ID: 1151542644

View in Genome Browser
Species Human (GRCh38)
Location 17:74772547-74772569
Sequence ATGAAGGAGCAGAAACAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 874
Summary {0: 1, 1: 0, 2: 6, 3: 72, 4: 795}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151542633_1151542644 21 Left 1151542633 17:74772503-74772525 CCTCATGGGGATAGTCAGTAGCC 0: 1
1: 0
2: 0
3: 7
4: 53
Right 1151542644 17:74772547-74772569 ATGAAGGAGCAGAAACAGGAGGG 0: 1
1: 0
2: 6
3: 72
4: 795
1151542639_1151542644 0 Left 1151542639 17:74772524-74772546 CCACTTGGGGGAAACTGAGGACC 0: 1
1: 0
2: 1
3: 26
4: 178
Right 1151542644 17:74772547-74772569 ATGAAGGAGCAGAAACAGGAGGG 0: 1
1: 0
2: 6
3: 72
4: 795

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151542644 Original CRISPR ATGAAGGAGCAGAAACAGGA GGG Intronic
900535287 1:3174009-3174031 ACGAAAGAGCACAAACTGGATGG + Intronic
901265834 1:7910133-7910155 ATGAGGGGCCAGAGACAGGAGGG - Intergenic
901400240 1:9010751-9010773 ATGAATGACCAGAACAAGGAAGG - Intronic
901916119 1:12502007-12502029 AAGAAGGAGCAGAGGCTGGAAGG + Intronic
902379492 1:16045954-16045976 GGGAAGGAGAAGAAACAGGGTGG - Intronic
902814276 1:18907355-18907377 GTCGAGGAGCAGAAAGAGGATGG + Exonic
903404867 1:23087903-23087925 ATGGAGAAGGAGGAACAGGAGGG + Exonic
903575795 1:24339019-24339041 ATGAAGCAGCAGCAGCAGTATGG - Intronic
903813845 1:26050191-26050213 ATAAGGGACCAGAGACAGGAGGG - Intergenic
903989175 1:27253320-27253342 AAGAAGAAGCAGAAACAGAGAGG - Intronic
904432414 1:30472976-30472998 CTGAAGGAGCAGAAAGGGAAGGG - Intergenic
904517556 1:31068029-31068051 ATGAAAGAGCAGAAATGGGAAGG + Intergenic
905115020 1:35631141-35631163 ATGAACAAGTAGCAACAGGAGGG + Intronic
905320522 1:37113569-37113591 ATGAAGGAGAAGAAAAAGCATGG - Intergenic
905521321 1:38602862-38602884 AAACAGGAGCAGAAACAGAAAGG + Intergenic
905529088 1:38662177-38662199 ATGAAGGAGAAAAAGAAGGAAGG + Intergenic
905731507 1:40302042-40302064 AGGAAGGTGCAGACAAAGGATGG + Intronic
906054739 1:42906667-42906689 ATGAAGGGGTAGAAATGGGAAGG - Intergenic
906180866 1:43817681-43817703 AAGAAGGAGAAGAAGAAGGAAGG - Intronic
906482079 1:46205743-46205765 AGGAAGGAGAAAAAATAGGATGG - Intronic
906706387 1:47898092-47898114 ATGAATGAGCAGATGAAGGAAGG + Intronic
907071085 1:51535508-51535530 ATGAAGAAATAGAAACAGTATGG - Intergenic
907472564 1:54683500-54683522 GGGCAGGAGCAGAATCAGGAAGG - Intronic
908341545 1:63185326-63185348 AGGAAACATCAGAAACAGGAAGG - Intergenic
908993204 1:70119436-70119458 AAGAAAGAGATGAAACAGGAAGG - Intronic
910019287 1:82567198-82567220 ATAAAGGAGAAAAAACAGGACGG + Intergenic
910919668 1:92330103-92330125 ATGAAGAATAAGAAACTGGACGG - Intronic
911104626 1:94119999-94120021 CTAAAGGAGCTGAAAGAGGAAGG - Intronic
911379014 1:97088964-97088986 ACTATGGAGCATAAACAGGAGGG - Intronic
911644776 1:100326550-100326572 AGGAAGGAGAAGAAGAAGGAAGG - Intergenic
911732853 1:101308234-101308256 AGGAAACAGCAGAAGCAGGAAGG + Intergenic
911856495 1:102884164-102884186 ATGAGGGATGAGAGACAGGAGGG - Intronic
912039672 1:105372730-105372752 AAGGAGGAGAAGAAATAGGAAGG + Intergenic
912210330 1:107550278-107550300 GAGAAGGAGGAGGAACAGGAGGG + Intergenic
912777520 1:112515108-112515130 GGGAAGGAGCTGACACAGGATGG - Intronic
912853594 1:113148000-113148022 ATGAAGGGCGAGAGACAGGAGGG - Intergenic
913125525 1:115784148-115784170 CTGAAAGAGCAGAGAGAGGAGGG + Intergenic
