ID: 1151541620

View in Genome Browser
Species Human (GRCh38)
Location 17:74767652-74767674
Sequence CCTTGAAAGAAGAAGGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 514
Summary {0: 1, 1: 0, 2: 2, 3: 39, 4: 472}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151541620_1151541631 11 Left 1151541620 17:74767652-74767674 CCATCCACCTTCTTCTTTCAAGG 0: 1
1: 0
2: 2
3: 39
4: 472
Right 1151541631 17:74767686-74767708 TGCTTCAGGGTTAGGGTTTCAGG 0: 1
1: 0
2: 1
3: 18
4: 177
1151541620_1151541633 20 Left 1151541620 17:74767652-74767674 CCATCCACCTTCTTCTTTCAAGG 0: 1
1: 0
2: 2
3: 39
4: 472
Right 1151541633 17:74767695-74767717 GTTAGGGTTTCAGGATTCCTGGG 0: 1
1: 0
2: 0
3: 18
4: 164
1151541620_1151541628 3 Left 1151541620 17:74767652-74767674 CCATCCACCTTCTTCTTTCAAGG 0: 1
1: 0
2: 2
3: 39
4: 472
Right 1151541628 17:74767678-74767700 TCCTTTGCTGCTTCAGGGTTAGG 0: 1
1: 0
2: 4
3: 28
4: 294
1151541620_1151541624 -3 Left 1151541620 17:74767652-74767674 CCATCCACCTTCTTCTTTCAAGG 0: 1
1: 0
2: 2
3: 39
4: 472
Right 1151541624 17:74767672-74767694 AGGCCCTCCTTTGCTGCTTCAGG 0: 1
1: 0
2: 3
3: 18
4: 183
1151541620_1151541625 -2 Left 1151541620 17:74767652-74767674 CCATCCACCTTCTTCTTTCAAGG 0: 1
1: 0
2: 2
3: 39
4: 472
Right 1151541625 17:74767673-74767695 GGCCCTCCTTTGCTGCTTCAGGG 0: 1
1: 0
2: 1
3: 17
4: 172
1151541620_1151541634 21 Left 1151541620 17:74767652-74767674 CCATCCACCTTCTTCTTTCAAGG 0: 1
1: 0
2: 2
3: 39
4: 472
Right 1151541634 17:74767696-74767718 TTAGGGTTTCAGGATTCCTGGGG 0: 1
1: 0
2: 3
3: 13
4: 198
1151541620_1151541632 19 Left 1151541620 17:74767652-74767674 CCATCCACCTTCTTCTTTCAAGG 0: 1
1: 0
2: 2
3: 39
4: 472
Right 1151541632 17:74767694-74767716 GGTTAGGGTTTCAGGATTCCTGG 0: 1
1: 0
2: 0
3: 9
4: 121
1151541620_1151541630 4 Left 1151541620 17:74767652-74767674 CCATCCACCTTCTTCTTTCAAGG 0: 1
1: 0
2: 2
3: 39
4: 472
Right 1151541630 17:74767679-74767701 CCTTTGCTGCTTCAGGGTTAGGG 0: 1
1: 0
2: 1
3: 23
4: 194

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151541620 Original CRISPR CCTTGAAAGAAGAAGGTGGA TGG (reversed) Intronic
900508059 1:3039442-3039464 CCAGGAAATAAGAAGGGGGAGGG - Intergenic
900708200 1:4093921-4093943 GCTGGAAAGAAGAAGGAGGAGGG - Intergenic
900877105 1:5350629-5350651 CATTTGAAGGAGAAGGTGGAGGG + Intergenic
901473452 1:9473348-9473370 CCTTGAAGGACGGAGGCGGAGGG - Intergenic
902711236 1:18241393-18241415 CCTTGAGAGAAGGAGGTAGAAGG + Intronic
903904312 1:26672985-26673007 CTTTGAAGGGAGAAGGTGGGAGG - Intergenic
904252236 1:29233339-29233361 CCTTGAGAGAAGAAGGAAGAAGG - Intergenic
904283187 1:29435722-29435744 CTTTGAGAGACCAAGGTGGATGG - Intergenic
904833967 1:33323145-33323167 CCTTGAATAAAGAAGGAGAAAGG - Intergenic
905123237 1:35698747-35698769 CCTGGAAAGATGTAGGTGGATGG - Intergenic
905942627 1:41875792-41875814 CGTGGAGAGAAGAAGGTGCAGGG - Intronic
908415789 1:63912041-63912063 CTTTGGAAGACCAAGGTGGAAGG + Intronic
908896253 1:68903644-68903666 CACAGAAAGAAGCAGGTGGAAGG - Intergenic
909492321 1:76239142-76239164 CCTTGAAGGAAGAATCTGAAGGG + Intronic
909546848 1:76857713-76857735 GCTTTCGAGAAGAAGGTGGAAGG + Intergenic
910457695 1:87414940-87414962 CTTTGAGAGGCGAAGGTGGATGG + Intergenic
910499615 1:87875025-87875047 ACTTGAAAAAAAAAGGAGGAAGG - Intergenic
912214712 1:107595339-107595361 CCTTGAAAGCAGAAACTGAAAGG - Intronic
912355332 1:109050120-109050142 TCTGGAAAAAAGAAGGTGGAAGG + Intergenic
912474210 1:109925353-109925375 CCTGGAAAGGAGAGGGTGGCTGG - Intronic
912780140 1:112538740-112538762 CCTTTAAACAAGAAGGGGGTAGG + Intronic
913582271 1:120238119-120238141 TCTTTAAAGCAGAAGGTGTAGGG - Intergenic
913625904 1:120660265-120660287 TCTTTAAAGCAGAAGGTGTAGGG + Intergenic
914564205 1:148849597-148849619 TCTTTAAAGCAGAAGGTGTAGGG - Intronic
914608621 1:149280642-149280664 TCTTTAAAGCAGAAGGTGTAGGG + Intergenic
915552180 1:156641758-156641780 TGTTCAAAGAAGAAGGAGGAGGG - Intronic
915584434 1:156836611-156836633 CCATGAAAGAGGAGGGAGGAGGG - Intronic
916292760 1:163184649-163184671 CCTTGTAAGAAGAAGGCAGGAGG + Intronic
916421652 1:164643148-164643170 CCTTGATGGATGAAGATGGATGG - Intronic
916593713 1:166221013-166221035 ACTTGAAGGCAGAAGGTGGGAGG - Intergenic
917106489 1:171497710-171497732 CTTTGAAAGGCGAAGGTGGGAGG - Intronic
917484939 1:175447303-175447325 CCTTCAGAGAAGCAGGAGGAAGG - Intronic
918037839 1:180893095-180893117 CCTTGAAAAAAGAAGGAAGGGGG + Intergenic
918279014 1:182984546-182984568 CTTTGAACCCAGAAGGTGGATGG + Intergenic
918674208 1:187261552-187261574 CCTTGAATGAGGAAGGAGGATGG + Intergenic
919540486 1:198839328-198839350 CCATAGAAGATGAAGGTGGAGGG + Intergenic
919775943 1:201194101-201194123 CCCAGGAGGAAGAAGGTGGAAGG + Intronic
920339782 1:205268529-205268551 CCTTGAACCAGGGAGGTGGAAGG + Intronic
