ID: 1151540778

View in Genome Browser
Species Human (GRCh38)
Location 17:74763641-74763663
Sequence CCTCCCATGAAGGAGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 418
Summary {0: 1, 1: 2, 2: 2, 3: 47, 4: 366}

Found 15 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151540778_1151540796 6 Left 1151540778 17:74763641-74763663 CCCTCCTCCTCCTTCATGGGAGG 0: 1
1: 2
2: 2
3: 47
4: 366
Right 1151540796 17:74763670-74763692 GGTGTGGGCTGGGGGAGCGGGGG 0: 1
1: 0
2: 11
3: 236
4: 2339
1151540778_1151540787 -5 Left 1151540778 17:74763641-74763663 CCCTCCTCCTCCTTCATGGGAGG 0: 1
1: 2
2: 2
3: 47
4: 366
Right 1151540787 17:74763659-74763681 GGAGGCCCAGAGGTGTGGGCTGG 0: 1
1: 0
2: 3
3: 51
4: 593
1151540778_1151540790 -2 Left 1151540778 17:74763641-74763663 CCCTCCTCCTCCTTCATGGGAGG 0: 1
1: 2
2: 2
3: 47
4: 366
Right 1151540790 17:74763662-74763684 GGCCCAGAGGTGTGGGCTGGGGG 0: 1
1: 0
2: 2
3: 78
4: 581
1151540778_1151540786 -9 Left 1151540778 17:74763641-74763663 CCCTCCTCCTCCTTCATGGGAGG 0: 1
1: 2
2: 2
3: 47
4: 366
Right 1151540786 17:74763655-74763677 CATGGGAGGCCCAGAGGTGTGGG 0: 1
1: 0
2: 2
3: 39
4: 408
1151540778_1151540793 3 Left 1151540778 17:74763641-74763663 CCCTCCTCCTCCTTCATGGGAGG 0: 1
1: 2
2: 2
3: 47
4: 366
Right 1151540793 17:74763667-74763689 AGAGGTGTGGGCTGGGGGAGCGG 0: 1
1: 2
2: 14
3: 203
4: 1967
1151540778_1151540802 30 Left 1151540778 17:74763641-74763663 CCCTCCTCCTCCTTCATGGGAGG 0: 1
1: 2
2: 2
3: 47
4: 366
Right 1151540802 17:74763694-74763716 CTAGTGTAGGGAGTGGCAGTGGG 0: 1
1: 0
2: 2
3: 13
4: 151
1151540778_1151540794 4 Left 1151540778 17:74763641-74763663 CCCTCCTCCTCCTTCATGGGAGG 0: 1
1: 2
2: 2
3: 47
4: 366
Right 1151540794 17:74763668-74763690 GAGGTGTGGGCTGGGGGAGCGGG 0: 1
1: 2
2: 12
3: 147
4: 1417
1151540778_1151540789 -3 Left 1151540778 17:74763641-74763663 CCCTCCTCCTCCTTCATGGGAGG 0: 1
1: 2
2: 2
3: 47
4: 366
Right 1151540789 17:74763661-74763683 AGGCCCAGAGGTGTGGGCTGGGG 0: 1
1: 1
2: 6
3: 70
4: 656
1151540778_1151540798 18 Left 1151540778 17:74763641-74763663 CCCTCCTCCTCCTTCATGGGAGG 0: 1
1: 2
2: 2
3: 47
4: 366
Right 1151540798 17:74763682-74763704 GGGAGCGGGGGCCTAGTGTAGGG 0: 1
1: 0
2: 1
3: 30
4: 433
1151540778_1151540797 17 Left 1151540778 17:74763641-74763663 CCCTCCTCCTCCTTCATGGGAGG 0: 1
1: 2
2: 2
3: 47
4: 366
Right 1151540797 17:74763681-74763703 GGGGAGCGGGGGCCTAGTGTAGG 0: 1
1: 0
2: 3
3: 24
4: 263
1151540778_1151540799 23 Left 1151540778 17:74763641-74763663 CCCTCCTCCTCCTTCATGGGAGG 0: 1
1: 2
2: 2
3: 47
4: 366
Right 1151540799 17:74763687-74763709 CGGGGGCCTAGTGTAGGGAGTGG 0: 1
1: 0
2: 0
3: 11
4: 410
1151540778_1151540801 29 Left 1151540778 17:74763641-74763663 CCCTCCTCCTCCTTCATGGGAGG 0: 1
1: 2
2: 2
3: 47
4: 366
Right 1151540801 17:74763693-74763715 CCTAGTGTAGGGAGTGGCAGTGG 0: 1
1: 0
2: 2
3: 19
4: 218
1151540778_1151540785 -10 Left 1151540778 17:74763641-74763663 CCCTCCTCCTCCTTCATGGGAGG 0: 1
1: 2
2: 2
3: 47
4: 366
Right 1151540785 17:74763654-74763676 TCATGGGAGGCCCAGAGGTGTGG 0: 1
1: 0
2: 1
3: 38
4: 385
1151540778_1151540795 5 Left 1151540778 17:74763641-74763663 CCCTCCTCCTCCTTCATGGGAGG 0: 1
1: 2
2: 2
3: 47
4: 366
Right 1151540795 17:74763669-74763691 AGGTGTGGGCTGGGGGAGCGGGG 0: 1
1: 0
2: 2
3: 105
4: 1350
1151540778_1151540788 -4 Left 1151540778 17:74763641-74763663 CCCTCCTCCTCCTTCATGGGAGG 0: 1
1: 2
2: 2
3: 47
4: 366
Right 1151540788 17:74763660-74763682 GAGGCCCAGAGGTGTGGGCTGGG 0: 1
1: 0
2: 10
3: 46
4: 504

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151540778 Original CRISPR CCTCCCATGAAGGAGGAGGA GGG (reversed) Intronic
900393215 1:2442900-2442922 GCAGCCATGAAGGAGGAGGCGGG - Intronic
901761446 1:11474436-11474458 CTTCCCATGGAGGAGGATTAAGG - Intergenic
901805603 1:11736550-11736572 ATTCCCCTGGAGGAGGAGGAAGG + Intronic
902239235 1:15077349-15077371 CCTCCAGTGAAGGAGGATGGTGG - Intronic
903935664 1:26893176-26893198 CCTTTCTTGGAGGAGGAGGAGGG - Intronic
904041886 1:27590109-27590131 CCTCCCCTCCAGGAGAAGGAGGG - Intronic
904302743 1:29565813-29565835 CCTCCCCTGATGGGAGAGGAAGG - Intergenic
904323493 1:29711821-29711843 CCTCTCAGGAAGTAGGTGGAGGG + Intergenic
