
1122678134 14:103434317-103434339 CAGATTCCTCCATGTTTAGTAGG + Intronic
1122978265 14:105179881-105179903 CAGAGTCCTGGATGTGATGGGGG + Intronic
1125790867 15:42364889-42364911 TAGATCCCTGCTTCTTTTGGAGG + Intronic
1129314791 15:74735172-74735194 AAAAATCCTCCATGTTTTGGTGG + Intergenic
1129745549 15:78017175-78017197 CTTATTCCTGCATGTTTTCTAGG - Intronic
1132020152 15:98354048-98354070 CAGCTTCCTGGATATTTTGATGG - Intergenic
1132931729 16:2462218-2462240 CAGCTGTCTGCATGTTCTGGAGG - Exonic
1133450601 16:5900810-5900832 CAGCTTCCTGGATGTCTTGACGG - Intergenic
1134311203 16:13076667-13076689 CAGCTTCCAGCATGCCTTGGAGG - Intronic
1134619429 16:15676401-15676423 CAGATTTCACCATGTTTTCGAGG + Intronic
1136614966 16:31393131-31393153 CAGGTCCCTGCAGGTTGTGGAGG + Intergenic
1138041819 16:53679551-53679573 CAGATTCCTGCCAGGTGTGGTGG - Intronic
1138316285 16:56073018-56073040 CAGGATGCTGCATGTTCTGGGGG + Intergenic
1142575041 17:901275-901297 CAGATCCCTGCATGTTGCAGAGG - Intronic
1143666570 17:8365486-8365508 CACTTTCCAGCTTGTTTTGGGGG - Intergenic
1144662993 17:17083465-17083487 CAAATTTCTGCAATTTTTGGTGG + Intronic
1146256519 17:31394009-31394031 CAGATCCCTGGAGGTTTCGGTGG - Intronic
1149706138 17:58696715-58696737 CAGATACCAGAATGTTTTGGAGG + Exonic
1150581791 17:66481022-66481044 CAGATGGCTGCCTGTCTTGGTGG + Intronic
1151126161 17:71846931-71846953 CAGATGGCTGAATCTTTTGGTGG - Intergenic
1151200870 17:72467309-72467331 CAGATTCCTGTATGTTAAGGAGG + Intergenic
1151351572 17:73535011-73535033 CAGATTCCAGGATGTCCTGGGGG - Intronic
1151538336 17:74750930-74750952 CAGATTCCTGCATGTTTTGGAGG + Intronic
1151645609 17:75429130-75429152 CAGATTCCGTCCTGGTTTGGAGG + Intergenic
1153797475 18:8637651-8637673 CAGATTTCTGACTGTTTAGGGGG - Intronic
1160544702 18:79645238-79645260 CACATTCCAGCATCTTTTGGGGG - Intergenic
924993427 2:336195-336217 CAGAGCCCTGCTTCTTTTGGGGG - Intergenic
925404034 2:3594488-3594510 CCGAATCTTGCATGTTTTGGGGG - Intergenic
926691648 2:15738860-15738882 GTGATTCCTCCATGTTGTGGTGG + Intronic
929979699 2:46666820-46666842 CAGATGCCTGTTAGTTTTGGAGG - Intergenic
931059595 2:58511782-58511804 CTGACTCCAGCATGTTTCGGGGG + Intergenic
934154181 2:89179905-89179927 CACATTTCTGCAGGCTTTGGAGG - Intergenic
934889747 2:98056893-98056915 GAAATTCCTGCATTATTTGGTGG - Intergenic
938841519 2:135169207-135169229 CAGATTTCTGGATATTTTGGTGG + Exonic
941342135 2:164319896-164319918 CAGATTTCTGCCTGTTTTAATGG - Intergenic
943270878 2:185801933-185801955 CAGAATCCACCATCTTTTGGAGG - Exonic
943880424 2:193137573-193137595 CACTTTCCATCATGTTTTGGAGG + Intergenic
944391529 2:199224654-199224676 CAGATGCCTGCATGACTGGGAGG - Intergenic
946506589 2:220308082-220308104 CAGATTTATGGATGTTTTGTGGG + Intergenic
