ID: 1151541761

View in Genome Browser
Species Human (GRCh38)
Location 17:74768211-74768233
Sequence CTCGCTGGTGTCACTGGAGG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 162}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151541761_1151541777 12 Left 1151541761 17:74768211-74768233 CCGCCTCCAGTGACACCAGCGAG 0: 1
1: 0
2: 1
3: 18
4: 162
Right 1151541777 17:74768246-74768268 CCATGCGGGGGGTGGCAACTGGG 0: 1
1: 0
2: 0
3: 3
4: 69
1151541761_1151541773 4 Left 1151541761 17:74768211-74768233 CCGCCTCCAGTGACACCAGCGAG 0: 1
1: 0
2: 1
3: 18
4: 162
Right 1151541773 17:74768238-74768260 TAGGCCAGCCATGCGGGGGGTGG 0: 1
1: 0
2: 0
3: 12
4: 111
1151541761_1151541769 -2 Left 1151541761 17:74768211-74768233 CCGCCTCCAGTGACACCAGCGAG 0: 1
1: 0
2: 1
3: 18
4: 162
Right 1151541769 17:74768232-74768254 AGGAGGTAGGCCAGCCATGCGGG 0: 1
1: 0
2: 2
3: 35
4: 388
1151541761_1151541772 1 Left 1151541761 17:74768211-74768233 CCGCCTCCAGTGACACCAGCGAG 0: 1
1: 0
2: 1
3: 18
4: 162
Right 1151541772 17:74768235-74768257 AGGTAGGCCAGCCATGCGGGGGG 0: 1
1: 0
2: 0
3: 11
4: 123
1151541761_1151541778 19 Left 1151541761 17:74768211-74768233 CCGCCTCCAGTGACACCAGCGAG 0: 1
1: 0
2: 1
3: 18
4: 162
Right 1151541778 17:74768253-74768275 GGGGGTGGCAACTGGGTTACAGG 0: 1
1: 0
2: 1
3: 16
4: 163
1151541761_1151541770 -1 Left 1151541761 17:74768211-74768233 CCGCCTCCAGTGACACCAGCGAG 0: 1
1: 0
2: 1
3: 18
4: 162
Right 1151541770 17:74768233-74768255 GGAGGTAGGCCAGCCATGCGGGG 0: 1
1: 0
2: 0
3: 9
4: 108
1151541761_1151541768 -3 Left 1151541761 17:74768211-74768233 CCGCCTCCAGTGACACCAGCGAG 0: 1
1: 0
2: 1
3: 18
4: 162
Right 1151541768 17:74768231-74768253 GAGGAGGTAGGCCAGCCATGCGG 0: 1
1: 0
2: 0
3: 26
4: 247
1151541761_1151541775 11 Left 1151541761 17:74768211-74768233 CCGCCTCCAGTGACACCAGCGAG 0: 1
1: 0
2: 1
3: 18
4: 162
Right 1151541775 17:74768245-74768267 GCCATGCGGGGGGTGGCAACTGG 0: 1
1: 0
2: 0
3: 4
4: 120
1151541761_1151541771 0 Left 1151541761 17:74768211-74768233 CCGCCTCCAGTGACACCAGCGAG 0: 1
1: 0
2: 1
3: 18
4: 162
Right 1151541771 17:74768234-74768256 GAGGTAGGCCAGCCATGCGGGGG 0: 1
1: 0
2: 0
3: 8
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151541761 Original CRISPR CTCGCTGGTGTCACTGGAGG CGG (reversed) Exonic
900428373 1:2590760-2590782 CCCGCGGGTGTCTGTGGAGGGGG + Exonic
901254467 1:7809969-7809991 CCCACTGGCCTCACTGGAGGAGG - Exonic
901323057 1:8350959-8350981 CCCGCTGGTTCCACTGCAGGTGG - Intergenic