905051171 1:35052483-35052505 CTTCCCATGGAGGGGCAGGAAGG + Intergenic
905320876 1:37116240-37116262 CCTACCATGATGGAACAGGAGGG + Intergenic
906901816 1:49843920-49843942 CCTGCCAGGAAGCAGGAGGAAGG + Intronic
907256153 1:53180641-53180663 CCTCCCGAGAAGGAGGAGCAAGG + Intergenic
907331936 1:53677278-53677300 CCTTCCATGAAGGACCAGCAGGG + Intronic
907393557 1:54174400-54174422 CCTACTATGTAGAAGGAGGATGG - Exonic
908402503 1:63784734-63784756 CCTACCATGACAGAGGGGGAAGG + Intronic
908838719 1:68256513-68256535 CTTCCCATGAGGGAGAAGGTAGG - Intergenic
908958969 1:69671400-69671422 CCTCTCCTCAAGCAGGAGGAAGG + Intronic
909483610 1:76151164-76151186 CCACCAATGAAGGCGGAGGAAGG - Intronic
910148718 1:84114727-84114749 GATCCCATGAAGGAAGAGAATGG - Intronic
910639819 1:89447249-89447271 CCTCTCCTCAAGGAGAAGGAAGG + Intergenic
911148212 1:94571745-94571767 CCTCCCAGGAAAGTGGAGAAGGG + Intergenic
912414672 1:109499822-109499844 CAGCCCAGGAAGGAGGGGGAAGG - Intronic
912491008 1:110062858-110062880 CCTCCCCTGACAGAGGATGAGGG + Intronic
912513466 1:110203594-110203616 CCTCCCAGGAAGCAGGAAGCTGG - Intergenic
912980586 1:114368174-114368196 CCTCCCCTAGAGGAAGAGGAAGG - Intergenic
914742073 1:150473090-150473112 CACCCCATGGAGGAGGAGGTGGG + Exonic
915584438 1:156836615-156836637 CCCACCATGAAAGAGGAGGGAGG - Intronic
918069183 1:181122499-181122521 CTTCTCAGGAAGGAGGAGAAGGG + Intergenic
918144927 1:181747248-181747270 CCTCCCATGAGGGCAGAGCAGGG - Intronic
918476256 1:184928251-184928273 CCTCTCCTGAAGCAGAAGGAAGG + Intronic
918847843 1:189641792-189641814 CATCCCATGAAGAAGGTAGAAGG + Intergenic
919800923 1:201354207-201354229 ACTCCCAAGAAGGAGGAGGCTGG + Intergenic
919824155 1:201492044-201492066 GCTCCCAAGAAGGAGGGAGAGGG + Intronic
920435868 1:205946734-205946756 ACTCCCAGGAAGAAGTAGGATGG + Intergenic
920460709 1:206137633-206137655 CATTCCCTGAAGGAGGAGAAAGG - Intergenic
920500576 1:206482593-206482615 CCTCCCATCAAGGAGGAGGATGG + Intronic
920868966 1:209777334-209777356 GCTCCCTGTAAGGAGGAGGAAGG - Exonic
921889434 1:220339079-220339101 CAAACCAGGAAGGAGGAGGATGG - Intergenic
922421470 1:225463493-225463515 CCTCCCAAGGAAGAGGAGGGAGG + Intergenic
923337797 1:232985249-232985271 TTTCCCATGAAGGAGAGGGAGGG + Intronic
924533623 1:244915004-244915026 CCTCCAATGAAGGAAAAGAAAGG + Intergenic
1063105287 10:2987080-2987102 TCTCCAATGAAGCAGGATGAAGG + Intergenic
1063353487 10:5376903-5376925 CCTTCCCTGACAGAGGAGGAGGG - Intergenic
1065149822 10:22811295-22811317 CATTCCATGAAGTAGGAGAAGGG + Intergenic
1065948110 10:30625859-30625881 CCTCCCCTAAAGCAGGGGGATGG - Intronic
1067429151 10:46231428-46231450 CCTCCCTTGAGGGATGAGGAAGG + Intergenic
1067444532 10:46332560-46332582 CCTCCCTTGAGGGATGAGGAAGG - Intergenic
1068783444 10:60944766-60944788 CCGCCCAGGGAGGAGGAGGCTGG - Intronic
1069058629 10:63870739-63870761 ATTCTCATGAAGAAGGAGGATGG - Intergenic
1069694365 10:70376019-70376041 CATCCCATGAAGAAAGGGGACGG - Intronic
1070483690 10:76909928-76909950 CCACCCTTGAGTGAGGAGGAGGG + Intronic
1071573659 10:86711312-86711334 CAGCCCGGGAAGGAGGAGGAAGG - Intronic
1071718617 10:88120859-88120881 CTTCAGGTGAAGGAGGAGGAAGG - Intergenic
1074858001 10:117487551-117487573 CCTCCCAGCAAAAAGGAGGAAGG - Intergenic
1075069631 10:119312366-119312388 TCTCCCAAGGAGCAGGAGGAGGG + Intronic
1075288622 10:121209082-121209104 CCACCCCTGAAGCAGGTGGAAGG + Intergenic
1075648847 10:124114513-124114535 ACCTCCTTGAAGGAGGAGGAGGG + Intergenic
1075806777 10:125194687-125194709 CCCCCAATGACGGAGGAGGTTGG + Intergenic
1076121926 10:127943473-127943495 TCTCCCATGCAGGAGGGAGACGG + Intronic
1076733215 10:132448433-132448455 CCGCCTAAGAAGGAGAAGGAGGG + Exonic
1077306128 11:1869428-1869450 GCTGCCTTGAAGGAGGAGGGAGG + Intronic
1077524182 11:3054266-3054288 CCTCCCAGTAAGGAGGAAGATGG - Intronic
1077832549 11:5890332-5890354 CCTGCAATGAAGGAGCAGGTGGG + Intronic
1078332957 11:10441025-10441047 ACTCCCCTGAAGAAGGAGGAGGG + Intronic
1078892064 11:15566530-15566552 CCTACCATGAAGGAGAAAGAGGG - Intergenic
1079318132 11:19427220-19427242 CCTCCCCTGCAGAAAGAGGATGG + Intronic
