ID: 1151539571

View in Genome Browser
Species Human (GRCh38)
Location 17:74758224-74758246
Sequence CAGTCCAGGGAGCGGATGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 207
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 188}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151539571_1151539587 15 Left 1151539571 17:74758224-74758246 CCCGCCATCCGCTCCCTGGACTG 0: 1
1: 0
2: 1
3: 17
4: 188
Right 1151539587 17:74758262-74758284 TGGGGCGGCCACTTAGGGCGCGG 0: 1
1: 0
2: 0
3: 7
4: 86
1151539571_1151539589 28 Left 1151539571 17:74758224-74758246 CCCGCCATCCGCTCCCTGGACTG 0: 1
1: 0
2: 1
3: 17
4: 188
Right 1151539589 17:74758275-74758297 TAGGGCGCGGTGAAGCTCCCTGG 0: 1
1: 0
2: 0
3: 5
4: 39
1151539571_1151539582 -4 Left 1151539571 17:74758224-74758246 CCCGCCATCCGCTCCCTGGACTG 0: 1
1: 0
2: 1
3: 17
4: 188
Right 1151539582 17:74758243-74758265 ACTGCGTGGGTGGAGGTGATGGG 0: 1
1: 0
2: 1
3: 10
4: 219
1151539571_1151539581 -5 Left 1151539571 17:74758224-74758246 CCCGCCATCCGCTCCCTGGACTG 0: 1
1: 0
2: 1
3: 17
4: 188
Right 1151539581 17:74758242-74758264 GACTGCGTGGGTGGAGGTGATGG 0: 1
1: 0
2: 1
3: 35
4: 380
1151539571_1151539586 10 Left 1151539571 17:74758224-74758246 CCCGCCATCCGCTCCCTGGACTG 0: 1
1: 0
2: 1
3: 17
4: 188
Right 1151539586 17:74758257-74758279 GGTGATGGGGCGGCCACTTAGGG 0: 1
1: 0
2: 0
3: 21
4: 82
1151539571_1151539583 -3 Left 1151539571 17:74758224-74758246 CCCGCCATCCGCTCCCTGGACTG 0: 1
1: 0
2: 1
3: 17
4: 188
Right 1151539583 17:74758244-74758266 CTGCGTGGGTGGAGGTGATGGGG 0: 1
1: 0
2: 2
3: 41
4: 375
1151539571_1151539591 30 Left 1151539571 17:74758224-74758246 CCCGCCATCCGCTCCCTGGACTG 0: 1
1: 0
2: 1
3: 17
4: 188
Right 1151539591 17:74758277-74758299 GGGCGCGGTGAAGCTCCCTGGGG 0: 1
1: 0
2: 0
3: 6
4: 132
1151539571_1151539590 29 Left 1151539571 17:74758224-74758246 CCCGCCATCCGCTCCCTGGACTG 0: 1
1: 0
2: 1
3: 17
4: 188
Right 1151539590 17:74758276-74758298 AGGGCGCGGTGAAGCTCCCTGGG 0: 1
1: 0
2: 0
3: 4
4: 82
1151539571_1151539585 9 Left 1151539571 17:74758224-74758246 CCCGCCATCCGCTCCCTGGACTG 0: 1
1: 0
2: 1
3: 17
4: 188
Right 1151539585 17:74758256-74758278 AGGTGATGGGGCGGCCACTTAGG 0: 1
1: 0
2: 0
3: 16
4: 150
1151539571_1151539584 0 Left 1151539571 17:74758224-74758246 CCCGCCATCCGCTCCCTGGACTG 0: 1
1: 0
2: 1
3: 17
4: 188
Right 1151539584 17:74758247-74758269 CGTGGGTGGAGGTGATGGGGCGG 0: 1
1: 1
2: 5
3: 88
4: 841

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151539571 Original CRISPR CAGTCCAGGGAGCGGATGGC GGG (reversed) Intronic
900980207 1:6041911-6041933 AAGGCCAGGGAGCGGGTGGGAGG + Intronic
901432166 1:9223046-9223068 CAGGCCAGGGACCAGATGACTGG + Intergenic
903736222 1:25531346-25531368 CAGTCCAGGGAGTGGGTGCCAGG - Intergenic
905869945 1:41397682-41397704 CAGTACAGGCAGGGGATAGCTGG - Intergenic