920913318 1:210237344-210237366 CTTTGGGAGAAGAAAGTGGAGGG + Intronic
922374740 1:224951267-224951289 CTTTGGAAGACCAAGGTGGATGG - Intronic
923226019 1:231939660-231939682 GCTTGGAAGAAGAGGGAGGATGG - Intronic
923383537 1:233444868-233444890 GCTTGAGAGAAGAGGGTGGGAGG + Intergenic
923837487 1:237628880-237628902 CCTTGGAAAAAGAAGGGGTAGGG + Intronic
924379118 1:243445513-243445535 CCTTGAGACCAGAAGTTGGATGG + Intronic
924574791 1:245269769-245269791 CCTTTAAAAAAAAAGGTGGCAGG - Intronic
924754948 1:246932094-246932116 CGGTGAAAGAAGGAGGTGGGAGG + Intergenic
1062789662 10:294201-294223 CCTTGGAAGAAGATGGAAGAGGG - Intronic
1063634921 10:7772995-7773017 TCTTGTAAGAGCAAGGTGGAGGG + Intronic
1063922654 10:10947705-10947727 CCTTGAAAGCAGAAAGTTGAAGG - Intergenic
1063923447 10:10954326-10954348 CCTTGAACCTGGAAGGTGGAGGG - Intergenic
1064043562 10:11990193-11990215 CATTGAAAGAAGCATGTTGATGG - Intronic
1064313227 10:14230778-14230800 GCTTGAAGGTGGAAGGTGGAAGG - Intronic
1064668280 10:17680648-17680670 CTTTGGGAGATGAAGGTGGAAGG - Intronic
1065342300 10:24718968-24718990 CCTTGAAAGATGAAGCTATATGG + Intronic
1065525324 10:26614141-26614163 GCTTGAACCCAGAAGGTGGATGG + Intergenic
1065875686 10:29995516-29995538 GCTTGAAAGCAGATGGGGGATGG + Intergenic
1066009108 10:31177290-31177312 CAGTGAAGGGAGAAGGTGGAGGG - Intergenic
1066020078 10:31289689-31289711 CCCTGATAGAAGAAGTTGAAGGG + Intergenic
1066366300 10:34780036-34780058 CGGGGAAAGAAGAAGATGGAGGG - Intronic
1066659447 10:37726328-37726350 CGTTGCAAGAAGAGGGTGGGGGG - Intergenic
1067995539 10:51268927-51268949 CCATGGCAGAAGAACGTGGATGG - Intronic
1068614359 10:59096353-59096375 CCTTGGAAGAAGGAGGTCAATGG + Intergenic
1069470864 10:68688178-68688200 GCTTGAATCAAGGAGGTGGAGGG - Intronic
1070167185 10:73907611-73907633 GCTTGAACCCAGAAGGTGGAGGG + Intergenic
1070566539 10:77607542-77607564 CCTTCAAAGAGGGAGGTAGAGGG + Intronic
1070674150 10:78400448-78400470 CCTTCAAAGAAATAGGTGAATGG + Intergenic
1070713378 10:78699868-78699890 CCTTAAAAGGAGAAGGTCCAAGG - Intergenic
1072346775 10:94515428-94515450 GCTTGAACCCAGAAGGTGGAGGG - Intronic
1072674418 10:97454732-97454754 TCTCGAAAGGAGAAGGTGGGTGG - Exonic
1072777877 10:98218992-98219014 GCTTGAACCCAGAAGGTGGAGGG - Intronic
1072878517 10:99201553-99201575 CCTTGAAAAATGAAGTTGTAGGG - Intronic
1073305250 10:102498161-102498183 CCTTAAAACATGAAGGTGGATGG + Intronic
1073482734 10:103797276-103797298 CTGTGAGAGAAGAAGGTGGGTGG + Intronic
1073556073 10:104452993-104453015 ACTGGAAAGAAGAAGGCTGAGGG + Intronic
1074354354 10:112769072-112769094 TCTTGAAAGAAAAACTTGGAAGG + Intronic
1074540162 10:114358542-114358564 CATTGAAAGAAGAAAATGTAAGG - Intronic
1074904260 10:117847186-117847208 CTTGGGAAGAAGAATGTGGATGG + Intergenic
1075854957 10:125621896-125621918 GCTAGAACGAAGCAGGTGGAGGG - Intronic
1076091087 10:127686281-127686303 CTTGGAAAGCAGAAGGTGGGTGG + Intergenic
1076400201 10:130178335-130178357 GCTTGAACCCAGAAGGTGGAGGG - Intronic
1076506920 10:130984445-130984467 CCTTTAAGGAGGAAGGTGGAGGG + Intergenic
1076515790 10:131043807-131043829 CCCTGAAAGCAGAAGTTGTAAGG + Intergenic
1077363228 11:2150308-2150330 GCTTGAAAGAAAAAGGGAGAGGG - Intronic
1077786021 11:5384278-5384300 ACTTGGAAGAATAAGGTGGGAGG - Intronic
1077942821 11:6861748-6861770 ACTTGAGAGTGGAAGGTGGAAGG + Intergenic
1078422313 11:11222794-11222816 ACTTGAAACCAGAAGGTGGAGGG - Intergenic
1079447017 11:20566787-20566809 ACTTGAGAGACTAAGGTGGAAGG + Intergenic
1079649176 11:22905412-22905434 CTTTAAAACAAGAAGATGGAAGG - Intergenic
1080526663 11:33129068-33129090 CCCTGAAAAAATAACGTGGATGG + Intronic
1081484196 11:43515432-43515454 CCTGGATAGAAGCAGGTGGCTGG - Intergenic
1081613498 11:44577373-44577395 CCCTGAGGGAAGAAGGTGGCTGG - Intronic
1082012744 11:47461389-47461411 CCTTGAAAGACCAAGGTCGGTGG - Intergenic
1082599850 11:55135681-55135703 CATTCAAAGAAGAATATGGAGGG + Intergenic
1083708123 11:64530557-64530579 CCTTCTAAGAGGGAGGTGGAGGG + Intergenic
1083792881 11:64997141-64997163 TCTGGAAAGAGGATGGTGGAGGG + Intergenic
1084511812 11:69610500-69610522 CCTTGAAAAAAGAAAGTGATAGG - Intergenic
1084854163 11:71970415-71970437 CTTTGGAAGACTAAGGTGGAAGG + Intronic
1084984173 11:72852985-72853007 ACTTGAAGGCAGAAGGTGGGAGG + Intronic
1086460781 11:87003556-87003578 CTTTGAAAGGCCAAGGTGGAAGG - Intergenic
1087380630 11:97400385-97400407 CCTTTGAAGCAGATGGTGGAAGG - Intergenic
1087685489 11:101258299-101258321 GCTGGAAAGAAGAAGATGGGGGG - Intergenic
1088640703 11:111870678-111870700 CCTTAAAAGCAGGAAGTGGAAGG - Intronic
1089288397 11:117422281-117422303 CCTTGTGAGTAGAAGTTGGAGGG + Intergenic
1089739273 11:120571204-120571226 CCAAGAAAGAAGAAGATGCAAGG - Intronic
1090405955 11:126475880-126475902 CCTTGAAGAAAGAAGGGTGAAGG - Intronic
1090433017 11:126662526-126662548 CCTTATATGCAGAAGGTGGAAGG + Intronic