1080197907 11:29633075-29633097 CCTCCCATGAAGGAAAAGAGAGG + Intergenic
1080740058 11:35055633-35055655 CCTTCCATGAAGGGGGATTATGG - Intergenic
1080806930 11:35662617-35662639 CGTGCCTTGGAGGAGGAGGAGGG - Intergenic
1083893970 11:65611168-65611190 CCTCCCAGAAAGGAGAAGTAGGG - Intronic
1084566357 11:69931115-69931137 ACACCCAGGGAGGAGGAGGAGGG - Intergenic
1084654385 11:70506677-70506699 CCCTCCATGAAGCAGGAGGGAGG - Intronic
1084961712 11:72720323-72720345 GGTCTCATGATGGAGGAGGAAGG - Intronic
1085766540 11:79288064-79288086 TCTTCCTTGAAGGAGAAGGATGG + Intronic
1085987788 11:81807081-81807103 CCTCCCAGAAAGGCGGAGAAGGG - Intergenic
1087094294 11:94305316-94305338 CATCACAGGAATGAGGAGGAGGG - Intergenic
1087365865 11:97217886-97217908 TCTCCCTTGAGGGAAGAGGAGGG + Intergenic
1087793101 11:102428094-102428116 ACTCCCAGGAAGGGTGAGGAAGG - Intronic
1087844838 11:102961257-102961279 CCTTCCTTGACAGAGGAGGAAGG - Intergenic
1089295441 11:117464610-117464632 CGTGCCAGGAAGAAGGAGGAAGG + Intronic
1091900632 12:4141282-4141304 CCCACCAGGAAGCAGGAGGATGG - Intergenic
1092779076 12:11968697-11968719 CCTCCCATGGTGGTGGAGGTGGG + Intergenic
1093214126 12:16343260-16343282 CCTCACATGACGGAGGGGGCAGG - Intergenic
1094209909 12:27878106-27878128 CCTTCCTTGAAGGAGGAGCTGGG + Intergenic
1094435797 12:30419424-30419446 CCTCACATGATGGAGCAGGGAGG - Intergenic
1096054231 12:48637615-48637637 CCTCACATGGAAGAGAAGGAAGG - Intergenic
1096424095 12:51486349-51486371 CCTTCCTTGAAGGGGGAGAATGG + Intronic
1097144636 12:56931741-56931763 CCTTGCATGAAGGAGCTGGAAGG - Intronic
1097590894 12:61573940-61573962 ACTCACATGGAGGAGGTGGAAGG - Intergenic
1099050290 12:77774304-77774326 GCTTCCATGAAGCAGTAGGATGG + Intergenic
1099292325 12:80787960-80787982 CCCCCCAGAAAGGAGGAGAAGGG + Intergenic
1100376249 12:94018556-94018578 CTTCCCATGGTGGAGGATGAGGG - Intergenic
1101632649 12:106510731-106510753 CCTGCCATGAGGGCTGAGGAAGG - Intronic
1102027214 12:109720340-109720362 CCTCCCTTGGAGGAGGAGGGAGG + Intronic
1102349713 12:112183555-112183577 GTCCCCATGAAGGAGGATGATGG + Intronic
1102482825 12:113235764-113235786 CTTCCCAAGAAGGTGGAAGATGG + Intronic
1102494571 12:113310617-113310639 TCTGCCATGAAGGTGGAAGAGGG - Intronic
1102582677 12:113900678-113900700 CTCCTGATGAAGGAGGAGGAAGG + Intronic
1103235145 12:119366474-119366496 CTTCTCCTGAAGGAGGAGCAAGG + Intronic
1103702229 12:122853849-122853871 GCTCCCATGAAGGAGGTCAACGG - Intronic
1103946339 12:124528769-124528791 CCTAGCCTGAAGGAGGAGAAAGG + Intronic
1104373212 12:128242662-128242684 AGGCCCATGAAGGAGGAGGATGG + Intergenic
1104433053 12:128732461-128732483 CCTCCCAGGAAGTAGAGGGAGGG - Intergenic
1104589719 12:130074647-130074669 CCGCCACTGAAGGAGGAGAAGGG + Intergenic
1107101470 13:36597944-36597966 CCTCACATGACTGAGAAGGAAGG - Intergenic
1110282942 13:73716567-73716589 CTTCCCTGGAAGGAGGAGAAAGG - Intronic
1111002966 13:82208659-82208681 CCCACCATGGTGGAGGAGGAGGG - Intergenic
1111502334 13:89138107-89138129 CCTCCCATGGAGCAAGAGGTAGG + Intergenic
1111831548 13:93336517-93336539 CCAACCTTGAAGGAGGAGAATGG - Intronic
1113244354 13:108377705-108377727 CCTCCCCTGAAGCTGGGGGAAGG + Intergenic
1117338548 14:54775145-54775167 GCCCCAAGGAAGGAGGAGGATGG + Intronic
1117607044 14:57440576-57440598 CCTCTCCTGAAGCAGAAGGAAGG + Intergenic
1117643988 14:57831451-57831473 CCTCCCAGGACAGAGGAGGGTGG + Intronic
1118075698 14:62296158-62296180 CCTCACATGAAGGAGAAGTTTGG + Intergenic
1119022208 14:71125248-71125270 CCTCCCAGAAAGGCGGAGAAGGG - Intergenic
1119474658 14:74920141-74920163 CCAGCCAGGAAGGAGGAGGAAGG + Intronic
1119478123 14:74942792-74942814 CCTCCTATGGAGGAGGGGGCAGG + Intronic
1120028866 14:79616952-79616974 TCTCCCAGGAAGGAAGAGGTCGG - Intronic
1120827944 14:88971950-88971972 TCTCCCATGAAGGCTGGGGAAGG + Intergenic
1121161281 14:91743712-91743734 CCTCCCATGCAGAAGGCAGAAGG - Intronic
1121781586 14:96625499-96625521 CCTCCCAGCGAGGAGGAGAAGGG - Intergenic
1122495847 14:102154371-102154393 CCTCACATGGTGGAGGGGGAAGG + Intronic
1122878048 14:104677850-104677872 CCTCCTTGGGAGGAGGAGGAAGG - Intergenic
1122878054 14:104677860-104677882 CCTCCCAAGGAGGAGGCAGATGG + Intergenic