901578998 1:10225044-10225066 ATCGCTGATCTCACAGGAGGAGG + Intronic
902044219 1:13513302-13513324 CTCGCTGCGCTCGCTGGAGGAGG - Exonic
902503276 1:16924350-16924372 ATCGCTGCTGTCGCTGCAGGAGG + Exonic
902818323 1:18928575-18928597 CACGCTGGGATCCCTGGAGGAGG - Intronic
905393167 1:37650975-37650997 GTGGCTGGTGGAACTGGAGGAGG + Intergenic
905791022 1:40789589-40789611 TTCTTTGGTGTCACTGGAGCCGG + Intronic
906148749 1:43575587-43575609 CTGGCTGGGGCCAATGGAGGGGG - Intronic
907294119 1:53438892-53438914 CTCGCTGGAGCCCATGGAGGCGG - Intergenic
910727593 1:90355268-90355290 TCCGCTGCTGTTACTGGAGGTGG + Intergenic
914995589 1:152540874-152540896 GTGGCTGGTGTCAATGAAGGTGG + Intronic
915142096 1:153774244-153774266 CTTCCTGCTGCCACTGGAGGTGG + Intergenic
915213673 1:154326893-154326915 CTGGCTGGGGGCCCTGGAGGAGG + Intronic
915581132 1:156814054-156814076 CTCGCTGGTGACCCTGGCCGAGG - Intronic
916505161 1:165422152-165422174 CTGGCTGGTGGCAGTGGAGCTGG - Intronic
918089048 1:181271979-181272001 CTCCATGGTGTCACTGGAGATGG + Intergenic
919471889 1:197989147-197989169 CTCGCTGCTGTGTCTGGAGGAGG + Intergenic
919773216 1:201176293-201176315 CTCACTGGGGCCATTGGAGGTGG + Intergenic
923603285 1:235422047-235422069 CACGCTGGGGTCAACGGAGGAGG - Intronic
924827877 1:247560981-247561003 CTCACTGTTGTCACTGGGGCTGG + Intronic
1066340373 10:34526700-34526722 CTTGCTGGTGGCACAGCAGGAGG - Intronic
1066649218 10:37639430-37639452 CCCGCTGGTTTCAAGGGAGGAGG - Intergenic
1067562169 10:47311767-47311789 CTGGCTGGTGTCCCGGAAGGTGG - Intronic
1071415329 10:85436043-85436065 CTCACTGGTGTTACTGTGGGAGG - Intergenic
1071561519 10:86649798-86649820 CTCGCTGGCATGGCTGGAGGTGG - Intergenic
1073577005 10:104634793-104634815 CTAGCTGGTGACAATGGAGGTGG + Intergenic
1073848507 10:107587401-107587423 CTGGCTGGGGCCACTGGAGCTGG - Intergenic
1076220140 10:128727306-128727328 CTCTCTGCTGCCACTGCAGGGGG + Intergenic
1076688076 10:132207116-132207138 CTCTCTGGTCTCGCTGGAGGAGG - Intergenic
1076785587 10:132748300-132748322 ATCGCTGGTGTGGGTGGAGGAGG - Intronic
1076841436 10:133047776-133047798 TTGGCCGGTGACACTGGAGGGGG - Intergenic
1078645061 11:13134472-13134494 CTAGGTGGTGGCAGTGGAGGTGG - Intergenic
1080895600 11:36446718-36446740 CTCCCTGGCATCACTGGAGAGGG - Intronic
1083222047 11:61258922-61258944 CGCTCTGGAGTCACAGGAGGTGG + Exonic
1083718232 11:64591360-64591382 CCTGCTGGTGTCACTTGGGGTGG - Exonic
1087288118 11:96288510-96288532 CTCGCTGTTGTCACCCGAGCTGG - Intronic
1089386791 11:118073747-118073769 CTCGCTGGTGTCCATGGGGGAGG - Intergenic