946940495 2:224764770-224764792 CAGTTTCCTGCCTCTTTTGAAGG - Intergenic
946943147 2:224791337-224791359 AAGATTCCTGAATTTTTGGGTGG + Intronic
1168867945 20:1105131-1105153 CAGGTTCCTGCAGGCTTTGATGG - Intergenic
1170015012 20:11770584-11770606 CAAATGCTTGCATGTTTTGATGG - Intergenic
1173630730 20:44512975-44512997 CAGATTCCTGGATTTTGTGAAGG - Exonic
1177056988 21:16318553-16318575 CAGCTTTCTGGATGATTTGGGGG - Intergenic
1177215529 21:18123482-18123504 CATATTCCTCATTGTTTTGGAGG + Intronic
1177993502 21:28067298-28067320 CAGATTTATTCAGGTTTTGGTGG + Intergenic
1182670024 22:31988079-31988101 CAGATTCCTGAATGATCCGGCGG + Intergenic
1184293682 22:43510981-43511003 CAGATTCCTGAATGAACTGGCGG + Intergenic
951945429 3:28130681-28130703 CAGATTTATACATATTTTGGAGG - Intergenic
955339304 3:58112523-58112545 CAGCTTCCTGCTTGCTTTTGGGG - Intronic
955880044 3:63533620-63533642 TTGTTTCCTGTATGTTTTGGAGG - Intronic
956332669 3:68128575-68128597 AACAGTTCTGCATGTTTTGGTGG - Intronic
956863330 3:73346051-73346073 CCAATTCCTGCATCTTTCGGGGG + Intergenic
958826924 3:99041580-99041602 CAGATTCCTGTTTGTTTCAGGGG - Intergenic
958968909 3:100589572-100589594 CTTATTCCTGTATGTTTTAGAGG - Intergenic
959872871 3:111349010-111349032 CTGATTCCTTCTTGTTTGGGTGG - Intronic
960806937 3:121593091-121593113 CAGATTCCTGCATGTGCAGTCGG - Intergenic
961280410 3:125762234-125762256 CAGCCTCCTGCATTTTTAGGAGG + Intergenic
961873986 3:130007298-130007320 CAGCCTCCTGCATTTTTAGGAGG - Intergenic
963461543 3:145620062-145620084 CAGATGCCTGCATGATATGAAGG + Intergenic
963502709 3:146147959-146147981 CAGAATCTTTCTTGTTTTGGAGG - Intronic
964646073 3:158959725-158959747 GAGATGCCTGCATGTGCTGGAGG + Intergenic
965670518 3:171143134-171143156 CAGATGCCTCCATGTGTTAGCGG - Intronic
966383423 3:179367459-179367481 AAGATGCCTGCATTTCTTGGTGG + Exonic
968192280 3:196677420-196677442 CAGATTCCAGCCTATTTTAGGGG - Intronic
969736691 4:8996495-8996517 CAGCCTCCTGCATTTTTAGGAGG + Intergenic
969867146 4:10083498-10083520 CACATTTCTTTATGTTTTGGGGG + Intronic
970622598 4:17839414-17839436 CCAGTTGCTGCATGTTTTGGAGG - Intronic
971427868 4:26533684-26533706 CAGATGCCTACAGGCTTTGGAGG + Intergenic
972102434 4:35438643-35438665 CAGAATACTCCATGTTGTGGGGG + Intergenic
975300965 4:72790948-72790970 TATATTCATTCATGTTTTGGTGG + Intergenic
975736347 4:77384942-77384964 CAGTCACCTGCATGTTCTGGGGG + Intronic
977662649 4:99608628-99608650 CAGATTCCTTTGTGATTTGGTGG - Intronic
978984637 4:114996340-114996362 CACAGTTCTGCATGATTTGGGGG - Intronic
982133033 4:152247457-152247479 CAGCTTCCTGCAGGCTATGGGGG + Intergenic
984532842 4:180938332-180938354 TAGATTCATGGATCTTTTGGGGG + Intergenic
986058158 5:4160249-4160271 TAGATTTCTGGATGTTTTGCTGG + Intergenic