1123072998 14:105651268-105651290 CCTCCCAGGCTGGGGGAGGACGG + Intergenic
1123092922 14:105750037-105750059 CCTCCCAGGCTGGGGGAGGACGG + Intergenic
1124149008 15:27160062-27160084 CCACCCAGGAAAGAGCAGGAGGG - Intronic
1126317257 15:47383375-47383397 CCTCCCATGACGAGGGAAGATGG + Intronic
1126732664 15:51699949-51699971 CCTCCTTTCAAGGAGGAGGGTGG + Intronic
1127509085 15:59622548-59622570 CCTCCTCTGAAGGAGGTAGAAGG + Exonic
1127630895 15:60826661-60826683 TTTCCCATGGAGGAGGAGGAGGG + Intronic
1128155465 15:65389047-65389069 TGTTCCATGAAGGAGGAAGAAGG - Intronic
1128286122 15:66438565-66438587 TTTCTCCTGAAGGAGGAGGAAGG - Intronic
1129780443 15:78266573-78266595 CCTTCCATGAAGGTAGAGGAAGG - Intronic
1131163951 15:90128824-90128846 CCTTCCAAGAAGGAGAAAGACGG + Intergenic
1132083711 15:98888969-98888991 CCAGCCAGCAAGGAGGAGGATGG + Intronic
1132230698 15:100181722-100181744 TCTCTCCTGAAGGAGGAGGAAGG + Intronic
1133294316 16:4743469-4743491 TCCCCCAGGAAGGAGGAGGAGGG - Intronic
1133337527 16:5015654-5015676 CCCCCTAAGAAGAAGGAGGAAGG + Exonic
1133758677 16:8781172-8781194 GCTTCCATGATGGAGGATGATGG + Intronic
1133930226 16:10226204-10226226 CCTCCCAGGAAGGAAGAGATGGG + Intergenic
1134066716 16:11233114-11233136 CCCCCCATGAAGAGGGAGGAGGG - Intergenic
1134280231 16:12810562-12810584 GCTCCCATGAAGGAGGAGCCTGG - Intergenic
1135024621 16:18989554-18989576 CCACCCTTGGAGGAGGAGGAAGG + Intronic
1135236240 16:20759163-20759185 CCTCCCAAGAGGTAGGGGGATGG - Intronic
1137018500 16:35399059-35399081 CATCTGATGAAGGAGGATGAAGG - Intergenic
1137520554 16:49191544-49191566 GCTTACATGAGGGAGGAGGAGGG + Intergenic
1139668259 16:68473295-68473317 GCTCCCATCAAGGAGGTGGGTGG + Intergenic
1139813648 16:69647042-69647064 CCGCCCATGGAGGAAGAGGAGGG - Exonic
1140705849 16:77628448-77628470 CCTACCATGAAGAATGATGAAGG - Intergenic
1140756781 16:78074741-78074763 CCTCACCTGAAGCAGGAGAAGGG + Intergenic
1142308141 16:89297043-89297065 CCTCCCAGGGAGGTAGAGGAAGG - Intronic
1143935473 17:10479866-10479888 CCTCACTGGAAGGAGGAAGATGG + Intergenic
1143937540 17:10502616-10502638 CCTCCTATGAATGAGGAATATGG - Intronic
1144533187 17:16060112-16060134 CCTCCCCTTCAGGATGAGGAAGG + Intronic
1144577242 17:16436818-16436840 CCTCCCAAGGAGGATGAGGATGG + Exonic
1146000200 17:29126286-29126308 CCTCCCTTGTGAGAGGAGGAGGG + Intronic
1146673596 17:34758222-34758244 CCTCCCAGGGATGAGGAGGAAGG - Intergenic
1148906220 17:50914049-50914071 CCTCTGATGAGGGAGGAAGAAGG + Intergenic
1149296430 17:55265767-55265789 CCTTTCATGGAGGAGGAGGAAGG - Intronic
1149430383 17:56592776-56592798 CCGGCCAAGGAGGAGGAGGATGG + Intergenic
1150124492 17:62627646-62627668 CCTCCCGGGGAGGAGGAGGGAGG - Exonic
1150648597 17:66995360-66995382 CCTCTCATGAAGCCTGAGGAAGG + Intronic
1151042734 17:70882640-70882662 TCTTCCAAGAGGGAGGAGGAGGG + Intergenic
1151156240 17:72124393-72124415 CCTCCCACGAAGGGCGAAGATGG + Exonic
1151396160 17:73824403-73824425 CCTCCCAAGAAGCAGTAGGACGG - Intergenic
1151540778 17:74763641-74763663 CCTCCCATGAAGGAGGAGGAGGG - Intronic
1151817766 17:76479618-76479640 CCTCTCTGGAAGGAGGAGGCCGG - Intronic
1151870945 17:76836350-76836372 CCTCCCATAAAGGAAGTTGAAGG - Intergenic
1151933533 17:77247784-77247806 CCTCACATGGAGGGGGAGGGAGG - Intergenic
1152418083 17:80175877-80175899 CCTGCCAGGAAGCAGGAGGAGGG - Intronic
1152634874 17:81426826-81426848 CTGCCCATGAACGAGGAGGCCGG - Exonic
1152820550 17:82435667-82435689 CCTGCAAGGAAGGAGCAGGACGG - Exonic
1203165178 17_GL000205v2_random:87189-87211 TCTCCCAGGAAGCAGAAGGAGGG + Intergenic
1154326243 18:13392874-13392896 TCGCTCATAAAGGAGGAGGAGGG + Intronic
1154447605 18:14448208-14448230 CCTCCCACAAATGAGCAGGAGGG - Intergenic
1155512776 18:26594184-26594206 CTTCCCTAGCAGGAGGAGGAAGG - Intronic
1156635101 18:39018413-39018435 CCTGCCATAAAGGAGCAAGAAGG - Intergenic
1157476608 18:48028015-48028037 CATCCCCAGAGGGAGGAGGAAGG + Exonic
1157622322 18:49023786-49023808 CCAGGCATGGAGGAGGAGGAAGG - Intergenic
1157731299 18:50006711-50006733 CCACCCAGAAATGAGGAGGAAGG - Intronic
1158695605 18:59700513-59700535 ACTCCTATGAAAGAGGTGGATGG - Intergenic