1090445514 11:126761473-126761495 CCTTGAAAGAGAAAGGAGCAGGG - Intronic
1091086929 11:132730094-132730116 CCTTGAACCCAGGAGGTGGAGGG - Intronic
1091137040 11:133201125-133201147 ACTTGAGAGTGGAAGGTGGAAGG + Intronic
1091172116 11:133528607-133528629 CCCTGAAGGAAGAAGCAGGAAGG + Intronic
1092380621 12:7993764-7993786 CCTTGAACCCAGAAGGCGGAAGG + Intergenic
1092534079 12:9371096-9371118 ACTTGAGAGTAGAAGGTCGAAGG - Intergenic
1093043800 12:14418020-14418042 GCTAGAAAGAAGTGGGTGGAGGG + Intronic
1093091229 12:14922984-14923006 ACTTGAACCCAGAAGGTGGAGGG + Intronic
1093407170 12:18818678-18818700 CCTTGGATGAATAAGATGGAAGG - Intergenic
1093462745 12:19421099-19421121 CTTTGGAAGACCAAGGTGGAAGG + Intronic
1093491412 12:19709313-19709335 CTTTGAAAGACCAAGGTGGGAGG - Intronic
1093983391 12:25500045-25500067 CTTTGAAAGAAGGAGGTTGTGGG + Intronic
1095218147 12:39574582-39574604 ACTTGAAAGAAGAAAGGGAAAGG - Intronic
1095298685 12:40557056-40557078 CTTTGAAAGTAGAAAGTAGAAGG + Intronic
1095932885 12:47646831-47646853 TTTAGAAAGATGAAGGTGGAGGG - Intergenic
1096367079 12:51037161-51037183 CCTTTAAAGAAGCAAGTGGGGGG - Intergenic
1097144636 12:56931741-56931763 CCTTGCATGAAGGAGCTGGAAGG - Intronic
1097287763 12:57890670-57890692 CCTGGAAATAAGGAGGTAGACGG - Intergenic
1097350052 12:58538754-58538776 CCTTCTAAGAAGAAGGTAGTGGG + Intergenic
1097666455 12:62482923-62482945 CCTTGGAAGACGGTGGTGGAAGG + Intronic
1097725184 12:63067070-63067092 GCTTGAAAGCAGAAGGGAGAAGG - Intergenic
1098362718 12:69670577-69670599 TCCTGAAAGTAGAAGGAGGAGGG + Intronic
1098591450 12:72218765-72218787 CCTTATAAGAAGAAGGGAGAGGG - Intronic
1099454895 12:82851345-82851367 GCTTGAACCCAGAAGGTGGAGGG + Intronic
1100261035 12:92932206-92932228 ACTTGAAGGCAGGAGGTGGATGG + Intergenic
1101639661 12:106578971-106578993 GCATGAAAGAGGAAGGTGCAGGG - Intronic
1102167961 12:110821031-110821053 AGAAGAAAGAAGAAGGTGGAGGG - Intergenic
1102845041 12:116171567-116171589 CATTGCAAGAGGAAGGTGGTTGG - Intronic
1104508195 12:129352372-129352394 TCTTGAAAGTAAAAGGAGGAAGG - Intronic
1104787548 12:131459373-131459395 CCTGGATAGAAGCTGGTGGAGGG + Intergenic
1105392681 13:19995677-19995699 CCTTCAAAAAAAAAGGTGGGGGG - Intronic
1105916197 13:24919013-24919035 CCTGGAAAGAAGGAGGGTGAGGG + Intronic
1106169747 13:27278999-27279021 ACTTGAGAGAATAAGGTGGGAGG + Intergenic
1106785877 13:33107764-33107786 CCTTGAAAAAAGGTTGTGGATGG + Intronic
1107112663 13:36714787-36714809 CCTTGAGAGGAGGAGATGGAAGG + Intergenic
1107514765 13:41118473-41118495 GCTTGAACGCAGGAGGTGGAAGG - Intergenic
1107583838 13:41822272-41822294 ACTTGAAAGAATAATATGGAAGG + Intronic
1107642097 13:42454002-42454024 CCTTGAATCCAGGAGGTGGAGGG - Intergenic
1107974062 13:45672515-45672537 CCATGAAAAAAAAAAGTGGAAGG + Intergenic
1108344639 13:49533278-49533300 CATTTATAGAAGAAGGTGGTGGG + Exonic
1108475020 13:50807405-50807427 GCTTGAGAGAAGCAGGAGGAGGG - Intronic
1109019458 13:57068676-57068698 ACTGAAAAGAAGAAGGTGAATGG + Intergenic
1109714179 13:66199554-66199576 ACTTGAGAGTAGAAGGTGGGAGG + Intergenic
1110375013 13:74783512-74783534 CTTTGAAAGGCCAAGGTGGAAGG + Intergenic
1110700387 13:78540626-78540648 CTCTGCAAGAAGAAGGAGGATGG - Intergenic
1110903797 13:80860291-80860313 ACTTGAAAGAAGAAAGTTTAAGG - Intergenic
1110968852 13:81735603-81735625 CCTTGTAAGAGAAAGGTAGAGGG + Intergenic
1111004241 13:82228282-82228304 TCTTAAAAAAAGAGGGTGGATGG - Intergenic
1111350827 13:87028730-87028752 TCTTGATAGTAGAATGTGGATGG + Intergenic
1112641372 13:101279407-101279429 CATTGGAAGAAGAATGAGGAAGG + Intronic
1112926433 13:104680441-104680463 CCTTGGAAGAGGAAAGTGGAAGG - Intergenic
1113007814 13:105727209-105727231 CCTTGATGGAGGAGGGTGGAGGG - Intergenic
1113039860 13:106092741-106092763 CTGTGAAAGAATAAGGTAGAGGG - Intergenic
1113243577 13:108368169-108368191 GCTTGATAGGAGAAGGTGGGAGG + Intergenic
1114561002 14:23590407-23590429 CTTTGGGAGATGAAGGTGGAAGG + Intergenic
1114938596 14:27576530-27576552 TCTTGAAGGCAGAAGATGGATGG - Intergenic
1116271598 14:42776629-42776651 CCAGGAAGGAAGAAGGAGGATGG - Intergenic
1116647183 14:47543451-47543473 CCTTGAAATAAGGAGATGGCTGG + Intronic
1117043106 14:51785963-51785985 CCTTGAGGGTAGAAGGTGGGAGG - Intergenic
1117236417 14:53781984-53782006 GCTTGAAAGAAGAGGATGGCTGG - Intergenic
1117601530 14:57380906-57380928 ACTTGAAAGGCTAAGGTGGAAGG + Intergenic
1118243203 14:64081841-64081863 CCATGAAATAAGAATGTGGGCGG + Intronic
1118632416 14:67717818-67717840 CTTTGAGAGACCAAGGTGGAAGG + Intronic
1119904858 14:78292478-78292500 ACTAGAAAGAGGGAGGTGGAAGG + Intronic
1120247737 14:82026313-82026335 CCTTGAAGGAAGAAAGTGAGTGG + Intergenic
1120448547 14:84634990-84635012 ACTTGAGAGATGAAGGTGGGAGG - Intergenic
1120602086 14:86523468-86523490 CCTTGAAAAGGGAAGCTGGATGG - Intergenic