1089389570 11:118091338-118091360 CTTGCTGGTCTCCCTAGAGGAGG - Intronic
1089478491 11:118786151-118786173 CCCACTGGTGGCCCTGGAGGAGG - Exonic
1091221892 11:133934714-133934736 ATGGCTGGTGGCCCTGGAGGTGG - Intronic
1093714109 12:22361992-22362014 CTTGCTGGTCTGACAGGAGGCGG - Intronic
1098040728 12:66351801-66351823 CTCACTGGAATCACTGGGGGAGG + Intronic
1098572339 12:72002299-72002321 ATCACAGGTGTCACTGGATGAGG + Intronic
1098896352 12:76066070-76066092 CTAGCTCATGTCACTGGAGGAGG + Intronic
1103176412 12:118867461-118867483 CTCCATCGAGTCACTGGAGGAGG - Intergenic
1104036285 12:125099329-125099351 CACCCTGGTGTCCCTGGAGGAGG + Intronic
1106778806 13:33034810-33034832 CTCACTGGTCTAAGTGGAGGGGG - Intronic
1107273463 13:38648505-38648527 CTGGCTGATGTGACTGTAGGAGG - Intergenic
1109698862 13:65998569-65998591 GTCTCTCGTGTCACTGGGGGAGG + Intergenic
1114567186 14:23641361-23641383 CACGCTGGAGTCGCTGGAGAAGG - Intronic
1117365846 14:55026919-55026941 CCCGCTGGTGTCACTCGGGTGGG - Intronic
1118562401 14:67100594-67100616 TGCCATGGTGTCACTGGAGGTGG - Intronic
1119900571 14:78256184-78256206 CACGTTGTTGTCACTGGAGATGG + Intronic
1121616849 14:95319414-95319436 CTCGCAGCGGTGACTGGAGGGGG + Intronic
1121685172 14:95830412-95830434 CTCTCTGGAGTCACTGGAATTGG - Intergenic
1124365133 15:29065771-29065793 GTAGCTGTTGACACTGGAGGAGG - Intronic
1124371637 15:29107638-29107660 CCCTCTGGTGCCACTGGTGGAGG - Intronic
1125721245 15:41846130-41846152 CTTGGTGGTGACCCTGGAGGGGG - Intronic
1126326955 15:47489245-47489267 CTCTCTGGAGTCTTTGGAGGGGG + Intronic
1127008553 15:54597159-54597181 CTGGCTGTTGTGACAGGAGGTGG + Intronic
1129162331 15:73753461-73753483 CTCGCTGGCGGGGCTGGAGGCGG + Intergenic
1132155294 15:99491906-99491928 CTTCCTTGTGTCTCTGGAGGAGG - Intergenic
1132937164 16:2486981-2487003 CCCCCTGGTGGCCCTGGAGGAGG - Intronic
1133008841 16:2899005-2899027 CAGGCTGGTGTCAATGGAGATGG - Intronic
1133879105 16:9763929-9763951 CTCGCTGGTCTCACTGTGCGGGG + Exonic
1134290884 16:12902210-12902232 CTCGCTGGCCTCTCCGGAGGCGG - Exonic
1140410808 16:74739350-74739372 CTGGAGGGGGTCACTGGAGGGGG - Intronic
1142106212 16:88304270-88304292 CGCCCTGGTGTCACTGGTGTGGG - Intergenic
1142717089 17:1753063-1753085 CTCGCTGGCTTCCCTGGAAGGGG + Intronic
1143316832 17:6039258-6039280 CTGGCTGGGGTCGCTGGAGGGGG - Intronic
1146652214 17:34613807-34613829 CTCTCTGGCGTGACTGTAGGAGG + Intronic
1147663337 17:42129352-42129374 CTAGCTGGAGTGCCTGGAGGTGG - Intronic