911254062 1:95614252-95614274 CAGTGCATGGAGCTGAGGGCCGG - Intergenic
915301298 1:154953082-154953104 CAGTCCAGGTAGCAGCTGGTGGG - Intronic
916005261 1:160653955-160653977 CTGGCCAGGGAGCTGATGGCAGG - Intergenic
916268913 1:162919430-162919452 CAGCCCAGGAAGGGGATGGCTGG + Intergenic
916505487 1:165424804-165424826 CAGTCCTGGGTGAGGAAGGCAGG + Intronic
917616704 1:176753212-176753234 CAGTCAAGGGAGAGGAAGCCGGG + Intronic
920315519 1:205073531-205073553 CAGGCCTGGGAGCGGACGGCTGG - Intronic
920645320 1:207799037-207799059 CAGTCCAGTGAGCTGATTGCAGG + Intergenic
920691426 1:208149900-208149922 CAGTCCAGGGTGCCTATTGCTGG + Intronic
922494013 1:226041895-226041917 CAGCCCAGGGACGGGGTGGCTGG + Intergenic
922779388 1:228239871-228239893 TGGTCCAGGGAGGGGAGGGCCGG + Intronic
1062993334 10:1841345-1841367 CACGCCAGGGAGTGCATGGCAGG - Intergenic
1063364328 10:5480662-5480684 CCCTCCAGGGAGGGGAAGGCAGG - Intergenic
1065070143 10:22015005-22015027 CAGTGCAGGGAGAGGAAGGCTGG - Intergenic
1067069171 10:43119809-43119831 CAGGCCAGGGTGTGGGTGGCAGG - Intronic
1069745397 10:70711915-70711937 GAGCCCAGGGAGCGGGTGGGGGG + Intronic
1070779122 10:79127342-79127364 TAGTCCAAGGAGCCCATGGCTGG - Intronic
1071307043 10:84308806-84308828 CAGTACAGGGAGCAGAGGGCAGG - Intergenic
1072614091 10:97038068-97038090 CAGAGCAGGGAGGGGAAGGCAGG - Intronic
1072620240 10:97074826-97074848 CAGCCCTGGGAGAGGATGGGGGG - Intronic
1072632109 10:97153622-97153644 CAGGCCAGTGAGCTGTTGGCAGG - Intronic
1075594214 10:123716207-123716229 CTGTCCAGGAAGCAGATGGATGG + Intronic
1077307849 11:1875928-1875950 CAGTCCAGGGAGGGGCTCGAGGG - Intronic
1082218422 11:49602768-49602790 CAGTCCAGTGAGCTGACAGCAGG + Intergenic
1084150007 11:67283729-67283751 CAGTCCAGGGAGCGGAAAAAGGG - Exonic
1084740688 11:71137630-71137652 CCTTCCAGGGAGTGGGTGGCGGG - Intronic
1085647968 11:78240241-78240263 CATTCCAGGGAAAGGATGCCTGG + Intronic
1086631154 11:89021352-89021374 CAGTCCAGTGAGCTGACAGCAGG - Intronic
1089197564 11:116703550-116703572 TAGCCCAGGGACCCGATGGCAGG + Intergenic
1089290279 11:117433480-117433502 CAGTAGAGGGAGAGGAGGGCTGG + Intronic
1089679979 11:120113925-120113947 CAAGCCAGGGAGGGGATGGGAGG - Intronic
1091752758 12:3032940-3032962 CAGGCCAGGGAGCAGAAGACAGG - Intronic
1092236977 12:6816413-6816435 CAGGCCAGGGAGGGGTGGGCAGG + Intronic
1093972425 12:25386932-25386954 CTCTCCAGGGAGCGGGTGGGTGG + Intergenic
1095613087 12:44155399-44155421 AAGTCTAGGGAGGGGCTGGCTGG - Intronic
1097134550 12:56840942-56840964 CAGTGCAGGGGATGGATGGCGGG - Intergenic
1097973407 12:65659469-65659491 CAGTCGGGAGAGCAGATGGCTGG - Intergenic
1098286796 12:68915396-68915418 CAGTCCAGGGAGGACATGGTGGG - Intronic
1103418781 12:120763160-120763182 CAGAACAGGGAGGAGATGGCTGG + Exonic
1103722574 12:122982557-122982579 CAGAGCTGGGGGCGGATGGCAGG - Intronic
1104645952 12:130497301-130497323 GAGCCCAGGGAGCAGAAGGCAGG - Intronic