1120757914 14:88261454-88261476 CCATGAAAGAAGAAAAGGGATGG + Intronic
1121006072 14:90491475-90491497 CGTTAAAAGAAGAAGAAGGAGGG + Intergenic
1121794932 14:96726931-96726953 CCATGAGAGAAGTAGGTGGTGGG + Intergenic
1121894798 14:97636938-97636960 CCTTGAGAGATGGAGGTGGACGG - Intergenic
1123917385 15:25046411-25046433 ACTTGAAGGTAGAAGGTGGGAGG - Intergenic
1124412804 15:29450947-29450969 ACTTGAGAGAAGAGGGTGGGAGG + Intronic
1125047719 15:35261722-35261744 ACTTGAGAGGCGAAGGTGGAAGG + Intronic
1126088545 15:45031410-45031432 CCTTGAAACAACAAAGTGGGAGG + Intronic
1126366275 15:47898052-47898074 CCTGGAAAGAGCAAGGGGGACGG - Intergenic
1127245769 15:57172623-57172645 CCTTGAAGGTAGAGGGTGGGAGG + Intronic
1127267105 15:57371289-57371311 CCTTGAAAGAGCAAGACGGAAGG + Intergenic
1127296635 15:57614547-57614569 CCTTGAAACAAGAAGGAGGCTGG + Intronic
1127314636 15:57783192-57783214 CCTTGAAAGATAAAGGTTGAAGG + Intergenic
1127580190 15:60331354-60331376 CATTGAAAGACCAAGGTGGGAGG + Intergenic
1127963806 15:63909018-63909040 CCATCAAAGAAGAAGGGGCATGG - Intronic
1128201750 15:65814940-65814962 CCTTGAACCCAGGAGGTGGAGGG - Intronic
1128270212 15:66302718-66302740 GCTTGAAAGGAGAAGATGGGAGG - Intronic
1128602764 15:69011597-69011619 CCCTGAAGAAAGAAGGTGGGGGG - Intronic
1128794092 15:70452166-70452188 CCCTGAAAGAGCCAGGTGGAGGG + Intergenic
1129156140 15:73719394-73719416 CCGTGAAAGGAGAAGGGGGAGGG - Intergenic
1130833227 15:87624243-87624265 CTTTGAAAGAAGCAGGTTGCTGG - Intergenic
1133652883 16:7829601-7829623 CTTTAAAAGAGGAAGGTGGGTGG - Intergenic
1134287739 16:12877109-12877131 ACTTGAAAGACTAAGGTGGGAGG - Intergenic
1135883634 16:26283550-26283572 CCTTGAAATGAGATGGTTGAAGG + Intergenic
1136276285 16:29181070-29181092 CCTTGGAAGAGGAAGGCAGAAGG + Intergenic
1136382606 16:29902813-29902835 CTTTTAAAAAAGAAGGTGTAGGG - Intronic
1136571269 16:31098373-31098395 CCTTAAAAAATGAAGGAGGATGG + Intergenic
1137757437 16:50913864-50913886 CTTTAAAATGAGAAGGTGGAGGG + Intergenic
1137801422 16:51265652-51265674 CCTTATAAGAGAAAGGTGGAGGG - Intergenic
1138897801 16:61229795-61229817 CCTTGCAACAAGAAGCTAGAGGG - Intergenic
1139019275 16:62726909-62726931 CGTTGAAAAAAGAAGGAGCAAGG - Intergenic
1141115681 16:81307036-81307058 ACTTGAAAGCAGAAGCCGGAAGG - Intergenic
1141859860 16:86709134-86709156 CATTGAAAGAATTAGATGGAGGG - Intergenic
1142080666 16:88147129-88147151 CCTTGGAAGAGGAAGGCAGAAGG + Intergenic
1142387881 16:89778077-89778099 CCTTGAACCCAGGAGGTGGAGGG + Intronic
1142782688 17:2193447-2193469 ACAAGACAGAAGAAGGTGGAAGG + Intronic
1142964688 17:3573279-3573301 CCTGGAGGGAAGAAGGGGGAGGG - Intronic
1144393353 17:14817820-14817842 ACTTGAGAGTGGAAGGTGGAAGG - Intergenic
1144511822 17:15883539-15883561 TATTCAGAGAAGAAGGTGGATGG + Intergenic
1145923972 17:28632373-28632395 CCTTGAAAGAAGAGGGAGTTGGG - Intronic
1146954861 17:36931594-36931616 GCCTGAAAGAAGAGGGTGCAGGG + Intergenic
1148540314 17:48475079-48475101 TTTTTAAAGAAAAAGGTGGAGGG - Intergenic
1148867382 17:50635501-50635523 CCTAGAGAAAAGAAGGTGGCAGG - Intronic
1149060320 17:52413907-52413929 CCAGGAAAGAAGTAGATGGATGG + Intergenic
1149727240 17:58908681-58908703 CCTTGAAAGGCCAAGGTGGGCGG - Intronic
1149933939 17:60784678-60784700 ACTTGAAAGAATGAGGTGGGAGG - Intronic
1150417824 17:65001698-65001720 ACTTGGAAGCAGCAGGTGGAGGG - Intergenic
1150793826 17:68222097-68222119 ACTTGGAAGCAGCAGGTGGAGGG + Intergenic
1151541620 17:74767652-74767674 CCTTGAAAGAAGAAGGTGGATGG - Intronic
1151577861 17:74961989-74962011 CCTTGTAGGAGGAAGGGGGAGGG + Exonic
1151623872 17:75264300-75264322 GCTTGACAGAAGAAGGCGAAGGG - Intronic
1152350811 17:79783130-79783152 CCTTGAAAGCTGATGGTGGACGG + Intronic
1153842461 18:9019119-9019141 ACTTGAAGGCAGAGGGTGGAAGG - Intergenic
1155040918 18:22065093-22065115 CTTTGAGAGACCAAGGTGGAAGG + Intergenic
1155492332 18:26411540-26411562 CTTTGAAAGGCCAAGGTGGAAGG - Intergenic
1156479392 18:37426623-37426645 CCTGGAAGGAAGAAGGAGGCTGG - Intronic
1156889649 18:42175985-42176007 ACTTGAAAGCATGAGGTGGAAGG - Intergenic
1157195414 18:45616852-45616874 CTTTGAAAGACCAAGGTGGGCGG + Intronic
1157461936 18:47905510-47905532 CCTTGAAATAAGGTGGTGTAAGG - Intronic
1158275297 18:55760519-55760541 AATGGAAAGAAGAAGGAGGAGGG - Intergenic
1158905018 18:62003393-62003415 CCTTACAAAAAGGAGGTGGAGGG - Intergenic
1158922458 18:62208654-62208676 ACTTGAAGGTAGAGGGTGGAAGG - Intronic
1158994535 18:62904424-62904446 CATTTATAGAAGAAGGTTGAGGG + Intronic
1159302334 18:66590849-66590871 CCTTGTAAGATGAAGGAGCATGG + Intronic
1160561431 18:79759926-79759948 ACTTGAACCCAGAAGGTGGAGGG - Intergenic
1162748121 19:12810904-12810926 CTTTGAAAGACCAAGGTGGGAGG - Intronic
1162870005 19:13579170-13579192 ACTTGAAAGCAGAAGCTGCAAGG - Intronic
1164460343 19:28442212-28442234 CCTTGAAACTAGAGGCTGGAAGG + Intergenic