987060433 5:14238016-14238038 AAAATTCCTACATGTTCTGGTGG - Intronic
989829809 5:45901694-45901716 CAGATGACTGAATGGTTTGGAGG + Intergenic
992883209 5:81131009-81131031 CAGATTCCTATATATTTTGATGG - Intronic
995535175 5:113128886-113128908 CAGATGCCTGTGTGTTTTGTTGG + Intronic
996443269 5:123514557-123514579 CAGATTCCTGTGGGTTTTGTTGG + Intronic
998421889 5:141995145-141995167 CATTTTCCTGCCTGTTTTTGCGG - Intronic
999171748 5:149601170-149601192 CAGATTCCTCCATGATCTGCAGG + Exonic
999468807 5:151832627-151832649 CAGAGTCCTGTATTTCTTGGAGG - Intronic
999764801 5:154731599-154731621 CAGATTCCTGCCTGTCTTAGTGG - Intronic
1000680024 5:164172055-164172077 CAGATTCCTTCAGGTTTTCAGGG - Intergenic
1002551851 5:180000038-180000060 CATACTCCTGCATGTTTTCCTGG + Intronic
1002626301 5:180531816-180531838 CTGGTTCTTGCATTTTTTGGTGG - Intronic
1002815872 6:679697-679719 CATTTTACTGGATGTTTTGGTGG - Intronic
1006437291 6:34032704-34032726 CTGATTCCTGCCTTTTTAGGAGG - Intronic
1010431895 6:75787428-75787450 GAGATTCATGCATGTTGTTGTGG - Intronic
1011989909 6:93501709-93501731 TTGATTCCTGCCTATTTTGGGGG - Intergenic
1014092170 6:117416452-117416474 CAAAATCCTGGATCTTTTGGAGG - Intronic
1014376914 6:120687509-120687531 TAGGTTCCTGAATGTTTTGGAGG + Intergenic
1015980432 6:138832939-138832961 CAGAGTTCTGCATGGGTTGGGGG + Intronic
1018009474 6:159656127-159656149 CAGATTCCGGCTGGTATTGGGGG - Intergenic
1018185670 6:161263760-161263782 CAGATTTCCACATGATTTGGGGG + Intronic
1018430475 6:163717772-163717794 CAGATTCCAGAAATTTTTGGTGG + Intergenic
1018812157 6:167306209-167306231 CTGATTCCTGCTTGTTGAGGGGG - Intronic
1018857897 6:167688590-167688612 CACATTCCTGCACCTTTTGCTGG + Intergenic
1018920605 6:168169795-168169817 GTGATTCTCGCATGTTTTGGGGG + Intergenic
1018964531 6:168474209-168474231 CAGGTTCCTGCACGTTTTATGGG + Intronic
1021445948 7:20733802-20733824 CTAATTTCTGCATGTTTTGGTGG + Intronic
1023364484 7:39450226-39450248 CAGACTGGTGCCTGTTTTGGGGG + Intronic
1024028541 7:45434843-45434865 CAGATTTCTTCATGTTTGTGGGG - Intergenic
1026392737 7:69918240-69918262 AAGATTACTGCAAATTTTGGTGG + Intronic
1026462631 7:70628584-70628606 CTGATTACTGGATTTTTTGGGGG - Intronic
1027177264 7:75912581-75912603 CAGCTTCCTGACTTTTTTGGGGG - Intronic
1027876081 7:83770488-83770510 GAGATTCCTGCATTGTTTTGTGG - Intergenic
1028106581 7:86886131-86886153 CAGGTCCCTGAATGTTTTGGGGG - Intronic
1029075755 7:97932629-97932651 CAGCCTCCTGCATTTTTAGGAGG - Intergenic
1029311773 7:99673860-99673882 CACTTTTCTGCAGGTTTTGGTGG - Intronic
1030003765 7:105094888-105094910 CAGTTTCAGGCATGCTTTGGTGG + Intronic
1030688202 7:112507772-112507794 GAAATTCCTGCCTGGTTTGGAGG + Intergenic
1032179788 7:129665041-129665063 CAGATTGCTGCTAGTTTGGGTGG + Intronic