913507134 1:119527158-119527180 ATGAGTGAGCAGAAGCAGGGTGG - Intergenic
914250326 1:145917132-145917154 TTTAAAGAGCAGAAACAGGCTGG + Intronic
916033132 1:160895885-160895907 ATGAAAGTGTTGAAACAGGATGG + Intergenic
916368192 1:164057778-164057800 ATGAATGAGAAGAAAGAGGAAGG - Intergenic
916490812 1:165300824-165300846 ATGAATGAGGAGAAGCAGGCAGG - Intronic
916524669 1:165598363-165598385 GTTAGGGTGCAGAAACAGGACGG + Intergenic
917175084 1:172225114-172225136 AAGAGGAAGAAGAAACAGGAGGG - Intronic
917448491 1:175126839-175126861 AAGAAGGAGGAGAAATGGGAGGG + Intronic
917469583 1:175314983-175315005 ATGAAAGCACAGAAACAGGGCGG + Intergenic
917521429 1:175751127-175751149 AGGGAGGAGCAGAACCAGGCTGG - Intergenic
918083776 1:181227988-181228010 ATGAAGAAGGAGAAATGGGATGG - Intergenic
918202358 1:182279351-182279373 ATGAACTAGAAGGAACAGGAGGG + Intergenic
918670450 1:187208281-187208303 ATGAATGAACAGAAAAAGGATGG + Intergenic
919588229 1:199465551-199465573 ATGAAGGAAGAGAGACAGGAGGG + Intergenic
919751037 1:201038407-201038429 ATGAGACAGCAGAAACAGGTGGG + Intergenic
920696283 1:208183487-208183509 ATGAAGGGGCAGAGATGGGAGGG + Intronic
921289598 1:213645190-213645212 ATGACGGAGCAGAAAGAGGTGGG + Intergenic
921303302 1:213771046-213771068 AAGAAGGGAGAGAAACAGGAAGG - Intergenic
921418584 1:214919808-214919830 ATGGAGAAGGAGAATCAGGAAGG - Intergenic
921557086 1:216611900-216611922 ATGAAGAAGCAGAAATATGGAGG + Intronic
921887507 1:220321549-220321571 AGGAAGGAGGAGGAAGAGGAGGG + Intergenic
922175752 1:223195754-223195776 ATAAAGCACCAGAAACAGGATGG + Intergenic
922662972 1:227446486-227446508 TAGAAGGAGTAGAAGCAGGAGGG + Intergenic
923293285 1:232568241-232568263 ATGAAGCAGCAGAGAAAGGAAGG + Intergenic
923294825 1:232583881-232583903 ATGAGAGACCAGAGACAGGAGGG - Intergenic
923475302 1:234326086-234326108 AGGAAGGAGCAGGAGGAGGATGG + Intergenic
923522961 1:234750296-234750318 AGAAAGGAGCAGAGACATGAAGG - Intergenic
924014462 1:239705383-239705405 ATAAAGTAGCAGAGACTGGAAGG + Intronic
1062952748 10:1516946-1516968 CTGAAGTAGCAGAAAAGGGATGG + Intronic
1063034308 10:2270273-2270295 AGGAAGGATCAGAGACAGGGTGG + Intergenic
1063246090 10:4220281-4220303 ATGCTGGGGCAGAAAAAGGAAGG - Intergenic
1064272669 10:13879659-13879681 AAGAAGGAGGAGGAAGAGGAAGG - Intronic
1064944264 10:20770680-20770702 ATGAAGAAACAGAACAAGGAAGG - Intergenic
1065173843 10:23057898-23057920 AGGAAACAGCAGAAGCAGGAAGG - Intergenic
1065199893 10:23302421-23302443 ATGAAGAGGCAGAGACAGGGTGG - Intronic
1065766642 10:29036543-29036565 CAGAAGGAACAGAAGCAGGAAGG + Intergenic
1066011574 10:31199145-31199167 GAGAAGGAGGAGAAAGAGGAAGG - Intergenic
1066221861 10:33343054-33343076 AGGAAGGAGGAGGAAGAGGAGGG + Intergenic
1067719769 10:48719610-48719632 GTAAATGAGGAGAAACAGGAGGG + Intronic
1067894683 10:50166077-50166099 CTGAAGGAGGAGCAACTGGAGGG - Intergenic
1067954158 10:50774185-50774207 CTGAAGGAGGAGCAACTGGAGGG + Intronic
1068299186 10:55116737-55116759 AAGAAACAGCAGAAGCAGGAAGG + Intronic
1068467400 10:57412597-57412619 ATGTTGGAGCTGAAACCGGAAGG - Intergenic
1068911212 10:62380290-62380312 AAGGAGGAGGAGAAACAGAAGGG - Intronic
1069040156 10:63687444-63687466 AGGAAACAGCAGAAGCAGGAAGG - Intergenic
1069277892 10:66615454-66615476 AAGAAGAAGGAGACACAGGAAGG + Intronic
1069588872 10:69630023-69630045 AAGAAGGAGAAGAAGGAGGAGGG - Intergenic
1069968435 10:72142771-72142793 ACGAAGTATCAGGAACAGGAGGG - Intronic