1158871187 18:61689778-61689800 CATCCCAACAAGGAAGAGGAGGG + Intergenic
1160425792 18:78778273-78778295 CCCTCCATGAAGCCGGAGGACGG + Intergenic
1161391559 19:4023869-4023891 CCGCCCAGGAAGGAGGATGAGGG - Intronic
1162145100 19:8608655-8608677 GAGCCCCTGAAGGAGGAGGATGG - Intronic
1162532839 19:11245761-11245783 CCCCCCAACAAGGAGAAGGAAGG + Intronic
1163105142 19:15119082-15119104 CTTCACACGAAGGAGGAGGAAGG - Intronic
1163262511 19:16199694-16199716 CCTTCCAAGAAGGCGGGGGAGGG - Intronic
1163290668 19:16377217-16377239 CCTCCCAAGGAGGAGGTGAAAGG + Exonic
1163481884 19:17561433-17561455 ACTTCCAAGAAGCAGGAGGAAGG + Intronic
1164308791 19:24028888-24028910 CCTAACATGGAGGAGGAGGCAGG - Intergenic
1164497671 19:28783322-28783344 CCTCCCCTGAAGGGGGTGGTGGG + Intergenic
1164526533 19:29017321-29017343 CCCTCCATGGAGAAGGAGGATGG - Intergenic
1165803719 19:38567849-38567871 CCTCCAAAGAAGGAGGAAGCTGG + Exonic
1166039268 19:40192026-40192048 TCCCCCATGGAGGAGGAGGAGGG + Exonic
1167048998 19:47067485-47067507 CCCCCAACGGAGGAGGAGGAAGG - Exonic
1167139037 19:47636903-47636925 CCTGCCTTGAAGGAAGAGGTTGG - Intronic
1168552258 19:57306280-57306302 CATCCTCTGAAGGTGGAGGATGG - Intergenic
1168647018 19:58065975-58065997 CCTGCCATGAAGGAGGAGGAGGG + Intronic
1168720031 19:58549771-58549793 CCTGACCTGAAGGAGGAGGATGG + Exonic
925399736 2:3563708-3563730 CCTCTAGTGAAGGAGGAGGGGGG + Intergenic
927570336 2:24153599-24153621 CCTCCCTTTAAGCAGAAGGAAGG + Intronic
928085025 2:28340539-28340561 CCTCCCCTGATGGAGGGGTACGG + Intergenic
928163940 2:28955657-28955679 CCTCCCAGGAAGTGGGAGTACGG - Intergenic
928933379 2:36648628-36648650 CATCCCGTGAAGCAGGAGGGAGG - Intergenic
929009409 2:37426127-37426149 CCTCAAAGGAAGGAGGAGAAGGG - Intergenic
929076909 2:38085590-38085612 CCCCCCAGAAAGGAGGAGAAGGG + Intronic
930054903 2:47244379-47244401 CATCCCATCCAGGAGGATGAAGG + Intergenic
930086725 2:47503161-47503183 TCTCCAATGAAGGAGGGGAATGG - Intronic
932439730 2:71726298-71726320 CCTACCCTCAAGGAGGAGGATGG - Intergenic
932750909 2:74371166-74371188 TCTCCTTTGCAGGAGGAGGAGGG - Exonic
934568682 2:95354581-95354603 CCTCCCAGGATGGAGGAGCAAGG - Intronic
935072496 2:99707362-99707384 TCTCCCATGAAGCATGAAGATGG - Intronic
935219217 2:100997785-100997807 CCTCCCATGTAGAATGGGGATGG + Intergenic
935863212 2:107356928-107356950 CCTTCCCTGGAGCAGGAGGAAGG - Intergenic
936012157 2:108931697-108931719 ATTCCCTTGAAGGAGGAGGTGGG + Intronic
936297241 2:111276281-111276303 CCACCCAGGAAGCAGGAGGTGGG - Intergenic
937907841 2:127061038-127061060 CCCCTCAGGAAGGAGGTGGAGGG - Intronic
938128386 2:128690682-128690704 CCAGCCATGAAGGAGCAAGAAGG - Intergenic
939894656 2:147776844-147776866 CTTTCCCTGAAGGAGGAGGTGGG - Intergenic
941083730 2:161092207-161092229 CCTCACATGGAGGAAGAGCAAGG + Intergenic
941966930 2:171310077-171310099 TCTCCCAGGAAGGAGGAGGGTGG - Intergenic
945703617 2:213201648-213201670 CCTATAAAGAAGGAGGAGGAGGG - Intergenic
945754512 2:213829909-213829931 CCTCTCATGAAGTGGAAGGAAGG + Intronic
946431551 2:219629296-219629318 CCTCCCATCCAGGAGGAGGGGGG + Exonic
948227023 2:236319115-236319137 GCTGCGATGAAGAAGGAGGAGGG - Intergenic
948561582 2:238857174-238857196 CCTCCCATGAGAGAGGAAGAGGG + Intronic
948947208 2:241226875-241226897 CCTCGGCTGGAGGAGGAGGAGGG - Intergenic
1169046537 20:2538033-2538055 CCTCCCAGAATGGGGGAGGAAGG - Intronic
1169576833 20:6972094-6972116 CCTCAAATGAATGAAGAGGATGG + Intergenic
1170940860 20:20846786-20846808 CCAGCCCTGAAGGAGGAGGAGGG - Intergenic
1172028833 20:31967914-31967936 CCTCCGAGGAAGGAGGGAGAGGG + Intergenic
1172109875 20:32538494-32538516 CCAGCCATGAAGGAGGAGGGAGG - Intronic
1173413422 20:42835986-42836008 CCTGGCATGAAGGAGGAGTTTGG + Intronic
1173653612 20:44683634-44683656 CCTCTCAAGAGGCAGGAGGAAGG - Intergenic
1174106161 20:48163885-48163907 CCTCCCGTGAAGGAGGCAGCTGG + Intergenic
1174422871 20:50411708-50411730 CATCCCCTGCTGGAGGAGGAGGG - Intergenic
1175278407 20:57787418-57787440 TCTCCCCTGGGGGAGGAGGAAGG - Intergenic
1175320941 20:58087912-58087934 CCTCCCATCAGAGAGGAGAATGG - Intergenic
1175390000 20:58621002-58621024 CCTCCAATGAGGGGGGAGGTTGG - Intergenic