1164811386 19:31159299-31159321 CCTTAAAAGTAGAAGAGGGATGG - Intergenic
1165497822 19:36164171-36164193 TCTTGAACCCAGAAGGTGGAGGG - Intergenic
1165691219 19:37865171-37865193 CCTTGAAAGGAGAAGCTGATTGG + Intergenic
1165709043 19:37996776-37996798 GCTTGAACCCAGAAGGTGGAGGG - Intronic
1167196829 19:48034919-48034941 CTTTGGAAGGACAAGGTGGAAGG - Intronic
1167521385 19:49958212-49958234 CCTAGAAAGATGAAGGTTCAAGG - Intronic
1168564014 19:57407658-57407680 CTTTGAAAGGTGGAGGTGGAAGG - Intronic
1168596173 19:57679473-57679495 TCTTGAAAGAAGATGGAGGTGGG + Intergenic
925038319 2:709287-709309 CCGGGGAAGAAGAAGGTGGAAGG - Intergenic
926722565 2:15971981-15972003 CCTTGGGAGATGAAGGTGGGTGG + Intergenic
927310867 2:21629864-21629886 CCCTGAAGGAAGAAGCTGAAGGG - Intergenic
929124519 2:38511068-38511090 CCTTGGAAGAAGAAAGTCGAGGG + Intergenic
929518817 2:42628527-42628549 CTTTTAAATAAGAAGGTGGCTGG - Intronic
929671712 2:43881026-43881048 GCCTGAATGAAGAAGGGGGAAGG + Intergenic
932658755 2:73633880-73633902 ACTTGAACCAGGAAGGTGGAGGG - Intergenic
933168969 2:79104304-79104326 ACTTGAAGATAGAAGGTGGAAGG + Intergenic
933184884 2:79267914-79267936 CCTTGACAGAATATAGTGGAAGG + Intronic
934688441 2:96338602-96338624 CCTTGTAAGAGGAAGGTCGTCGG + Intronic
935316891 2:101843652-101843674 CCTGGAAATAAGAAAGTGGGAGG + Intronic
935497875 2:103804058-103804080 TCTTCAAACCAGAAGGTGGATGG - Intergenic
935575895 2:104710155-104710177 CCTTAAGAGAAGAGGGTGGGTGG - Intergenic
935590633 2:104843572-104843594 ACTTGAGGGACGAAGGTGGATGG + Intergenic
935733712 2:106089022-106089044 CATAGAAAGAAGAAAGAGGATGG - Intergenic
938207091 2:129432990-129433012 TCTTGTAAGAGGATGGTGGATGG + Intergenic
938370773 2:130767125-130767147 CCATGAAGGGAGAAGGTGGCTGG + Exonic
938982163 2:136537273-136537295 CTTTTAAAGAAGGAGTTGGAGGG - Intergenic
939956963 2:148535279-148535301 CCATGAAGGAGGAAGGAGGAAGG - Intergenic
940149824 2:150587574-150587596 CCTTGCAAGAAAAATATGGACGG + Intergenic
940283541 2:152011283-152011305 CCTCAAAGGAAGAAGGTGGAGGG - Intronic
940305701 2:152223943-152223965 GCTTGAAAGAAGAAAGATGAAGG - Intergenic
940405202 2:153293336-153293358 CCTTAAAAGATGAAAGAGGAAGG + Intergenic
942648566 2:178142794-178142816 CCTTGAAAGAATGAGGTGGAAGG + Intergenic
942944393 2:181657049-181657071 CCTTTGGAGAAGGAGGTGGAGGG + Intronic
943224894 2:185159706-185159728 CCTTGAACCCAGGAGGTGGAGGG + Intergenic
943573524 2:189602818-189602840 CCTTTAAAGAAGAAGGAGTTGGG + Intergenic
943854246 2:192768156-192768178 CCCTGAAGGAAGAAGGTGGTAGG + Intergenic
944230029 2:197383227-197383249 CTTTGGAAGACCAAGGTGGAAGG + Intergenic
945089628 2:206166686-206166708 CCTTGGAAGGCCAAGGTGGAAGG - Intergenic
945324024 2:208462422-208462444 CCTGGGAATAAGAATGTGGAAGG + Intronic
945683148 2:212937516-212937538 CCTTGTAAGAGGGAGGTGGGAGG + Intergenic
945703617 2:213201648-213201670 CCTATAAAGAAGGAGGAGGAGGG - Intergenic
945945050 2:215987582-215987604 TTTTAAAAGAAGAAAGTGGAAGG + Intronic
947204725 2:227649940-227649962 CTTTGAAAGACCAAGGTGGGAGG + Intergenic
947444254 2:230151375-230151397 CCTTGAAAGAAGAAGTTCCCAGG - Intergenic
947920462 2:233866915-233866937 CTTTGTAAGGAGATGGTGGATGG - Intergenic
948073884 2:235149964-235149986 CTTTGCAGGAAGAAGCTGGATGG + Intergenic
948955848 2:241290365-241290387 CCTTGAAAGGCCAAGGTGGGTGG + Intronic
948979112 2:241483748-241483770 CCTGGAATGAAGAAGGAGGCTGG - Intronic
1168751059 20:281733-281755 CTTTGGAAGAGCAAGGTGGAAGG + Intronic
1169345576 20:4825546-4825568 CCTTGAAGGATGAAGGATGAAGG - Intergenic
1169864674 20:10187085-10187107 CTTTGAAAGACCAAGGTGGAAGG + Intergenic
1170099549 20:12683820-12683842 CCTTAAAATAAGAAGGTGATAGG - Intergenic
1170527891 20:17259660-17259682 CCTTGAGATAGGAAGGTAGAGGG + Intronic
1171267699 20:23785704-23785726 CCTTGGAAGAAGAATGTACAGGG + Intergenic
1171356308 20:24548010-24548032 CACTGAAGGAAGAAGGGGGAAGG + Intronic
1172023097 20:31929137-31929159 CCTTGGAAGATCAAGGTGGGAGG - Intronic
1172077157 20:32307989-32308011 CTTTGAGAGAATGAGGTGGAGGG + Intronic
1172394223 20:34588167-34588189 ACTTGAAACCAGGAGGTGGAGGG + Intronic
1173002495 20:39114583-39114605 CCCAGAAAGAACAAGGTGGAAGG - Intergenic
1173914701 20:46698338-46698360 CCTTAAAAGTAGAAGGAGGCAGG - Intergenic
1174053539 20:47783794-47783816 GCTTGAAAGGCGAAGGTGGTGGG - Intronic
1174120193 20:48259303-48259325 ACTTGAAAGGTGAAGGTGGTGGG - Intergenic
1175051403 20:56158776-56158798 TCCTGAAAGAAGAAACTGGAAGG - Intergenic
1175348448 20:58300555-58300577 CCTTTCAAGAAGCAGCTGGAGGG - Intergenic
1175521849 20:59606771-59606793 CCATGAGAGAAGGAGGAGGAAGG + Intronic
1176918049 21:14649524-14649546 CTTTGAAAGGCCAAGGTGGATGG + Intronic
1181556639 22:23675235-23675257 CCTTGAGAGAAGAATCTGGAGGG - Intergenic
1181697750 22:24602348-24602370 CCTTGAGAGAAGAATCTGGAGGG + Intronic