1147863958 17:43540970-43540992 CTTGCTGGCGTCACTGGTGCTGG + Intronic
1151414922 17:73955870-73955892 CTGGCTGGTGTCCATGGAGATGG + Intergenic
1151541761 17:74768211-74768233 CTCGCTGGTGTCACTGGAGGCGG - Exonic
1153925158 18:9828985-9829007 CCTGCTGCTGTCACAGGAGGAGG + Intronic
1154013944 18:10599953-10599975 CTCCCGGGTGTGACTGGAGCAGG + Intergenic
1157731282 18:50006595-50006617 CTCTCAGGTGTCACAGAAGGGGG - Intronic
1157840193 18:50950322-50950344 CTGGCTGGTGTCTCTTCAGGAGG + Exonic
1160153145 18:76410445-76410467 CTTTCTGGAGCCACTGGAGGAGG + Intronic
1160553067 18:79707464-79707486 CTAGCTGGTCTCACTGCAGGAGG - Intronic
1160983778 19:1828227-1828249 CTCGCTGGCGTCCCTGGACAGGG - Exonic
1161021360 19:2013227-2013249 CTTGCTGCGGGCACTGGAGGGGG - Intronic
1161477396 19:4494156-4494178 CTCGTCGCTGTCACTGGAGGCGG - Exonic
1162325001 19:9993671-9993693 CTCACTGGTGTCTCTGGACAGGG - Exonic
1163490889 19:17616664-17616686 GTCCCTGGTGTCCCTGGAGCAGG - Intronic
1163600768 19:18247921-18247943 CTGGCTGCTGTCCCTGGATGGGG - Intronic
1164664135 19:30012443-30012465 CTCACTGGTGTCACTGCAAGTGG - Exonic
1165774013 19:38394662-38394684 CTGGCGGCTGTGACTGGAGGAGG - Exonic
1166391399 19:42410777-42410799 GTCGCTGGTGACTCTGGCGGAGG - Exonic
1166873168 19:45882906-45882928 CTCGCTGGCGTCACGGGGCGGGG - Intergenic
1167497886 19:49830110-49830132 CTGGCTGCTTTGACTGGAGGGGG - Exonic
1167703203 19:51063499-51063521 ATCGCCGGTGTCATTGGAGCAGG + Intronic
1167745258 19:51347025-51347047 CTCCCAGGTGACGCTGGAGGGGG - Exonic
925026160 2:608885-608907 CCCGCTGGTGTCAAATGAGGAGG - Intergenic
926798120 2:16635576-16635598 CTGCCTGGTGTCACTGTGGGGGG - Intronic
927247210 2:20967028-20967050 CTGGCTGGATTCACTGGAGGAGG - Intergenic
927783176 2:25955241-25955263 CTCACTGGTGACACTGAACGGGG + Intronic
927892682 2:26762166-26762188 ATCGCTTGAGTCCCTGGAGGTGG - Intergenic
929174994 2:38967287-38967309 CTCCCTGTTGTTACTGGAGAAGG + Intronic
932694605 2:73944851-73944873 CTCTGTGGTGTCACTAGAGATGG - Intronic
934819035 2:97356074-97356096 CTCACTGCTGTCGCTGGAGTTGG + Intergenic
935433424 2:103002740-103002762 CTTGCTGGTGTCCCAGGAGCAGG - Intergenic
937262742 2:120596766-120596788 TTGGCTGGTGTCACAGGATGGGG - Intergenic
938316686 2:130334261-130334283 CCCGCTGGTATGACAGGAGGCGG - Intergenic
939109739 2:137992514-137992536 CTGGCTGGTGTTACTGGAGTTGG - Intronic
939245863 2:139622802-139622824 ATCTGTGGTGTCACTGTAGGTGG + Intergenic
945921114 2:215755464-215755486 TTCGCTGATGTCACCGGAGGTGG + Intergenic
948874640 2:240820122-240820144 CTCTCCGGCGTCACTGGCGGCGG + Exonic