1070313072 10:75287702-75287724 ATGGAGCAGCAGAATGAGGAGGG - Intergenic
1070326106 10:75390333-75390355 GTGAAGGAGGAGGAAGAGGAGGG - Intergenic
1070385633 10:75921836-75921858 AGGAAGGATCAGAAGGAGGAAGG - Intronic
1070530730 10:77335122-77335144 AGGAAAGAGCAGGAAAAGGAGGG - Intronic
1071742644 10:88378331-88378353 ATGAGTGGCCAGAAACAGGATGG - Intronic
1072005939 10:91247571-91247593 ATGAAGGAGATGAGGCAGGAAGG + Intronic
1072854937 10:98936579-98936601 AGGGAAGAGCAGAAACAGGGTGG - Intronic
1073209170 10:101784385-101784407 ATGAAAGAGGAGAAAAGGGAGGG + Intergenic
1074524596 10:114252893-114252915 ATGAAGGAACACAAGCAGGCCGG - Intronic
1075499606 10:122960938-122960960 ATAAGTGAGCAGAAACAGCAAGG - Intronic
1075689918 10:124387788-124387810 AGGAAACAGCAGAAACAGAAAGG + Intergenic
1075859303 10:125661235-125661257 GAGATGGAGCAGACACAGGAGGG + Intronic
1075924136 10:126236590-126236612 AGGAAGGAGCACTCACAGGAAGG + Intronic
1075924138 10:126236606-126236628 AGGAAGGAGCACCCACAGGAAGG + Intronic
1075924142 10:126236622-126236644 AGGAAGGAGCACTCACAGGAAGG + Intronic
1075924159 10:126236734-126236756 AGGAAGGAGCACCTACAGGAAGG + Intronic
1076040320 10:127241983-127242005 AGGAAGGCCCAGAAACTGGAGGG - Intronic
1076064435 10:127438188-127438210 TTCTAGGACCAGAAACAGGATGG + Intronic
1076831842 10:132999338-132999360 ATGGAGGTGGAGAGACAGGAGGG - Intergenic
1076831855 10:132999382-132999404 ATGGAGGTGGAGAGACAGGAGGG - Intergenic
1076831868 10:132999426-132999448 ATGGAGGTGGAGAAACAGGAGGG - Intergenic
1076831881 10:132999470-132999492 ATGGAGGTGGAGAGACAGGAGGG - Intergenic
1076831894 10:132999514-132999536 ATGGAGGTGGAGAAACAGGAGGG - Intergenic
1076831907 10:132999558-132999580 ATGGAGGTGGAGAGACAGGAGGG - Intergenic
1076831920 10:132999602-132999624 ATGGAGGTGGAGAAACAGGAGGG - Intergenic
1076850946 10:133092728-133092750 ATGAAGAAGGAGAAATAGGGAGG + Intronic
1077477826 11:2798897-2798919 CTGGAGGAGCAGGAACAGGACGG + Intronic
1077608584 11:3628818-3628840 ATGCAGGGGCAGAGGCAGGATGG + Intergenic
1077731746 11:4738217-4738239 TTGCAGAAGCAGACACAGGAAGG - Intronic
1078125741 11:8561144-8561166 ATGAAGAAGCAGAGATAGGAAGG - Intronic
1079745679 11:24125830-24125852 ATGAGGGAGCAGAAAGATGAAGG + Intergenic
1079914161 11:26347733-26347755 ATGAAAGAGCAATTACAGGAAGG + Intronic
1080050209 11:27851852-27851874 AGGAAGGAGAAGGAAAAGGAAGG - Intergenic
1080103632 11:28488701-28488723 TTAAAGGACCAGAAACAGAAGGG - Intergenic
1080683554 11:34497055-34497077 TTGAAGAATCAGAAAGAGGATGG + Intronic
1080738884 11:35045199-35045221 AAGAAGGTGCTGAAAGAGGATGG + Intergenic
1081451730 11:43177342-43177364 AGGAAGGAACAGATATAGGATGG - Intergenic
1081581933 11:44358534-44358556 ATGAAGGAGAAGGAAAAGGATGG - Intergenic
1081929504 11:46858939-46858961 ATAAAGGAGAAGGAACAGGCAGG + Exonic
1082176283 11:49063802-49063824 GAGAAGGAGGAGAAAGAGGAGGG + Intergenic
1082672422 11:56051863-56051885 AGGCAAGAGCAGAAACAGGGAGG - Intergenic
1082958782 11:58899553-58899575 AAAAAGGAGAGGAAACAGGAAGG + Intronic
1083263659 11:61536368-61536390 GTGAGGGAGCAGAAGCAGGCTGG - Intronic
1083285685 11:61657226-61657248 ATGAAGGAGAAATAAAAGGAGGG + Intergenic
1083583656 11:63840622-63840644 GTGAGGGTGGAGAAACAGGAAGG - Intronic
1084041234 11:66543828-66543850 ATGAAGCAGCAGGCACAGGAAGG + Exonic
1084532137 11:69733622-69733644 AGGAAGGAGGAAAAAAAGGAAGG + Intergenic