1182025509 22:27115060-27115082 TGATGAAAGATGAAGGTGGAAGG + Intergenic
1182366764 22:29784400-29784422 CTTTGAAAGACGGAGGTGGGTGG - Intergenic
1182584313 22:31335146-31335168 CCTTGAGAGAGGAAAGTGGAAGG - Intronic
949672222 3:6412356-6412378 CCTTGAAAAAAAAAGGAAGATGG + Intergenic
951629982 3:24709207-24709229 CCTAGAAAGTAGAATGTGAATGG + Intergenic
952185844 3:30967870-30967892 CCAAGAAAGAAGAAGATGGGAGG + Intergenic
952412892 3:33065210-33065232 CACTGAAAAAAGAAGGTGGTTGG + Intronic
954940906 3:54372313-54372335 CAGTGAAAGAAGAGGGTGGGTGG + Intronic
954980026 3:54737512-54737534 CCTGGGAAGAAGAGGGTGGTTGG + Intronic
955003716 3:54950449-54950471 CCTTGCAAGATGAAGAGGGAAGG - Intronic
955488789 3:59461982-59462004 CCATGATAGCATAAGGTGGATGG + Intergenic
955788933 3:62568380-62568402 GCTAGAACGAAGCAGGTGGAAGG + Intronic
955960449 3:64335227-64335249 CCTTGAAAAAAAAGGGTGGGAGG + Intronic
956246867 3:67193125-67193147 CCTTGTAGGAAGAAGCTTGAGGG - Intergenic
956585970 3:70865397-70865419 TCTTGCAAGAAGAAGGCAGAAGG - Intergenic
959050075 3:101516116-101516138 TCTTTAAAGAAGAGGGTGGGTGG - Intergenic
960953456 3:123014468-123014490 GCTAGAAAGAGGAAGCTGGAAGG + Intronic
960976178 3:123176814-123176836 GCATTAAAGAAGAAGCTGGAGGG - Intronic
961474909 3:127140469-127140491 CCGTGAGAGAAGATGGTGGCTGG + Intergenic
963428777 3:145168470-145168492 CCTTGGTAGACCAAGGTGGAAGG + Intergenic
965811885 3:172599898-172599920 CCTTATAAGGAGCAGGTGGAGGG - Intergenic
966458076 3:180141002-180141024 AGTTGAAAGGAGAAGATGGAGGG - Intergenic
966516159 3:180822903-180822925 CCTTGAAGGCAGAGGGTGGGAGG + Intronic
967471667 3:189869093-189869115 CCTAGCAATAAGGAGGTGGAAGG - Intronic
967509867 3:190298251-190298273 CTTTGAAAGAAGCAGTAGGATGG - Intergenic
967758932 3:193202286-193202308 CCTGGGAAGGAGAAGATGGAAGG + Intergenic
968076255 3:195817343-195817365 CCTTGTAAGGAGAAGGAGGCCGG - Intergenic
968076280 3:195817431-195817453 CCTGGTAAGAAGAAGGAGGCTGG - Intergenic
968191358 3:196670041-196670063 CCTTGAAAGAAGCAAAGGGAGGG - Intronic
969334542 4:6499920-6499942 ACTTGGAAGAAGAAAGGGGAAGG - Intronic
969905757 4:10394241-10394263 CCTTGAAGACAGAAGTTGGATGG + Intergenic
970003483 4:11387843-11387865 CCCTGAAGGAAGCAGGTGAAGGG - Intergenic
970231674 4:13917223-13917245 CCTAGAGAGAAGAGGTTGGAGGG - Intergenic
972223507 4:36984255-36984277 GCTTGAACCCAGAAGGTGGAGGG + Intergenic
972678151 4:41280093-41280115 CCTGGAAGGCGGAAGGTGGAAGG - Intergenic
972922379 4:43959896-43959918 CCTTGGAAGGAGAAGGTGTTAGG + Intergenic
973942795 4:55927264-55927286 CATTGAAAGAAGACTGTGCATGG + Intergenic
974008409 4:56584208-56584230 CCTTGAAAGGTGGAGGTGGGAGG - Intronic
975771750 4:77731810-77731832 CCATGAAATAAGAAGCAGGAAGG + Intronic
976151715 4:82099154-82099176 CTCTCCAAGAAGAAGGTGGAGGG - Intergenic
976325000 4:83761254-83761276 CCTCCAGAGAATAAGGTGGAAGG - Intergenic
976351779 4:84067972-84067994 ACTTGAAAGTAGAAGGTGTTTGG - Intergenic
976362887 4:84201181-84201203 CCTTAGAAGAGGAAGGTAGAGGG - Intergenic
976997552 4:91454427-91454449 CCTTATAAGTAGAAGGTGGAGGG - Intronic
977269856 4:94903751-94903773 CCTTATAAGAAGAAGGTGTTAGG + Intronic
977590706 4:98823500-98823522 CCTTGACAATACAAGGTGGATGG - Intergenic
977914531 4:102577001-102577023 ATTTGCAAGCAGAAGGTGGAGGG + Exonic
978395259 4:108272285-108272307 CCTTAAGAGAAGAAGGCTGAGGG - Intergenic
978902695 4:113971824-113971846 CCTTGAATGAAAGAAGTGGATGG + Intronic
979309358 4:119184056-119184078 CTTTGGGAGGAGAAGGTGGATGG - Intronic
980147950 4:129013136-129013158 ACTTGAAAGGAGAGGGTGGGAGG - Intronic
983509156 4:168588868-168588890 ACTTGAAAGAAGAAATTGGCTGG - Intronic
984257684 4:177407792-177407814 ACTTTAAAATAGAAGGTGGAGGG + Intergenic
984886576 4:184455191-184455213 GGTTAGAAGAAGAAGGTGGAGGG - Intronic
986428671 5:7660028-7660050 GCTTGAGAGGAGAAGGTGGGAGG + Intronic
986445906 5:7821063-7821085 GCTTGAGAGAAGAAGGTGAGGGG - Intronic
986551826 5:8965018-8965040 ACTTGAAAGTGGAAGGTGGAAGG + Intergenic
986704483 5:10443856-10443878 CCTTGGAAGAAGGAGGCAGAGGG - Intronic
987027253 5:13939963-13939985 CCTGGACAGAAGAAAATGGATGG - Intronic
989060702 5:37408479-37408501 AATTGAAAAAAGAAGGTAGAGGG + Intronic
990335603 5:54769350-54769372 CCTTGAAAGAAATTGGTGAAAGG + Intergenic
990742953 5:58930884-58930906 ATTTGACAGAAGATGGTGGATGG + Intergenic
991050388 5:62266649-62266671 CCTTGGCAGAGGAAGGTGGACGG + Intergenic
991960058 5:72035354-72035376 CTTTGAAAGAAGGAGGAGGAGGG - Intergenic
992591827 5:78303533-78303555 CCTTAAAAGAGGAAGGCAGAAGG - Intergenic
992806797 5:80345638-80345660 CCTTGGAAGTCCAAGGTGGAAGG + Intergenic
993064037 5:83076835-83076857 AGTTAAGAGAAGAAGGTGGAAGG + Intronic
993388813 5:87292595-87292617 CATTGAAAGAAAAAGTCGGAGGG - Intronic
993473600 5:88336202-88336224 CTTTGGAAGAATGAGGTGGAAGG - Intergenic