1175954103 20:62599514-62599536 CCTCCCATGACAGAGGAGCCTGG - Intergenic
1176406573 21:6371902-6371924 TCTCCCAGGAAGCAGAAGGAGGG - Intergenic
1176448592 21:6842458-6842480 CCTCCCACAAATGAGCAGGAGGG + Intergenic
1176826762 21:13707481-13707503 CCTCCCACAAATGAGCAGGAGGG + Intergenic
1178160778 21:29911722-29911744 CTTCCTATGATGGAGGAGGGAGG - Intronic
1179249114 21:39658058-39658080 CTTCCACTGAAGGAGGAGGTAGG - Intronic
1181610261 22:24007216-24007238 CCTCCCCTGAAGGTGAAGGTGGG - Intergenic
1181994311 22:26863055-26863077 CCTCCAAAGAGAGAGGAGGAGGG + Intergenic
1182868830 22:33628092-33628114 GCTCCCAAGAAGAAAGAGGAGGG + Intronic
1183516543 22:38270182-38270204 CCACCTATGAAGGAGAAGGAGGG - Intronic
1184968356 22:47997493-47997515 CTTCTCATCAAGGAGGAAGAAGG + Intergenic
1185004556 22:48268061-48268083 CCGGCCATGAGGAAGGAGGAGGG + Intergenic
949521002 3:4853918-4853940 CCTCCCATGAGTGAAAAGGAAGG - Intronic
949573155 3:5312598-5312620 CTTTCCATGCAGAAGGAGGAAGG - Intergenic
950111827 3:10423615-10423637 CCTCCCCAGAAGGAGGAATAAGG - Intronic
950392771 3:12709677-12709699 CATCACATGAAGGATGAAGAGGG + Intergenic
950659272 3:14456761-14456783 ACTCCCATGCAGGAGGGGCAGGG - Intronic
950680801 3:14583852-14583874 CCTCCCAAGATGGAGGAGGAGGG - Intergenic
950764557 3:15263750-15263772 CCTGCCTTGAAGAAAGAGGAGGG + Intronic
951052975 3:18115149-18115171 CGTCACAGGAAAGAGGAGGAGGG + Intronic
951172195 3:19555142-19555164 CCTCCCCTCAAGCAGAAGGAAGG + Intergenic
952099351 3:29993615-29993637 CCTCTCATGAATGAAGAAGAAGG + Intronic
952707459 3:36393715-36393737 CCATCCATGAACCAGGAGGAAGG + Intronic
954369071 3:50160817-50160839 CCTCCCATCAAGGGGCAGGGTGG - Intronic
954646222 3:52133203-52133225 CCTCACATGCAGAAGGTGGAAGG - Intronic
955148329 3:56342079-56342101 CCTCACATGAAGGGAGAGGCAGG - Intronic
955409636 3:58647326-58647348 CCTGCCCAGAAGGAGGAGAAGGG - Intronic
961748659 3:129082303-129082325 CCGCCCAGGAAGGAGGAAGGTGG + Intergenic
962261861 3:133915462-133915484 CCTCCCAAGAGGGAAGTGGAGGG - Intergenic
962891077 3:139673596-139673618 ACTCTCCTGAAGGAGGAGGCTGG - Intronic
965415239 3:168384738-168384760 CCTCTCATTAAGCAGAAGGAAGG + Intergenic
965626536 3:170688149-170688171 CCCCCCAGAAAGGAGGAGAAGGG + Intronic
966935717 3:184707448-184707470 ACTCACATGAGGGAGAAGGATGG - Intergenic
968732063 4:2273870-2273892 CCACACAGGCAGGAGGAGGAGGG - Intronic
968829593 4:2926091-2926113 ACTCCCATCAAGCTGGAGGAAGG + Exonic
969467436 4:7366140-7366162 CCTGCCAAGGAGGAGGAGGGTGG - Intronic
969521083 4:7678098-7678120 CCCCTCATGAAGCAGGAAGACGG + Intronic
969568816 4:7996026-7996048 CTGGGCATGAAGGAGGAGGAAGG - Intronic
969657894 4:8508587-8508609 CCGGCCATGAAGGCTGAGGATGG - Intergenic
970652673 4:18195829-18195851 ACTCCTATGGAGGAGGAGCAGGG - Intergenic
971317383 4:25578911-25578933 CATCTCAGGAAGCAGGAGGATGG - Intergenic
975814777 4:78206279-78206301 TGTGCCATGAAGGTGGAGGAAGG + Intronic
977937879 4:102827256-102827278 CCTCTCCTGCTGGAGGAGGAGGG - Intronic
979444197 4:120791876-120791898 CCTCACATGAGGGAGAAAGAGGG - Intronic
980001315 4:127492129-127492151 CCTACATTGAAAGAGGAGGAAGG + Intergenic
981007251 4:139888632-139888654 CCTCCCATGAAGGAGGACAGTGG + Intronic
981008619 4:139901622-139901644 CTCCCCATAAGGGAGGAGGATGG + Intronic
981935944 4:150240055-150240077 CCTCCTGTGAAGGTGGAGAATGG + Intronic
982233852 4:153233733-153233755 CTTCCTATGAAGTAGAAGGAAGG + Intronic
982345176 4:154349553-154349575 CCTCCCATGAAGTAAGGAGAAGG - Intronic
982595832 4:157381895-157381917 CCTCCCATAGAGGAGGAAGGAGG - Intergenic
985145252 4:186889436-186889458 CCGCCCATGAATGAGAACGAGGG - Intergenic
985339556 4:188934715-188934737 CCTGCCCTGAAGGAGAAAGAAGG + Intergenic
985763707 5:1765374-1765396 GATCCCATGGTGGAGGAGGAGGG + Intergenic
988350266 5:30095687-30095709 CCTGTCAGGGAGGAGGAGGAGGG - Intergenic
988589774 5:32538649-32538671 GCTCTCAAGAAAGAGGAGGATGG + Intronic
990739734 5:58900188-58900210 TCTCCCATGCAGCTGGAGGATGG - Intergenic
991094282 5:62722819-62722841 CAACTCATGAAGGAAGAGGAAGG + Intergenic
992572479 5:78073835-78073857 CTTACCACAAAGGAGGAGGAAGG + Intronic
993267489 5:85744625-85744647 CCTTCCTTGAAGCAGAAGGAAGG + Intergenic