1085442017 11:76573899-76573921 AAGAAGGAGGAGAAAGAGAATGG - Intergenic
1086212304 11:84335247-84335269 ATGAAGGAACAGAGGGAGGAAGG + Intronic
1086505945 11:87504379-87504401 CTGAAGGGGCAAAAACTGGAAGG - Intergenic
1086673554 11:89575751-89575773 ATGAAGTAGAAGAAAGAAGAAGG - Intergenic
1086689435 11:89772064-89772086 GAGAAGGAGGAGAAAGAGGAGGG - Intergenic
1086716422 11:90067890-90067912 GAGAAGGAGGAGAAAGAGGAGGG + Intergenic
1086825525 11:91490363-91490385 AGGAAGGAGCAGAAAGAGGAAGG - Intergenic
1086850726 11:91804364-91804386 GTGACACAGCAGAAACAGGAGGG + Intergenic
1087126726 11:94635205-94635227 AAGAAGCAGCAGACACAGCATGG - Intergenic
1087702335 11:101449474-101449496 AAGAAACAGCAGAAGCAGGAAGG + Intergenic
1087897394 11:103601871-103601893 AGAAAACAGCAGAAACAGGAAGG - Intergenic
1089126017 11:116177142-116177164 AAGATGTAGCAGAAAGAGGAGGG + Intergenic
1089436983 11:118477214-118477236 ATGAAGGAGCAGGGGAAGGAAGG + Intronic
1089919767 11:122197601-122197623 ATGAGGGAGGTAAAACAGGATGG - Intergenic
1089980798 11:122770708-122770730 ATGCAGGAGTAGAAACAAGTTGG - Intronic
1090345684 11:126068339-126068361 AAGAAGAAGCAGAAACACAAGGG + Intergenic
1090446729 11:126770806-126770828 TGGAAGGGGCAGAAAGAGGAAGG + Intronic
1090726937 11:129536337-129536359 ATGAGGGTGAAGAGACAGGATGG + Intergenic
1090767527 11:129889505-129889527 AAGAGTGAGAAGAAACAGGATGG + Intronic
1091182099 11:133614607-133614629 AATAAGGAGCAGGAACAAGAAGG + Intergenic
1091443661 12:530643-530665 ATGAAGAAACAGAAACAGAAAGG - Intronic
1091794139 12:3287738-3287760 AAGAATGAGCAGAGACAGGGTGG - Intergenic
1091796585 12:3300788-3300810 ATGGAGGAGCAGAGACTGCATGG + Intergenic
1092227468 12:6757185-6757207 AGGAAGGAAAAGAAAAAGGAAGG - Intronic
1092387446 12:8047081-8047103 GGTAAGGAGCAGAGACAGGATGG - Intronic
1092631171 12:10379765-10379787 ATGAAGCAGCAGAAAAAAAATGG + Exonic
1093051094 12:14505934-14505956 ATGAGGAAACAGAAACATGACGG + Intronic
1093262525 12:16956962-16956984 ATGAAGGAAGTGAAAAAGGAAGG - Intergenic
1093861783 12:24174907-24174929 AGAAAAGTGCAGAAACAGGAAGG + Intergenic
1093977842 12:25442100-25442122 ATGAAGGAGCAGGAATATGAGGG - Intronic
1094246924 12:28308858-28308880 ATGAAGGAAAAGAACAAGGATGG - Intronic
1094381217 12:29845297-29845319 ATGAAGAAACTGAAACAGAAAGG + Intergenic
1094688136 12:32740951-32740973 ATGAAGGAGAAGATGCAGTAGGG - Intronic
1095779866 12:46047860-46047882 ATGTAGTAAAAGAAACAGGAGGG + Intergenic
1095923646 12:47556731-47556753 ATTAAGGAGCACAAACACTAAGG - Intergenic
1096122432 12:49097031-49097053 ATGAAGGGGAAGGAAAAGGATGG + Exonic
1097098838 12:56571749-56571771 ATGGATGAGCAGGAACTGGAGGG + Exonic
1097365369 12:58706430-58706452 CTGAATGGGCAAAAACAGGAAGG - Intronic
1098341939 12:69460680-69460702 ATGAAGGAGAAGAGAAAGGATGG + Intergenic
1098622072 12:72613758-72613780 GAGAAGGAGCAGAAGGAGGAGGG + Intronic
1098630174 12:72713341-72713363 AAGAAGGAGGAGAAGAAGGAAGG + Intergenic
1098895304 12:76053279-76053301 AAGAAGAAGCAGAAACACAAGGG - Exonic
1099746537 12:86711233-86711255 ATGTAGGAAGAGAAACAGTATGG + Intronic
1099850841 12:88094851-88094873 ATGAAGCTGGAAAAACAGGAGGG - Intronic
1100420135 12:94424511-94424533 ATGGATGAGCAGGAACTGGAGGG - Intronic
1100550727 12:95644333-95644355 AGGAAGGAGAAGAAGGAGGAAGG - Intergenic
1100760230 12:97798963-97798985 AATTAGGAGGAGAAACAGGAAGG + Intergenic
1101037017 12:100716556-100716578 ATGAAGCAGGGGAAAGAGGAAGG - Intergenic