948892053 2:240912224-240912246 CTAGCTGGTGTCCAGGGAGGTGG - Intergenic
1168984720 20:2038413-2038435 CTTGCTGGAGACACTGGAGAAGG + Intergenic
1171508631 20:25661044-25661066 ACCGCTGATGTGACTGGAGGTGG + Intergenic
1177429602 21:20974985-20975007 CTGGCTGGAGTCATTGGAAGAGG - Intergenic
1178577860 21:33811083-33811105 GTCACTGGTTTCACTGGAGCGGG - Exonic
1179505596 21:41837942-41837964 CGAGCTGGTGTCAGTGGTGGTGG + Exonic
1179596365 21:42445541-42445563 CTGGCTGGTGTCACTGGGCTGGG - Intronic
1180232549 21:46436050-46436072 CTCGCTGCTGTTCCCGGAGGTGG - Exonic
1180669570 22:17542700-17542722 CTGGGTGCTGGCACTGGAGGTGG - Exonic
1181617360 22:24064166-24064188 CTCTGTGGTTTCCCTGGAGGAGG + Exonic
1181672790 22:24433533-24433555 CTTTGTGGTGTCACTGGCGGCGG + Exonic
1184788039 22:46681198-46681220 ATGGCAGGTGTCACTGGAGCCGG + Intergenic
1184821918 22:46915798-46915820 CCCACTGGTTTCACGGGAGGTGG + Intronic
949682674 3:6533379-6533401 CTCCCTGGTGTCACTGGAGTAGG + Intergenic
953293324 3:41688195-41688217 CTCTGTGGTGTCAGGGGAGGGGG - Intronic
954248814 3:49352731-49352753 CACTTTGGTGTCTCTGGAGGTGG + Intergenic
957349786 3:79008968-79008990 CTCGCTGTTGTCACCTGAGCTGG + Intronic
959762125 3:109977890-109977912 CCAGCTGGTGTCTCTGTAGGCGG + Intergenic
961060373 3:123823551-123823573 ATGGCTGGTGGCAGTGGAGGTGG - Intronic
963160925 3:142149769-142149791 CCCGCAGCTGTCCCTGGAGGCGG - Intergenic
967158147 3:186712130-186712152 CTCCCTGGAGTCCCTGGAGAAGG - Intergenic
967945910 3:194804039-194804061 CTCTCTGGTGGCTCTGGAGGTGG + Intergenic
968230994 3:197004298-197004320 CCCGCAGGTGCCACTGGAAGAGG + Intronic
968441497 4:626720-626742 CTCACTGGAGTCACTGAAGGAGG + Intronic
972094261 4:35328571-35328593 CTCTCTGCTGTCATTGGAGGTGG - Intergenic
972568492 4:40289687-40289709 CAGGCTGGTGGCAGTGGAGGTGG + Intergenic
980985917 4:139693914-139693936 CTCGCTGGTGTCTTTGCTGGTGG + Intronic
984902637 4:184598975-184598997 CTTGCTTATGTCACTGCAGGAGG - Intergenic
991633473 5:68680156-68680178 GCCGCTGGTCTCACAGGAGGAGG + Intergenic
994281525 5:97909192-97909214 CTCGCTTCTGTTACTGGAGAGGG + Intergenic
997872108 5:137515373-137515395 CCAGCTGGTGTCATTGGAAGTGG + Intronic
998890879 5:146744448-146744470 CTGTGTGTTGTCACTGGAGGAGG - Intronic
999353055 5:150895615-150895637 TTCGCTGGTGTCCCGGAAGGTGG + Exonic
1002959944 6:1905241-1905263 CTGGCCGGTGTCATTAGAGGTGG + Intronic
1004959790 6:20774084-20774106 CTCTCTGGTGGTAGTGGAGGTGG + Intronic
1011220176 6:85046761-85046783 CTTGCTGGTGTTATTAGAGGAGG + Intergenic