1111608765 13:90576425-90576447 CAGTGCATGGAGCGGCTGGCTGG + Intergenic
1111997147 13:95176204-95176226 CACTCCAGGAAGCCGAGGGCAGG + Intronic
1112566187 13:100552969-100552991 CAGGCCAGGTGGCGGGTGGCTGG + Intronic
1113454908 13:110441473-110441495 CAGCCCAGGGAGCCAATGCCAGG + Intronic
1113724401 13:112587738-112587760 CGGACGAGGGAGCGGAGGGCTGG - Intronic
1113935492 13:113992439-113992461 CTGTGCAGCGAGGGGATGGCTGG - Intronic
1114063117 14:19037965-19037987 CAGTCCAGTGCGCGGAGGGACGG + Intergenic
1114063295 14:19038655-19038677 CAGTCCAGGGTGTGGAGGGGTGG + Intergenic
1114098960 14:19361340-19361362 CAGTCCAGGGTGTGGAGGGGTGG - Intergenic
1114099141 14:19362030-19362052 CAGTCCAGTGCGCGGAGGGACGG - Intergenic
1114318701 14:21528817-21528839 AAGGCCAGGGAGCAAATGGCAGG - Intronic
1115017397 14:28633759-28633781 GGGTCCTGGGAGGGGATGGCAGG + Intergenic
1115351307 14:32398551-32398573 CAGTACATGGTGTGGATGGCTGG - Intronic
1119562471 14:75602229-75602251 CACTCCAGGGAGGGGAGGGGAGG - Intronic
1120301644 14:82714942-82714964 CAGGAAAGGGAGGGGATGGCAGG - Intergenic
1120988569 14:90355183-90355205 CAGGCCAGTGAGCGGCAGGCGGG - Intergenic
1122881164 14:104691007-104691029 CAGTCCAGGGATGGGAGGGCAGG - Intronic
1123028773 14:105440876-105440898 CAGTCCAGGGAACAGAGGGGAGG - Intronic
1123666687 15:22613895-22613917 CAGACCAGGAAGCGGTAGGCAGG + Intergenic
1124320529 15:28708468-28708490 CAGACCAGGAAGCGGTAGGCAGG + Intronic
1124334423 15:28846304-28846326 CAGGCCAGGAAGCGGTAGGCAGG + Intergenic
1124481966 15:30086881-30086903 CAGACCAGGAAGCGGTAGGCAGG - Intronic
1124488422 15:30138979-30139001 CAGACCAGGAAGCGGTAGGCAGG - Intronic
1124755105 15:32399341-32399363 CAGACCAGGAAGCGGTAGGCAGG + Intronic
1124777018 15:32597374-32597396 CAGACCAGGAAGCGGTAGGCAGG - Intronic
1126233359 15:46353835-46353857 GAGCCCAGGGTGAGGATGGCTGG - Intergenic
1128133730 15:65247658-65247680 CAGGCAAGGGAATGGATGGCTGG + Intronic
1128999376 15:72319922-72319944 CGGTCCAGGGAGGGGACGGCGGG - Exonic
1129029527 15:72608377-72608399 CAGACCAGGAAGCGGTAGGCAGG - Intergenic
1129475181 15:75780255-75780277 CAGACCAGGAAGCGGTAGGCAGG - Intergenic
1129704501 15:77786586-77786608 CAGAGGAGGGAGGGGATGGCAGG + Intronic
1131177566 15:90219684-90219706 CAGTCCTGGGAGCAGAGGCCGGG + Intronic
1131515978 15:93077036-93077058 CGGGCAAGGGAGGGGATGGCAGG + Intronic
1131536179 15:93239874-93239896 CAGTCCAGGCAGGGGGAGGCAGG - Intergenic
1132655023 16:1038208-1038230 CCTTCCAGGGAGCAGAGGGCTGG - Intergenic
1132945624 16:2530158-2530180 CAGTCCAGGGAGCAGAAAACAGG - Exonic
1133728614 16:8559456-8559478 CAGCTCAGGGAGCCCATGGCGGG - Intergenic
1134862600 16:17574043-17574065 CTGGCAAGGGAGAGGATGGCCGG + Intergenic
1136537748 16:30910405-30910427 CAGGACAGGGAGCGGGTGGGAGG + Intergenic
1137044479 16:35642909-35642931 AAGACCCGGGAGCAGATGGCAGG + Intergenic