1101229990 12:102731038-102731060 AAGACGGATCAGGAACAGGATGG - Intergenic
1101581728 12:106047922-106047944 ATGAGGGAACAGAAATAGGAAGG - Intergenic
1101800929 12:108021499-108021521 ATGAAGGAGCAGGAGGAGGAAGG - Intergenic
1101866586 12:108524873-108524895 GTGAAGGCACAGAAACACGAGGG - Intronic
1102210719 12:111124997-111125019 ATGAGGGACCAGAGACAGGAGGG + Intronic
1102364739 12:112322518-112322540 ATTACGAAGGAGAAACAGGAAGG + Intronic
1102487307 12:113266940-113266962 ATGAAGAAGGAGAAACAGGAAGG - Intronic
1102966935 12:117135151-117135173 ATTCAGGAGCAGAGGCAGGAGGG - Intergenic
1103245755 12:119455824-119455846 AGGAAGGAGAAGAAGAAGGAAGG + Intronic
1103480856 12:121248902-121248924 ATGAAGACGGAGAGACAGGACGG + Intronic
1104188865 12:126458632-126458654 ATTAAGGAGCAGAAGCAGTGTGG - Intergenic
1104196909 12:126549085-126549107 ATGAAGGAGGAGAAGAAGGATGG + Intergenic
1104316190 12:127704214-127704236 AAGAAGCAGAAGAAACAAGAAGG + Intergenic
1104316195 12:127704249-127704271 AGGAAGCAGAAGAAACAAGAAGG + Intergenic
1104820278 12:131673061-131673083 ATGAAGGAGGAGGAGGAGGAGGG + Intergenic
1105887391 13:24653505-24653527 ATCAAGGAGGAAAACCAGGAGGG + Intergenic
1106112979 13:26793064-26793086 AGGAAACAGCAGAAGCAGGAGGG + Intergenic
1106195622 13:27491718-27491740 AGGAAGAGGAAGAAACAGGAGGG + Intergenic
1106654388 13:31726630-31726652 ATGAGGTAGCAGCAACAGCAAGG + Intergenic
1106850006 13:33780233-33780255 ATAAAGGAGAAGAAAAAGAAGGG + Intergenic
1106976789 13:35227777-35227799 ATGAAGTAGCACAAACATAAGGG + Intronic
1107668587 13:42718680-42718702 AAGAAGGAGGAGAAAGAAGAGGG + Intergenic
1108006108 13:45948312-45948334 ATGAAGAAGCAGCAGCAAGAGGG - Intergenic
1108173121 13:47764269-47764291 AAGAAGAAGCAGAAACACAAGGG + Intergenic
1108256205 13:48613375-48613397 AGGAAGAGTCAGAAACAGGAGGG + Intergenic
1108934812 13:55870923-55870945 ATGAATGAGCGGTAACATGAAGG - Intergenic
1109066134 13:57694866-57694888 ATCAAGGATCTGAATCAGGATGG + Intronic
1109113179 13:58349425-58349447 ATGAAAGAGAAGAAAAAGGTAGG + Intergenic
1109344247 13:61095789-61095811 ATGATGGACAAGAGACAGGAGGG - Intergenic
1109897202 13:68708757-68708779 ATGACCTAGAAGAAACAGGAAGG - Intergenic
1109918508 13:69023817-69023839 AAGAAGTAGTAGAAACAGGAAGG - Intergenic
1110387793 13:74934893-74934915 CTGAATGGGCAAAAACAGGAAGG + Intergenic
1110471002 13:75860470-75860492 ATGAAGGAACAGAGACTTGATGG + Intergenic
1111616087 13:90663424-90663446 ATGAAGTAACCGAAGCAGGAAGG - Intergenic
1111780387 13:92716238-92716260 AGGAAGTAGCAGAAAATGGAGGG - Intronic
1112029912 13:95447618-95447640 GTGAAGGAGCTGAAGCAGGGAGG - Intronic
1112199474 13:97261071-97261093 ATCAAGGAGAAGAAAAAGGCAGG - Intronic
1112995406 13:105568583-105568605 ATGAGGAAGCAGAAACAGTAGGG + Intergenic
1113883426 13:113642743-113642765 ATGAAGGAGAAGAGAAAGAAAGG + Intergenic
1114050944 14:18919485-18919507 ATGGAGGGGGAGAAACAGGGTGG - Intergenic
1114111615 14:19482437-19482459 ATGGAGGGGGAGAAACAGGGTGG + Intergenic
1114254401 14:20989316-20989338 ACGTAGCAGCAGACACAGGAGGG + Intergenic
1114276139 14:21146770-21146792 AAGAAGGAGCAGACTCAGAAAGG + Intergenic
1115577517 14:34725549-34725571 ATGATGGAGCAGAAAGAGAGAGG + Intergenic
1116255846 14:42554274-42554296 AGGAAGGAGGAGAAGAAGGAAGG + Intergenic
1116578952 14:46613373-46613395 ATCAAAGAGCAGACACAGCATGG - Intergenic
1116645799 14:47527399-47527421 TGGAAGGAGTAGAAAAAGGAAGG + Intronic