1032890393 7:136189161-136189183 CTGCTTCTTGCTTGTTTTGGGGG - Intergenic
1032895026 7:136240818-136240840 CAGAATCTTGACTGTTTTGGAGG + Intergenic
1033945903 7:146717181-146717203 CAGCTCTCTGCATCTTTTGGTGG - Intronic
1034388640 7:150764069-150764091 CAGATTCATTCATGTGTTGTGGG - Intergenic
1035349428 7:158235920-158235942 CTGCTTCCTGCTTGTTGTGGAGG - Intronic
1035707077 8:1684255-1684277 CAGATACCTTCATCTTTTTGTGG + Intronic
1036241770 8:7087705-7087727 CAGCCTCCTGCATTTTTAGGAGG + Intergenic
1036306552 8:7607122-7607144 CAGCCTCCTGCATTTTTAGGAGG + Intergenic
1036357397 8:8055110-8055132 CAGCCTCCTGCATTTTTAGGAGG + Intergenic
1036618489 8:10406573-10406595 CAGAGTCCTGGGTGTATTGGAGG + Intronic
1036771306 8:11580037-11580059 CAGCTGCTGGCATGTTTTGGTGG + Intergenic
1036830964 8:12019375-12019397 CAGCCTCCTGCATTTTTAGGAGG - Intergenic
1036901107 8:12669819-12669841 CAGCCTCCTGCATTTTTAGGAGG - Intergenic
1037038519 8:14200635-14200657 TATATTCCAGCATGTTTTGTTGG - Intronic
1037124358 8:15327483-15327505 AAGATTACAGCATTTTTTGGAGG - Intergenic
1039102892 8:33959342-33959364 AAAATTCCTGCATGCTTTGGTGG + Intergenic
1042715425 8:71767020-71767042 CAGATACCTGTACATTTTGGTGG - Intergenic
1046741819 8:117837107-117837129 CAGATTCCTGGAGGCTTTGCAGG - Exonic
1047909598 8:129513381-129513403 CAGTTTCCTCCATGTTCTTGTGG - Intergenic
1047934637 8:129764834-129764856 CCGATTCCTGAACCTTTTGGGGG + Intronic
1048744697 8:137601016-137601038 CCGATTTCTGCTTGTTTTGCAGG + Intergenic
1048789910 8:138092357-138092379 CAGATTCCTGGATCTTTTAAAGG + Intergenic
1048863977 8:138745815-138745837 CTGAATCCTGAATGTTTTGGCGG - Intronic
1050478142 9:6062313-6062335 CATAGTCCTGCATTTCTTGGAGG + Intergenic
1052270787 9:26626092-26626114 CAGAGGCCTGCAGGTTTTGTTGG - Intergenic
1052396012 9:27938963-27938985 TAGATTCCTGAATATTTTGAGGG + Intergenic
1057443289 9:95097076-95097098 CAGATGCCTCCCTGTTGTGGGGG - Intergenic
1057603784 9:96483296-96483318 CAGATCCTTGCCTTTTTTGGGGG + Intronic
1060794830 9:126506555-126506577 CAGATGCCTGCAGGCTCTGGAGG - Exonic
1060844798 9:126827588-126827610 CAGCTTCCTGATTGTATTGGTGG + Intronic
1185981789 X:4787665-4787687 CAGATTCCTGCATTATCTGCAGG - Intergenic
1186221102 X:7350087-7350109 CAGCTTCCTGCATGACTTTGAGG - Exonic
1187822286 X:23301023-23301045 CAGATGCCTGGATGATTTGTGGG - Intergenic
1187831138 X:23381963-23381985 CACAATCTTGAATGTTTTGGGGG + Intronic
1188884492 X:35532547-35532569 CATAGTCCTGTATTTTTTGGAGG - Intergenic
1190828948 X:54043748-54043770 AAGATTCCTGTAAGTTTTGGGGG - Intronic
1197812533 X:130459848-130459870 CAGATTCCACTATATTTTGGAGG + Intergenic
1198004784 X:132481920-132481942 CAGGTTTATCCATGTTTTGGTGG - Intronic
1198839556 X:140841738-140841760 CTGATGCCTGCTTTTTTTGGGGG + Intergenic