1139344066 16:66290658-66290680 CAGTGCAGGGAGTGGCTGGCTGG - Intergenic
1139367830 16:66444470-66444492 CAGTGCAGGGGGAGGATGGAGGG + Intronic
1139596292 16:67960207-67960229 CAAGCCAGGGAGCTGGTGGCGGG - Intronic
1140700946 16:77581077-77581099 CTGTCCAAGGAGAAGATGGCTGG + Intergenic
1142258026 16:89024688-89024710 CACCCCAGGCAGCGGATGACTGG - Intergenic
1142848569 17:2693678-2693700 CAGTTCTGGGAGGCGATGGCAGG - Intronic
1143583956 17:7842252-7842274 GAGTCCAGGGCCCGGATGGAGGG + Intronic
1143635934 17:8163604-8163626 AAGTCCAGGGGGCGGAGGACGGG + Intergenic
1143779273 17:9220946-9220968 CAGGCCAGGGAGGGGGTGGGTGG + Intronic
1144724487 17:17494992-17495014 CAGTGCTGGGGGCGGATCGCCGG + Exonic
1145783230 17:27577650-27577672 CAGGCAAGGGAGAGGGTGGCAGG - Intronic
1147587084 17:41658905-41658927 CAGGGCAGGGAGGGGCTGGCAGG + Intergenic
1148181983 17:45612743-45612765 CATGGCAGGGAGGGGATGGCGGG + Intergenic
1148266876 17:46232957-46232979 CATGGCAGGGAGGGGATGGCGGG - Intergenic
1148652011 17:49257076-49257098 CAGTCCAGGGAGGTCATGGCAGG - Intergenic
1151539571 17:74758224-74758246 CAGTCCAGGGAGCGGATGGCGGG - Intronic
1154451227 18:14475787-14475809 CAGTCCAGGGCACGGCTGGGCGG - Intergenic
1155990708 18:32276253-32276275 CTGTCCTGGGGGCTGATGGCCGG + Intronic
1157804081 18:50645059-50645081 CAGGCCAGGGAGTGGGTGGCTGG + Intronic
1158445605 18:57518007-57518029 AAGGCCAGGGAGCCGATGGGAGG + Intergenic
1160748785 19:723948-723970 CAGACCAGGGAGGGGAGGGGAGG + Intronic
1160952269 19:1673504-1673526 CAGACCAGGGAGAGGCTGACTGG - Intergenic
1165146861 19:33736369-33736391 CAGGCCTGGGAGCGGTTAGCTGG - Intronic
1165960779 19:39532618-39532640 CGGTCCATGGCGCGGATGCCGGG - Exonic
1166110119 19:40616998-40617020 CACGCCAGGGGGCGGATGCCAGG + Exonic
1166394791 19:42431274-42431296 CAGACCAGTGAGAGGAGGGCAGG - Intronic
1166741263 19:45116289-45116311 CAGTGAAGGGCGCAGATGGCAGG - Intronic
1167245253 19:48369258-48369280 CAGGCCAGGGAGGGCATGGAAGG + Intronic
1167934861 19:52897671-52897693 TAGACCCGGAAGCGGATGGCAGG - Intronic
926092524 2:10060042-10060064 CAGTCCCGGGAGCCCAGGGCAGG + Intronic
927707395 2:25304900-25304922 CAGTCTAGGCAGGGGATGGGAGG - Intronic
928205067 2:29278168-29278190 CAGTGCAGGGAGGAGATGTCTGG + Intronic
929565435 2:42980930-42980952 CGGTTCAGAGAGCGGATAGCAGG + Intergenic
932330173 2:70894292-70894314 AAGGGCAGGGAGAGGATGGCTGG - Intergenic
932432619 2:71685034-71685056 CAGTGCAGGGTGCAGCTGGCAGG - Intronic
933674552 2:85042835-85042857 CAGTTCGGGGAGCGGGTGACAGG - Intronic
934883020 2:97999622-97999644 AAATCCAGGCAGCGGATGACAGG - Intergenic
935346441 2:102112501-102112523 CAGTCCAGGGAAAGGAGGGCAGG + Intronic
938480374 2:131657773-131657795 CAGTCCGGGGAGCAGCGGGCAGG + Intergenic
940581445 2:155585012-155585034 CAAGCCAGGGAGCAGATGGGAGG - Intergenic
944428053 2:199604041-199604063 CAGTGCTGGGAGCGGAGGGAGGG + Intergenic