993762104 5:91808151-91808173 CTTTGAAAGACCAAGGTGGGAGG - Intergenic
994195544 5:96918882-96918904 CCTTAAAAGAAGGAGGTGGGGGG - Exonic
994469122 5:100179825-100179847 CCTTGAAAGAAGAGGGTTGGAGG + Intergenic
995429532 5:112058776-112058798 CTTTGAGAGATAAAGGTGGAAGG - Intergenic
996010529 5:118477562-118477584 CCTTGCAAGCCCAAGGTGGATGG + Intergenic
996093959 5:119378775-119378797 CCTTTAAAGCAAAAGGTGGCTGG + Intronic
997203653 5:132027884-132027906 ACTTGAAAGAAGAAGAAGGAGGG - Intergenic
997663576 5:135608740-135608762 CCTTGGGAGAAGAGGGAGGATGG - Intergenic
998491479 5:142550944-142550966 CTTTGGAAGGATAAGGTGGACGG - Intergenic
999115695 5:149161358-149161380 CCATGGAGGAAGTAGGTGGAGGG - Intronic
999756046 5:154665239-154665261 ACTTGAACCCAGAAGGTGGAGGG - Intergenic
1000289676 5:159858735-159858757 CAATGACAGAAGAAGGTGGCAGG + Intergenic
1001592457 5:172874813-172874835 CCTTGAAAGGCCAAGGTGGGAGG + Intronic
1001939926 5:175733145-175733167 CCGTGGAGGAGGAAGGTGGAGGG + Intergenic
1002761938 6:209185-209207 CCTAGGAAGAAGAAAGGGGAAGG + Intergenic
1005931031 6:30484171-30484193 CCTTGGGAGACCAAGGTGGAAGG + Intergenic
1006233426 6:32605448-32605470 CCTTGAACCCAGGAGGTGGAGGG + Intergenic
1006240482 6:32673402-32673424 CTTTGAAAGACCAAGGTGGGCGG + Intergenic
1006410929 6:33872816-33872838 ACCTGGAAGAAGCAGGTGGAGGG + Intergenic
1008448665 6:51623664-51623686 GCTTGAAACCAGGAGGTGGAGGG - Intronic
1008616520 6:53231678-53231700 CCATTAAAAAAGAAGGTGGAAGG + Intergenic
1009284431 6:61798014-61798036 ACTTGAGAGGAGAAGGTGGGAGG - Intronic
1010082367 6:71878760-71878782 CTTTGAAAGGCCAAGGTGGAAGG + Intergenic
1010121072 6:72376636-72376658 CCTTGGGAGACTAAGGTGGAAGG + Intronic
1011401972 6:86973158-86973180 ATTTAAAAGGAGAAGGTGGAGGG - Intronic
1012199802 6:96391991-96392013 CCTTTAACGAAGCAGGTGAAAGG - Intergenic
1012974681 6:105767790-105767812 CTGTGAAAGAGGAAGGTGGTTGG - Intergenic
1012979725 6:105816733-105816755 CTTTGAAGGAAGAAGGAAGAGGG - Intergenic
1013358253 6:109366344-109366366 CCTTGGAAGTAATAGGTGGAGGG - Intergenic
1013675101 6:112450636-112450658 CCTGGAAAGAGGAATGGGGAAGG - Intergenic
1015657212 6:135532521-135532543 CCATGATGGAAGAAGGAGGATGG - Intergenic
1016365264 6:143308998-143309020 TCTTGAAAGAAGCTGGTGGTGGG + Intronic
1016445630 6:144129267-144129289 ACTTGAAGGAGGAGGGTGGAAGG + Intergenic
1016469485 6:144360414-144360436 CCTTGAGAGGCTAAGGTGGATGG - Intronic
1017385218 6:153875173-153875195 CTTTGAAAGACCAAGGTGGGAGG - Intergenic
1018058086 6:160069506-160069528 TCTTGAATAAAGAAGGTGCATGG + Intronic
1018811962 6:167304941-167304963 CCTTGAGGGGAGAAGGTGGCAGG - Intronic
1021293965 7:18880646-18880668 ACTTGAGAGAGGAGGGTGGAAGG + Intronic
1021519423 7:21524491-21524513 CCCTGAAGGAAAAAGGGGGAAGG - Intergenic
1021834749 7:24658854-24658876 CCTTGAACCTAGAAGTTGGAAGG - Intronic
1022034328 7:26519342-26519364 GCTTTTAAGAAGAAGTTGGAGGG - Intergenic
1022119757 7:27296724-27296746 GCTTGAACCCAGAAGGTGGAGGG + Intergenic
1022168798 7:27801958-27801980 CTTTGAAAGAACAAACTGGAGGG + Intronic
1022856693 7:34321856-34321878 TCGTGAAAGCAGAAGATGGAAGG + Intergenic
1023616296 7:42023607-42023629 TCCTGAAAGAAGAGGGTGGGGGG + Exonic
1023664155 7:42503032-42503054 CCTTTAATGAAAAAGGTGAAAGG - Intergenic
1023689315 7:42769949-42769971 GCTTGGAAGGAGAAGGTAGAGGG - Intergenic
1023882462 7:44328069-44328091 GCTTGAAAGGACAAGGTGGGAGG - Intronic
1025754308 7:64321345-64321367 CCTTCAAAGCAAAAGGTGCATGG - Intronic
1026894747 7:74003490-74003512 CCTGGAAAGAAGATTCTGGAAGG - Intergenic
1027523661 7:79240643-79240665 CCTTGAAATCATAAGTTGGAAGG - Intronic
1028039764 7:86036923-86036945 GCTTGAAGAAAGAATGTGGAAGG - Intergenic
1028682523 7:93553039-93553061 TTTTGAAAGAAGAAGGTGTGAGG - Intronic
1029503526 7:100948811-100948833 GCTTGAAACCAGAAGGTGGAGGG - Intergenic
1029933124 7:104394781-104394803 GCTTGAACCAAGGAGGTGGAGGG - Intronic
1030286388 7:107831275-107831297 CCTTATAAGAAGGAGGTGGAAGG + Intergenic
1030632036 7:111906708-111906730 CCTTGAAAAAGGGAGGGGGAAGG + Intronic
1030799535 7:113832221-113832243 CCTGGAAAGACAAAGGAGGAAGG + Intergenic
1031201579 7:118694905-118694927 CCTTAAAAAAACAAGGTGCATGG - Intergenic
1032136933 7:129288441-129288463 GCTTGAACCCAGAAGGTGGAGGG - Intronic
1032312854 7:130804272-130804294 GCATGAAAGAAGAAAGTGGTGGG + Intergenic
1034483452 7:151341425-151341447 CCTTGAAAGAGGCTGGGGGAAGG - Intergenic
1035412099 7:158653123-158653145 CCTTGAAAGGCCAAGGTGGGTGG + Intronic
1035862293 8:3042225-3042247 CCTTGGAAGAGAGAGGTGGATGG + Intronic
1036162519 8:6402881-6402903 CCTTGCAAGCTGAAGCTGGATGG + Intergenic
1036541716 8:9720473-9720495 CCTTGTAAGGAGATGATGGAGGG - Exonic
1036900217 8:12664792-12664814 ACGTAAAAGAAGGAGGTGGAAGG + Intergenic
1038108681 8:24467980-24468002 CCTTGAACCCAGGAGGTGGAAGG + Intronic