994255377 5:97587249-97587271 CCTGCTAAGAAGGAGGCGGAAGG + Intergenic
994343821 5:98662521-98662543 CCTCTCCTCAAGCAGGAGGAAGG - Intergenic
994375968 5:99015920-99015942 CCTCCCAGGAAAGGGGAGAAGGG + Intergenic
995213979 5:109573611-109573633 CCTACAATGAAAGAGGAGGCAGG + Intergenic
997357482 5:133272986-133273008 CATCCCCTGCAGGAGCAGGACGG + Intronic
997981830 5:138472444-138472466 CCTTTCAGGTAGGAGGAGGAAGG - Intergenic
998471389 5:142386557-142386579 CCTCCCAGGAAGCAGGGGCAAGG + Intergenic
998618813 5:143771846-143771868 CCACTCAGGGAGGAGGAGGAAGG + Intergenic
999424783 5:151477762-151477784 CCTTCCAAGAAGGAAGAGGCAGG + Intronic
999735333 5:154508860-154508882 CATCCCATGATGGAAGGGGAAGG - Intergenic
999854530 5:155579822-155579844 CCTACCCTCAAGGAGGAGGATGG + Intergenic
1001020021 5:168174857-168174879 ACACTCTTGAAGGAGGAGGATGG - Intronic
1001420896 5:171586518-171586540 CCTCAAATGACAGAGGAGGAGGG - Intergenic
1001596553 5:172902398-172902420 CATCCCATTAAGGAGCATGAAGG + Intronic
1002097680 5:176840998-176841020 TCTCCGGTGAAGGAGGTGGATGG - Intronic
1002710398 5:181191609-181191631 CCTCCCAGGAAGGCGGAAGTAGG + Intergenic
1003026252 6:2558257-2558279 CCTCCCAGGAGGGAGGAAGCAGG - Intergenic
1003308802 6:4950990-4951012 CCTCCCATGCAGGCAGAGGCTGG - Intronic
1003521677 6:6863440-6863462 CCTGACTGGAAGGAGGAGGAAGG - Intergenic
1003527793 6:6912418-6912440 CATACCTGGAAGGAGGAGGAGGG + Intergenic
1004073265 6:12321565-12321587 CCTCGAATGAAGGTGGAGAAAGG - Intergenic
1005901092 6:30216794-30216816 CCTCAGATGAAGGAGGGAGAAGG - Intergenic
1006137782 6:31906419-31906441 CCTCCGAGGTAGGAGGGGGAGGG - Intronic
1006401950 6:33822832-33822854 CCTGGCCTGAGGGAGGAGGAGGG - Intergenic
1006402230 6:33824635-33824657 CCTCCTATGAAACAGGAAGAGGG + Intergenic
1006514142 6:34536700-34536722 ACTCCCTTGTAGGAGGAGGGTGG - Intergenic
1006576898 6:35053224-35053246 CAACCCAAAAAGGAGGAGGAGGG + Intronic
1007514457 6:42400339-42400361 CATGCCAAGAAGGAGGAGTAAGG + Intronic
1007664960 6:43508620-43508642 CCTCTCAGGAAGGGGCAGGACGG - Intronic
1008164628 6:48120978-48121000 CCTTCCATGAAGGAGAAGGAAGG + Intergenic
1012988883 6:105904524-105904546 CCATCCCTGATGGAGGAGGATGG + Intergenic
1013639141 6:112056428-112056450 CATCAAAAGAAGGAGGAGGAGGG - Intronic
1013872465 6:114782283-114782305 CCACTCAGGAAGGAGAAGGATGG - Intergenic
1014028867 6:116679070-116679092 TCTCCCAGGACGGAGGAGTAGGG + Intergenic
1014205446 6:118651317-118651339 CCGCCGAAGAAGCAGGAGGACGG - Intronic
1017179153 6:151533710-151533732 CTTCAGATGAAGGAGGTGGAAGG - Intronic
1017595645 6:156025901-156025923 CCTCACATGGTGGAGGGGGAGGG - Intergenic
1017779544 6:157705428-157705450 CCTCCCAGAAAGGCGGAGAAGGG + Intronic
1018850822 6:167589084-167589106 GCTCCTCTGAAGGAGGAGGATGG - Intergenic
1019527120 7:1485393-1485415 CCCCCCATGGAGGAGGATGTGGG - Exonic
1021949198 7:25757919-25757941 TTTCCCAGGAAAGAGGAGGAGGG - Intergenic
1023167707 7:37359184-37359206 CCTGCAAGGAAGGAGTAGGAAGG - Intronic
1024528537 7:50371272-50371294 CCACTAATGAAGGAGGAGGTTGG - Intronic
1024963369 7:55001750-55001772 AGTGCCAGGAAGGAGGAGGAAGG - Intergenic
1025620520 7:63166091-63166113 CCTTCCTTGAAAGATGAGGAAGG + Intergenic
1026277719 7:68894768-68894790 CCTCACATGGAGGAAGAGGGAGG - Intergenic
1026380611 7:69795758-69795780 CCTCTCATCAAGGATGAAGATGG - Intronic
1026869577 7:73842210-73842232 CCTCCTCTGAAGGGGGAGGAGGG - Intronic
1027157697 7:75780210-75780232 CCTCCCAGGAAAGTGGAGAAGGG - Intronic
1030130219 7:106193599-106193621 GGTCCCAGGAAGCAGGAGGATGG + Intergenic
1030660697 7:112216051-112216073 TCTCAAATGAAGGAGGAGAAGGG + Intronic
1030681240 7:112436639-112436661 AATAGCATGAAGGAGGAGGAGGG + Intronic
1031231674 7:119114888-119114910 CCTCTCCTGAAGCAGAAGGAAGG + Intergenic
1031545341 7:123045373-123045395 CATCCCATGAAGGAAGAAGGAGG - Intergenic
1031788449 7:126065974-126065996 CCTCCCATGACAGATGGGGATGG + Intergenic
1033504885 7:141989965-141989987 TGTTCCATGTAGGAGGAGGAAGG + Intronic
1034237413 7:149583145-149583167 CCTCCCAGGCAGCAGGAAGATGG - Intergenic
1034963379 7:155375797-155375819 CCCCACAGGAGGGAGGAGGAAGG + Intergenic