946292421 2:218755190-218755212 CAGTCCAGGGGGAGGGTGGAAGG + Exonic
948560701 2:238849272-238849294 CAGGCCAGGGCGCCGACGGCCGG - Intronic
1172126397 20:32627409-32627431 CAGGCCAGGGTGCGGCTGCCCGG - Intergenic
1174044595 20:47724510-47724532 CCTTCTAGGGAGCGGATGGCTGG - Intronic
1174266431 20:49335547-49335569 CATTCCAGGGAGCTGCGGGCAGG + Intergenic
1175612804 20:60365435-60365457 CAGGGCAGGGAGGGGCTGGCCGG - Intergenic
1176141854 20:63548376-63548398 CTGTCCAGGGAGAGGGTGGGAGG - Intronic
1180481610 22:15760594-15760616 CAGTCCAGTGCGCGGAGGGACGG + Intergenic
1180481787 22:15761284-15761306 CAGTCCAGGGTGTGGAGGGGTGG + Intergenic
1182623459 22:31630311-31630333 AGGGCCAGGGAGCGGGTGGCCGG - Intronic
1183971996 22:41484398-41484420 CAGGCCAGGGAGCTGGTGGATGG + Intronic
1184288078 22:43483266-43483288 GAGTCCTGGGAGTGGAGGGCAGG + Intronic
1184410995 22:44326395-44326417 CAGCAGAGGGAGGGGATGGCCGG - Intergenic
1184610051 22:45597597-45597619 CAGCCCAGGGAGGGGCAGGCAGG + Intronic
1185078616 22:48696644-48696666 GTGTCCAGGCAGCTGATGGCTGG + Intronic
951202461 3:19890429-19890451 CAGTCCTGGGAGAGGATGGTAGG + Intronic
953890512 3:46748891-46748913 CAGTGCAGGGACAGGGTGGCAGG + Intronic
956674367 3:71720729-71720751 CAGTCCAGGTGGGGGATGCCTGG + Intronic
956920566 3:73924269-73924291 CATTCCAGGGAGTGGAAGTCAGG + Intergenic
959252422 3:103965661-103965683 CACTCCAGGGAGAAGAAGGCAGG + Intergenic
960840796 3:121956578-121956600 AAGTCCAGGGGGCGCCTGGCAGG + Intergenic
961657580 3:128451933-128451955 CAGTGCAGGGAGCAGGTGTCTGG - Intergenic
964435116 3:156643367-156643389 AAGTCCAGGGAGTGGTTGGAGGG - Intergenic
965058257 3:163749498-163749520 CAGCCCAGGCAGGGAATGGCTGG - Intergenic
969624284 4:8294488-8294510 GAGTCCAGGAAGCTGATGGTGGG - Intronic
977397315 4:96486770-96486792 CTGTTCAGGGAGGGGATGGAAGG + Intergenic
979976002 4:127197001-127197023 CAGTCTTGGGAGGGAATGGCAGG - Intergenic
981748021 4:148069381-148069403 CCTTCCAGGGAGGGGAGGGCTGG + Intronic
983519937 4:168697580-168697602 CAGTCCATGGAGGGGAGAGCAGG - Intronic
984836547 4:184027737-184027759 CAGTCCAGTAAAGGGATGGCAGG - Intergenic
985675712 5:1230316-1230338 CACCCCAGGGAGCTCATGGCAGG - Intronic
985782547 5:1878678-1878700 CCGTCCAGGGAGTGGAAGGGCGG + Exonic
989864007 5:46423796-46423818 CAGTCCAGTAATGGGATGGCTGG + Intergenic
991298332 5:65103815-65103837 CAGGCCGGGGAGCTCATGGCAGG + Intergenic
994678150 5:102850716-102850738 TAGTCGAGGGGGCGGCTGGCGGG + Intronic
1001397279 5:171426418-171426440 CAGTGCATGGAGGGGAGGGCTGG + Intronic
1003176699 6:3757409-3757431 CAGTCCAGGGCAGGGGTGGCAGG - Intergenic
1005840912 6:29744202-29744224 CAGGCCAGGGTGGGGATAGCAGG - Intergenic
1006518831 6:34559859-34559881 CAGCCCAGGGAGCTGGAGGCAGG - Intergenic
1006911224 6:37564892-37564914 CAGTCCAGGGAGGGGAACACGGG - Intergenic
1007816291 6:44527764-44527786 CAGCCCAGGGAGGGCAGGGCTGG + Intergenic