1116899450 14:50347839-50347861 ACAGAGGAGCAGAAAGAGGAAGG + Intronic
1117033700 14:51704629-51704651 AGGGAGGAGCAGAAACAGAAGGG + Intronic
1117291013 14:54332873-54332895 ATGAAGCAACAGTAACGGGAAGG - Intergenic
1117313976 14:54556146-54556168 ATGAGAGAGCAAAAACAGGTTGG + Intergenic
1118062878 14:62160174-62160196 AGGCAGGAGCAGAACCAGGGAGG - Intergenic
1118463586 14:66010562-66010584 ACTAAGCAGCTGAAACAGGATGG - Intergenic
1119531886 14:75367557-75367579 ATGAAGAAGGAAAAAAAGGAAGG + Intergenic
1119568575 14:75649855-75649877 AGGAGGGAGCAGCAACTGGAAGG - Exonic
1119631668 14:76237482-76237504 AGGCAGGAGCAGAAAGGGGAAGG - Intronic
1119925383 14:78488764-78488786 ATGAAGAAGAAGAAAGGGGAGGG + Intronic
1120182202 14:81355186-81355208 AAGAAGGAGAAGAAAGAGAAAGG + Intronic
1120367610 14:83590966-83590988 ATGAGGGGCCAGAGACAGGAGGG - Intergenic
1121272414 14:92646833-92646855 ATTAAGGAAAAGAAACTGGAAGG - Intronic
1121342148 14:93111831-93111853 AGAAAGGGGAAGAAACAGGATGG + Intronic
1121638326 14:95468630-95468652 AGGAAGGAGCAGGGTCAGGAGGG - Intronic
1121685419 14:95831873-95831895 ATGGAGGTGCAGAGACAGAAGGG - Intergenic
1121735714 14:96216701-96216723 AGGAAGGAGGAGGAAGAGGAAGG + Intronic
1121861669 14:97324433-97324455 CTGAATCAGCAGAAACAGGAAGG - Intergenic
1122436007 14:101699715-101699737 ATGAAGTAACAAAAACAGGATGG + Intergenic
1123695039 15:22872978-22873000 AACAAGAAGCAGAAACAGAATGG + Intronic
1123792337 15:23734330-23734352 AAGAAGGAGAAGAAAGAAGAAGG + Intergenic
1123945342 15:25236276-25236298 ACGAAGGAGCAGAGACAGGTTGG - Intergenic
1124073348 15:26416218-26416240 CAGAAGGAGCAGAAAGAGAATGG + Intergenic
1124232264 15:27955817-27955839 CTGAAGGGGCTGAAACAGGCGGG - Intronic
1124596892 15:31098750-31098772 CTGGGGGAGCAGACACAGGATGG + Intronic
1125036765 15:35134317-35134339 AGGAAGGAAGAGAAAGAGGAAGG - Intergenic
1125354174 15:38799565-38799587 CTGAAGCAGCAAAAACTGGAAGG - Intergenic
1126146364 15:45476440-45476462 ATAAAGAAGCAAAAAGAGGATGG + Intergenic
1126922022 15:53537540-53537562 ATGAAGAAACAGAGACAGAAAGG - Intronic
1127556022 15:60088532-60088554 ATGAAGGGCCAGTCACAGGAAGG + Intergenic
1127591065 15:60424105-60424127 CTGAAGGACAAGAAAAAGGAAGG + Intronic
1127629277 15:60811559-60811581 ATGAAGGAGCTTAGACAGAATGG - Intronic
1127931555 15:63600502-63600524 GTGCAGGGGCAGAAAGAGGAGGG + Intronic
1128130257 15:65222544-65222566 GTGAAGTAGCAGAAAGATGAAGG - Intergenic
1129191818 15:73941913-73941935 GTGGAGGGGCAGGAACAGGACGG + Intronic
1129658829 15:77541920-77541942 AAGAAGGAGGAGAAAAAGAAGGG - Intergenic
1129831927 15:78676284-78676306 GTGGAGGAAGAGAAACAGGAGGG + Intronic
1130691498 15:86085354-86085376 ATGAAGGGGAAGAAATAAGATGG + Intergenic
1131063457 15:89418371-89418393 ATGAGGGAGCAAAAAGAGAAGGG + Intergenic
1131351193 15:91701424-91701446 ATGAAGGAGGAGAGGAAGGAAGG + Intergenic
1131877470 15:96825803-96825825 AAGCAGCAGCAGAAGCAGGATGG - Intergenic
1131901070 15:97088539-97088561 ATGAAGGAGGAGGAGGAGGAAGG - Intergenic
1132571026 16:644043-644065 AAGAAGGTGCAGGAGCAGGATGG - Intronic
1133194424 16:4158832-4158854 AAGGAGGAGAAGAAAGAGGAAGG + Intergenic
1133802041 16:9092045-9092067 ATGGAGGAGCGGAAGGAGGAGGG + Exonic
1133959461 16:10480384-10480406 GGGAAGGAGGAGAAACAGAAAGG - Intronic
1134853080 16:17497947-17497969 ATCAAGGAGCAGAAACAGCTTGG - Intergenic