1018173287 6:161158867-161158889 CTTGCTGGTGTTAGTGGGGGTGG - Intronic
1018180752 6:161221301-161221323 CTGGCTGGTGACATTGGACGTGG - Intronic
1019272467 7:158035-158057 CTCGCTGGAGTCCTTGGAGGTGG - Intergenic
1021595129 7:22307314-22307336 CACGCTGGTGTAAATGGTGGAGG + Intronic
1023195642 7:37635782-37635804 CTCGCTGGTGTGGCTGGGGATGG + Intergenic
1023287792 7:38637099-38637121 CTCCCTGATCTCCCTGGAGGCGG - Intergenic
1023921140 7:44630968-44630990 CCCGCTGATGTGACAGGAGGTGG + Intronic
1024582597 7:50812272-50812294 GTCACTGGTGGCACTGGAGCTGG - Intergenic
1026067947 7:67092247-67092269 CAAGGTGGTGACACTGGAGGTGG - Intronic
1026708981 7:72720059-72720081 CAAGGTGGTGACACTGGAGGTGG + Intronic
1028987045 7:97017115-97017137 CTGGCCTGTGTCACCGGAGGGGG + Intergenic
1029404984 7:100369347-100369369 CTGGCTGATGTCACTGAATGGGG + Intronic
1030937517 7:115603667-115603689 CTCGCTGATTTGACAGGAGGCGG - Intergenic
1033449661 7:141451044-141451066 CTTGCTGGTGGGAGTGGAGGAGG - Intronic
1036167530 8:6450484-6450506 GTGGCTGGTATCCCTGGAGGTGG - Intronic
1041126627 8:54647382-54647404 CTCGCTGGTGTCACCCAAGCTGG - Intergenic
1041215346 8:55595079-55595101 CTCGTTGCTGTCACAGGAGCTGG + Intergenic
1044298530 8:90556299-90556321 CCCTCTGGTGTCTCTGTAGGTGG - Intergenic
1045130793 8:99149781-99149803 ATCGCTGATCTCACAGGAGGCGG - Intronic
1047202897 8:122781536-122781558 TTCGCCGGTGTCTCCGGAGGGGG + Exonic
1048752570 8:137696968-137696990 CTCACTGCTGTCACAGGATGAGG - Intergenic
1055005278 9:71498694-71498716 ATCCCTGGTGTCCCTGGATGGGG + Intergenic
1055446036 9:76383162-76383184 CCCGCTGATGTGACAGGAGGCGG + Intergenic
1056326835 9:85486972-85486994 CCCACTGGGGACACTGGAGGGGG + Intergenic
1056762618 9:89425896-89425918 TGCCCTGGTGTCCCTGGAGGAGG - Intronic
1057377014 9:94534264-94534286 TACGCTGGGGTCAGTGGAGGAGG + Intergenic
1058836830 9:108864645-108864667 CTCTCTGGTGTTCCTGCAGGGGG + Intergenic
1059564384 9:115368712-115368734 CTGGCTTTTGTCATTGGAGGAGG + Intronic
1061670911 9:132187790-132187812 CTCCCTGGAGTCAGGGGAGGAGG + Intronic
1062300603 9:135865802-135865824 GGGGCTGGTGCCACTGGAGGGGG + Intronic
1187862719 X:23697485-23697507 ATCAGTGGTGTCACTGAAGGTGG - Intergenic
1189461682 X:41248472-41248494 CTCCCAGGGGTCCCTGGAGGAGG + Intergenic
1191675086 X:63785040-63785062 CTCGTTGGAGGAACTGGAGGTGG + Intronic
1198218343 X:134577344-134577366 CTTGTTGGGGTCACTGGAGAGGG + Intronic
1200083664 X:153592254-153592276 GTCGCCGGTGTCCCGGGAGGAGG - Intronic