1034975836 7:155448920-155448942 CGTCCCATGAAGCACGGGGAAGG - Intergenic
1035160341 7:156945194-156945216 CCTGTCTTGGAGGAGGAGGAGGG - Intergenic
1035341492 7:158165421-158165443 CCTCTCTTGGAGGAGAAGGACGG - Intronic
1035346875 7:158206169-158206191 CCTCTCCTCAAGGAGAAGGAAGG - Intronic
1036223355 8:6939248-6939270 CCTCACTACAAGGAGGAGGATGG - Intergenic
1037893512 8:22636663-22636685 CCTGCCAAGGAGGAGGAGAAAGG + Intronic
1039473534 8:37827694-37827716 CCTCATCTGAAGGAGGAGGCTGG + Intronic
1041669245 8:60476423-60476445 CCTCTCCTGAAATAGGAGGACGG - Intergenic
1041715366 8:60927248-60927270 CCTTCCAGGAATGGGGAGGAGGG - Intergenic
1043934750 8:86130628-86130650 AGTTCCAGGAAGGAGGAGGAAGG + Intronic
1044792564 8:95863151-95863173 ACTCCCATAAAGGAGGTGGTTGG - Intergenic
1045115936 8:98979763-98979785 CATCCCATGATGGAAGTGGAAGG + Intergenic
1045187252 8:99851665-99851687 CCTGGCATCAAGGAGGAGCAGGG + Intronic
1046720550 8:117613966-117613988 TCACCCATGAAGGAAGAGGTCGG + Intergenic
1047327967 8:123858058-123858080 TTTCCCATGAAGGAGGGGAAGGG - Intronic
1047598391 8:126401904-126401926 CCTCCCAGGACAGAGCAGGATGG - Intergenic
1048794600 8:138138189-138138211 TCTCCTGTGGAGGAGGAGGAGGG - Intronic
1048846338 8:138606571-138606593 CCTCCCATGATGGAGGGGCATGG + Intronic
1048874952 8:138829277-138829299 CTGCCCATGCAGGAGGAAGATGG + Intronic
1049306502 8:141906956-141906978 CCCCACATGCAGCAGGAGGAAGG - Intergenic
1050027159 9:1347367-1347389 CCTCCCAGTAAAGTGGAGGAAGG - Intergenic
1052938652 9:34114493-34114515 CTTCCCATGAAGAAGCAGGGTGG - Intronic
1052995982 9:34551861-34551883 CCTCCCCTGAGGGAGGAAGGAGG + Exonic
1053107789 9:35427144-35427166 CCTGCCATGAAGAAAGAAGAAGG - Intergenic
1055398018 9:75893378-75893400 CATGCCATGATGAAGGAGGAAGG + Intronic
1056461169 9:86810933-86810955 CCTCACATGGAAAAGGAGGAAGG - Intergenic
1057558464 9:96108286-96108308 CCTTCCAGGGAGGAGTAGGATGG - Exonic
1057717141 9:97503669-97503691 CCTACCCTGAAGGAGGGAGAAGG - Intronic
1057912929 9:99034194-99034216 CTTCCCATGACGGAGGTAGAGGG - Intronic
1058393426 9:104522805-104522827 CCCCCCATGTAGGAGGACGGGGG + Intergenic
1058930388 9:109713200-109713222 GCTCCCAAGAAGAAGGAAGAAGG - Intronic
1059521483 9:114946803-114946825 GCTCCCAGGAAGGGCGAGGAAGG - Intergenic
1060046031 9:120341819-120341841 GCTCAGAAGAAGGAGGAGGAGGG + Intergenic
1060494916 9:124111538-124111560 GCTCCCCTGGAGGAGGGGGATGG - Intergenic
1060788676 9:126470510-126470532 ACTGCCCTGAAGGAGGAGGTGGG + Intronic
1061083863 9:128387914-128387936 CCTTCCCTGAAGCAGGTGGAGGG + Intronic
1061421124 9:130473345-130473367 CCTCCCATGAAGAGGTAGCATGG - Intronic
1062066326 9:134528495-134528517 TCTCCGATGAAAGAGGAGGTTGG + Intergenic
1062222229 9:135422874-135422896 CCTCCTATGAAGGAGCAGAAAGG + Intergenic
1062581867 9:137232367-137232389 CCTCCCTCGCAGGAGCAGGAGGG - Intronic
1062685973 9:137813677-137813699 CCTCCCGTGAAAGAGCTGGAAGG + Intronic
1203772083 EBV:54557-54579 CCGCCAAAGAAGGAGGAGGAGGG - Intergenic
1203520599 Un_GL000213v1:42059-42081 CCTCCCACAAATGAGCAGGAGGG - Intergenic
1185550610 X:980616-980638 GCTGCCATGGAGGAGGAGGAGGG + Intergenic
1185550642 X:980720-980742 GCTGCCATGGAGGAGGAGGAGGG + Intergenic
1187591442 X:20721561-20721583 TCTCTCAGGTAGGAGGAGGAGGG - Intergenic
1189454803 X:41176260-41176282 CAGACCATGAAGGAGGAGGAGGG - Intronic
1192839237 X:74836693-74836715 CCTCCCCTTAAGCAGAAGGAAGG + Intronic
1193297181 X:79846924-79846946 CCTCTCCTGAAGCAGAAGGAAGG + Intergenic
1194340706 X:92701349-92701371 CCTCTCCTCAAGGAGAAGGAAGG + Intergenic
1195287358 X:103398035-103398057 CTTCACATCAAGGAAGAGGACGG - Intergenic
1195621143 X:106956095-106956117 CTTCCCAAGAGGAAGGAGGAAGG + Intronic
1197581320 X:128287989-128288011 CCTCTCCTGAAGCAGAAGGAAGG - Intergenic
1198674267 X:139115456-139115478 CCAGTCAGGAAGGAGGAGGATGG - Intronic
1199277578 X:145964332-145964354 CCTCCCATTAAGCAGAAAGAAGG - Intergenic
1200137783 X:153883360-153883382 TCTGCCTAGAAGGAGGAGGAAGG + Intronic
1200624069 Y:5490682-5490704 CCTCCAATTCAGAAGGAGGAGGG - Intronic
1200649061 Y:5818087-5818109 CCTCTCCTCAAGGAGAAGGAAGG + Intergenic
1200887219 Y:8281671-8281693 CTGGCCAAGAAGGAGGAGGATGG - Intergenic