1135177330 16:20242237-20242259 ATGAATGAGCTGAAAATGGAAGG - Intergenic
1135295730 16:21278009-21278031 AAGGAGGAGCAGGAAGAGGAGGG - Intronic
1135784104 16:25332565-25332587 TAGAAGGAACAGAGACAGGAAGG - Intergenic
1136170586 16:28486879-28486901 ATGAAGGGGCAGAGACATCAAGG - Intronic
1136491884 16:30613936-30613958 AGGAAGGAGAAGAAAGAAGAAGG + Intronic
1137930123 16:52579010-52579032 AGGAAGGAGCAGAAAGGAGAGGG + Intergenic
1138293872 16:55870396-55870418 AAGAAGGAAGAGAAAGAGGAAGG + Intronic
1138436208 16:57001411-57001433 CTCAAGAGGCAGAAACAGGATGG + Intronic
1138877642 16:60972177-60972199 AAGAAGGAGGAGAAAAAAGAAGG - Intergenic
1138894232 16:61183469-61183491 ATGAGGCACCAGAGACAGGAGGG + Intergenic
1139364471 16:66425516-66425538 ATGAAGGATCAGAGAAAGGAGGG - Intergenic
1141223018 16:82089465-82089487 ATGAAGGAGCAAAGACAGTAGGG - Intronic
1141332735 16:83126959-83126981 ATGAAGGAGTAGAGGGAGGAGGG + Intronic
1141525911 16:84611668-84611690 ATGAAGGAATAAACACAGGAAGG + Intronic
1141585609 16:85031583-85031605 ATGAAGCTGGAGAAACAGGCAGG - Intronic
1141685164 16:85565958-85565980 AGTAAGGAGCAGAGGCAGGATGG - Intergenic
1141898026 16:86971088-86971110 ATCAAGGAGCAGAAGCAAGGTGG + Intergenic
1142243881 16:88959638-88959660 AGGAAGGAGGAGGAAAAGGAGGG - Intronic
1143890031 17:10095943-10095965 AGGAATGAGGAGGAACAGGAAGG - Intronic
1143941313 17:10545200-10545222 ATGAAGGAGAAGGTCCAGGAAGG - Intronic
1144152539 17:12463993-12464015 AAGATGGAGGAGAAACAGAAGGG - Intergenic
1144262610 17:13537405-13537427 ATGGAGGAGCTGAGAAAGGAAGG - Intronic
1144562202 17:16330038-16330060 CAGAAGGAGCAAAAGCAGGAAGG + Intronic
1144580079 17:16453787-16453809 AAGAAGGGCCAGAGACAGGAGGG - Intronic
1147112692 17:38275243-38275265 ATGAAGAAACTGAAACAGCAAGG - Intergenic
1147406339 17:40215082-40215104 ATGAAGAAACAGACACAGCAAGG - Intergenic
1147422991 17:40331837-40331859 TTGAAGGAGCAGACCGAGGAAGG + Intronic
1147663485 17:42130087-42130109 AAGAAGGGGCAGAAACAGGATGG + Intronic
1147780238 17:42935694-42935716 ATTAAGAAACAGAAACAGGCTGG - Intergenic
1148255799 17:46130791-46130813 ATGAGGGAGGGGAAAGAGGAGGG - Intronic
1148698775 17:49576139-49576161 CTGAAGGAGCAGGAAGGGGAAGG + Exonic
1149341331 17:55689261-55689283 ATGAAGGAACTGAAAGTGGATGG - Intergenic
1150986907 17:70208489-70208511 ATGTTGGAGCACAAACAGAACGG - Intergenic
1151542644 17:74772547-74772569 ATGAAGGAGCAGAAACAGGAGGG + Intronic
1151815876 17:76471167-76471189 AGGTAGGAGGAGAAAGAGGAAGG + Exonic
1151978240 17:77494327-77494349 ATGAAGGGACAGAGAGAGGAAGG - Intronic
1152052003 17:77986794-77986816 ACAAATGAGCAGAGACAGGAAGG + Intergenic
1152072645 17:78141598-78141620 GTGAAGGAAGAGTAACAGGAAGG - Exonic
1152221762 17:79072636-79072658 ATGAAGGAGGAGGCAGAGGAAGG + Intergenic
1152261582 17:79270103-79270125 AGGACGGAGGAGAACCAGGAGGG - Intronic
1152696541 17:81800511-81800533 ATGCAGGAAGGGAAACAGGAGGG - Intergenic
1153177051 18:2387820-2387842 ATGAAGAAGCAGAAAAAAGAAGG + Intergenic
1153326618 18:3827040-3827062 AAGAAGGAGTAGACTCAGGATGG + Intronic
1153359879 18:4182231-4182253 AAGAACAAGCAGAAGCAGGAAGG + Intronic
1153572873 18:6491102-6491124 AAGAAGGAGGAGGAACAGGAAGG - Intergenic
1153588915 18:6652712-6652734 ATGAGGGAGTAGGAACTGGATGG + Intergenic
1153599106 18:6761611-6761633 ACCAAGGATCAGAATCAGGAAGG + Intronic
1153989555 18:10384456-10384478 AGGAAGGTGCAGAAATGGGAGGG - Intergenic