1010277958 6:73990906-73990928 CAGCACTGGGAGCGGCTGGCGGG - Intergenic
1010914205 6:81595629-81595651 CAGTACAGAGAGTGGATGGAAGG - Intronic
1016934745 6:149441288-149441310 GAGGCCAGGCAGCGGGTGGCAGG + Intergenic
1017852202 6:158314490-158314512 CAGTGCAGGGAGAGGACAGCAGG - Intronic
1018705051 6:166457969-166457991 AAGTCCAGGGAGCTGGTGGTTGG - Intronic
1019406996 7:889128-889150 CCGTCCAGGGAGTGCATGGGAGG + Intronic
1019729743 7:2623345-2623367 GAGGCCAGGGAGGGGCTGGCAGG + Intergenic
1019743815 7:2688570-2688592 CTGGCCTGGGAGAGGATGGCGGG - Intronic
1020444402 7:8254373-8254395 CAGTCCAGGCAGGGGAAGGGAGG + Intronic
1024232515 7:47373465-47373487 GAGCCCAGGGAGCGGATGCAAGG - Intronic
1029459582 7:100687241-100687263 CAGGCCAGGGAGGGGAGGCCTGG - Intronic
1029545283 7:101207308-101207330 CTGTCCAGGGAGGGGAGGGGAGG + Intronic
1031981828 7:128132590-128132612 AATTCCAGGAAGCGGTTGGCTGG + Intergenic
1032708639 7:134443579-134443601 CAGGGCAGGGAGCACATGGCAGG + Intronic
1034460467 7:151195353-151195375 CAGTCCAGGGACCTGACTGCAGG - Intronic
1034960611 7:155362134-155362156 CAGTGCAGGGAGTGGATGCCAGG - Intronic
1035118000 7:156540921-156540943 CAGGCCAGGAAGCAGGTGGCAGG + Intergenic
1035219737 7:157399251-157399273 CAGACAAGGCAGGGGATGGCGGG - Intronic
1036645356 8:10608911-10608933 CTGTCCAGGGAGCTGAGGGAGGG - Exonic
1036794668 8:11746838-11746860 CAGGCCAGGGAGCGGAGCACAGG - Intronic
1045336248 8:101206110-101206132 CTGGCCCGGGAGCGGATCGCGGG + Intronic
1048224920 8:132575845-132575867 CAGTCCAGTGAGGGTAGGGCTGG + Intronic
1048345776 8:133573071-133573093 CAGGCCAGGGCCCGCATGGCCGG + Intergenic
1049039949 8:140105037-140105059 CAGTCCTGGGGGCAGGTGGCTGG - Intronic
1050093962 9:2044319-2044341 GACTCCAGGGAGCACATGGCAGG + Intronic
1054926088 9:70590024-70590046 CAGTCCAGGGCTCAGACGGCTGG + Intronic
1057131764 9:92658893-92658915 AAGTCCTGGGAGGGGCTGGCTGG - Intronic
1057211160 9:93201859-93201881 CAGTTCAGGAAGCGGCCGGCAGG - Intronic
1058677172 9:107410200-107410222 CAGTCCAGGGAGAGGCTGGCTGG + Intergenic
1060816417 9:126637831-126637853 CAGTACAGAGAGCGGGGGGCGGG - Intronic
1060839324 9:126781715-126781737 GAGGCCAGGGAGCGGAGGTCGGG + Intergenic
1060884533 9:127141068-127141090 CTGTCCAGGGAGTGGAGGGATGG + Intronic
1061055969 9:128223081-128223103 CAGCCCAGGGCGCAGGTGGCCGG + Intronic
1061533895 9:131235746-131235768 CTGCCCAGGGAGGAGATGGCGGG + Intergenic
1062737729 9:138147598-138147620 CCGTCAAGGCAGGGGATGGCGGG + Intergenic
1186935829 X:14449597-14449619 TAGTCTTGGGAGGGGATGGCAGG - Intergenic
1189436608 X:40998366-40998388 CTGTCCAGAGAGAGGTTGGCAGG - Intergenic
1190066802 X:47247226-47247248 GGGGCCAGGGAGAGGATGGCTGG + Intronic
1195651483 X:107289562-107289584 CAGCCAAGGGAGGGGATGGTGGG - Intergenic
1199429233 X:147740309-147740331 CATTCAAGGGTGAGGATGGCAGG - Intergenic