1038302003 8:26360226-26360248 ACTTGAAAGAGGAGGATGGAAGG + Exonic
1038307400 8:26417158-26417180 CCCTGAAAAATGAAGCTGGAGGG - Intronic
1038324314 8:26561046-26561068 CCTTGAAAGAAGCAGGGGGAGGG + Intronic
1038587229 8:28800925-28800947 CGTGGAAAGAAACAGGTGGAGGG + Intronic
1039635763 8:39162916-39162938 GCTTGAACAAGGAAGGTGGAGGG + Intronic
1040485151 8:47864140-47864162 CCTTGTAAGAAGGATGTGTAGGG + Intronic
1040623746 8:49120078-49120100 TCTTAAAAGAATGAGGTGGAAGG - Intergenic
1041372086 8:57172320-57172342 TCTTGAAAGATGAAGCTGGAAGG - Intergenic
1041536777 8:58935567-58935589 CCTTGAAAGAAAATCTTGGAAGG + Intronic
1041733068 8:61082576-61082598 TCTTGAAAGAAGCTGGTGGTAGG + Intronic
1041991872 8:64002499-64002521 GCATGAAAAATGAAGGTGGAGGG + Intergenic
1042281802 8:67064071-67064093 CCTGGAAAGAAAAATGGGGAGGG - Intronic
1042921819 8:73927666-73927688 ACTTGAAACCAGGAGGTGGATGG - Intergenic
1043064668 8:75553344-75553366 TCTTGATAGAACAAGGTGAATGG - Intronic
1043381801 8:79710366-79710388 GCTTGAACTCAGAAGGTGGAGGG - Intergenic
1043671468 8:82890400-82890422 CTTAAAAAGAAGAAGATGGAGGG - Intergenic
1044096917 8:88078150-88078172 CCCTTATAGAAGGAGGTGGAAGG + Intronic
1044103295 8:88168949-88168971 CCTTGAAAGGCAAAGGTGGGAGG - Intronic
1044769175 8:95611339-95611361 ACTTGAGAGAGGAAGGTGGGAGG - Intergenic
1045145664 8:99341088-99341110 CTTTGTAAGGAGATGGTGGATGG - Intronic
1047265920 8:123309259-123309281 CCTTGAGAGACCAAGGTGGGAGG - Intergenic
1047688892 8:127330512-127330534 CCCTGAAACAAGAAGAGGGATGG + Intergenic
1047902517 8:129439642-129439664 GCTTGAAATAAGAAGCTGAATGG - Intergenic
1048237842 8:132709552-132709574 CCTTTAAAGAGGGAGGTAGAGGG + Intronic
1048285546 8:133138442-133138464 CCTTAAAAGTAGAAGAGGGAGGG + Intergenic
1048395030 8:134006268-134006290 CATTGTAAAAAGGAGGTGGAGGG + Intergenic
1049341431 8:142114646-142114668 CTTTGAGAGAAGAAGGAAGAAGG + Intergenic
1049368883 8:142254079-142254101 TCTGCCAAGAAGAAGGTGGAAGG - Intronic
1050412618 9:5382487-5382509 CCTGGAAAGAAGAATGAGCATGG + Intronic
1050975559 9:11933423-11933445 ACTTGAAAGTAGAAGGTGGGAGG + Intergenic
1050978371 9:11972730-11972752 CTTGGAAAGAAGGAGATGGATGG - Intergenic
1051283476 9:15468035-15468057 GCTTGAACCCAGAAGGTGGAGGG + Intronic
1051686536 9:19663933-19663955 CCTTCTAATAAGCAGGTGGATGG + Intronic
1051808819 9:21027643-21027665 CCGTGAAGGAAGAAGGTAGCAGG + Intronic
1052683242 9:31721367-31721389 ACTTGAACCCAGAAGGTGGAGGG + Intergenic
1053028211 9:34749487-34749509 CCTTGAAAGGCCAAGGTGGGAGG + Intergenic
1054887974 9:70219767-70219789 GTTCGAAAGAAGAAAGTGGATGG + Intronic
1055581500 9:77711192-77711214 CCTTCAGAGAAGGAGGGGGAGGG - Intergenic
1056959504 9:91110354-91110376 ACTTGAAGGAAGAGGGTGGGAGG + Intergenic
1057093839 9:92286122-92286144 CTTTGAGAGATCAAGGTGGATGG + Intronic
1057642489 9:96837967-96837989 CTTTGAAAGGCCAAGGTGGACGG - Intronic
1057969142 9:99536637-99536659 CCTGGAAAGAAGAAAGTAGAAGG + Intergenic
1058104095 9:100950371-100950393 CCCAGGTAGAAGAAGGTGGATGG + Intergenic
1059955938 9:119516086-119516108 GCTTGAACCAAGGAGGTGGAAGG - Intronic
1060898137 9:127232550-127232572 CCTTGAGAGGCTAAGGTGGAAGG - Intronic
1061287652 9:129633298-129633320 CCATGAGACAAGAAGGTGGGGGG - Intronic
1061998039 9:134197992-134198014 CCTTAAAGGAAACAGGTGGAAGG + Intergenic
1062109873 9:134776455-134776477 ACTTGGAAGCAGAGGGTGGAAGG + Intronic
1185749331 X:2598137-2598159 CCTTGAAAGGAAAGGATGGATGG + Intergenic
1186128022 X:6436583-6436605 TCTTGAAACAAGAAGATGGATGG + Intergenic
1186670573 X:11763787-11763809 CTTTGTAAGGAGATGGTGGATGG + Exonic
1187234253 X:17452167-17452189 CCTTGATAGCAGTAGGTGAAAGG + Intronic
1188354426 X:29174001-29174023 CCTTGAACCCAGGAGGTGGAGGG - Intronic
1188440761 X:30213885-30213907 CCCTGAATGAAGATGATGGAAGG + Intergenic
1190033408 X:46996702-46996724 CCTTACAAGAGAAAGGTGGAGGG - Intronic
1190182024 X:48200616-48200638 CTTTGAAAGGTCAAGGTGGACGG - Intronic
1191616106 X:63171162-63171184 CCTTGAAGGAAGCAGATGGTTGG - Intergenic
1191620191 X:63207761-63207783 CCTTGAAGGAAGCAGATGGTTGG + Intergenic
1192329520 X:70163862-70163884 ACTTGAAAGAAAGGGGTGGAGGG + Intronic
1194046638 X:89014376-89014398 CTTTGAAAGACCAAGGTGGGAGG - Intergenic
1196592481 X:117503183-117503205 ACTGGAAAGAAGGAGGTGGTTGG + Intergenic
1197169698 X:123418199-123418221 CATTGAAAGGAGAAGGTAGGAGG - Intronic
1197831905 X:130651876-130651898 CTTTGAAAGAAGAAAGGGAAGGG - Intronic
1198171043 X:134105498-134105520 CATTCATAGAAGAAGGTGAAAGG + Intergenic
1199105789 X:143865945-143865967 CCTTGACAGATGAAAGTTGAAGG + Intergenic
1199270939 X:145881915-145881937 TCTTGAAAGGGGAATGTGGATGG + Intergenic
1201448493 Y:14084033-14084055 CCATGAAAGAAGAGGCTGGTGGG + Intergenic
1201610187 Y:15833937-15833959 TCTTGAAGCAAGAAGGTGGGTGG + Intergenic