1154964957 18:21347397-21347419 AAGGAGCAGCAGAAGCAGGAAGG - Intronic
1155416069 18:25601236-25601258 AGGAAAGAGTAGAAGCAGGAAGG - Intergenic
1155865799 18:30963426-30963448 AGGAACCAGCAGAAGCAGGAAGG - Intergenic
1155896682 18:31337880-31337902 AAGGAGGAGCAGAAACAGGGGGG + Intronic
1156036919 18:32774301-32774323 AAAAAGAAGCAGAAAAAGGAAGG + Exonic
1156661998 18:39357273-39357295 ATTAAAGAGCATAAACAGAATGG - Intergenic
1156966890 18:43105435-43105457 AGGAAGGAACAAAAAAAGGAAGG + Intronic
1157531286 18:48423080-48423102 GGGAAGGAGGAGAAACTGGAGGG - Intergenic
1157728412 18:49983277-49983299 ATGGAGGACCAGAACCAGAAAGG - Intronic
1158872769 18:61704646-61704668 ATGAGGGATGAGAGACAGGAGGG - Intergenic
1158991979 18:62878370-62878392 ATGAAGTAGCAGAGAGAGGGAGG - Intronic
1159137757 18:64356998-64357020 ATGAAGTAGCATAGACTGGATGG + Intergenic
1159473552 18:68888228-68888250 ATGAATGAGCACAAAGAGAAGGG + Intronic
1159600824 18:70427196-70427218 AGGAAGAAGCAGATAAAGGAAGG - Intergenic
1159780604 18:72656406-72656428 ATGAAGTTGTAGAAACTGGAAGG - Intergenic
1160912347 19:1480591-1480613 AGGAAGGAGAAGAAAAAGGAAGG + Intergenic
1161019073 19:1999368-1999390 TGGAAGGAGGAGAAACAGGCCGG + Intronic
1161788856 19:6346464-6346486 AAGAAGGAGGAGGAAGAGGAGGG - Intergenic
1162805612 19:13136564-13136586 ATGGAGGAGCTGATACAGCAAGG + Intronic
1163075961 19:14891872-14891894 TTCAGAGAGCAGAAACAGGAGGG - Intergenic
1163912233 19:20206520-20206542 TTGAAGAAGTAGAATCAGGAAGG + Intergenic
1164441853 19:28284985-28285007 ATGAAGGAGAAGAAGGAGGATGG + Intergenic
1164535601 19:29084558-29084580 AAGAAGTAGCTGAAAGAGGAAGG + Intergenic
1164856322 19:31527454-31527476 ATGAAGGAAGGGAAACAGAAGGG + Intergenic
1165451185 19:35884335-35884357 ATGAAGATGCAGTAAGAGGATGG - Intergenic
1165460956 19:35944206-35944228 AAGAAAGAAAAGAAACAGGATGG + Intronic
1165478596 19:36047524-36047546 ATGACAGAGCAGAAAGAGGCCGG + Intronic
1165834257 19:38744596-38744618 CTGATGGAGAAGAAACATGAAGG - Intronic
1165950349 19:39470827-39470849 AGGAAGGAGCAAAGGCAGGAGGG - Intronic
1166104253 19:40589688-40589710 AGGAAGGAGCAGAAGAAAGAAGG + Intronic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166273369 19:41732987-41733009 ATGAAGGAGCAGATGGATGAGGG - Intronic
1166371409 19:42303250-42303272 AAGAAGGTGCAGAAAGAGAAAGG + Intronic
1166886632 19:45965223-45965245 TTGAAGAAGCAGAGAGAGGACGG - Intronic
1166981888 19:46635868-46635890 AGGAAGGAGCAGAGACACCAAGG + Intergenic
1167660924 19:50795584-50795606 CTGTAGAAGCTGAAACAGGAGGG - Intergenic
1168000565 19:53442620-53442642 AGGAAGGAGCAGCAGCAGGGTGG - Intronic
1168005060 19:53480104-53480126 AGGAAGGAGCAGCAGCAGGGTGG - Intronic
1168161525 19:54513313-54513335 TTGAGGGAGCAGAGAGAGGAAGG + Intergenic
925333484 2:3076326-3076348 ATTAAGGAGCATAATCAGGAGGG + Intergenic
925570314 2:5303469-5303491 ATGATGGTGCAGAGCCAGGAAGG + Intergenic
925590386 2:5503383-5503405 AGAAAACAGCAGAAACAGGAAGG + Intergenic
925842588 2:8006566-8006588 ATGGAGGAGAAGAGAGAGGAGGG - Intergenic
925852963 2:8101040-8101062 TTGAAGAAGCAGAAAGAGCAAGG - Intergenic
926266880 2:11331001-11331023 AGGAAGGAGCAGAAAGAAGGAGG + Intronic
926394847 2:12430403-12430425 AGGAAGGAGAAGAAGGAGGAAGG + Intergenic
926417043 2:12659847-12659869 CAGAATGAGCAGAAACAGGTTGG - Intergenic
926456994 2:13079295-13079317 ATGAAAGAGCAGACACAGAAGGG + Intergenic
926558302 2:14386558-14386580 CAGAAGGAGGAGAAGCAGGAGGG + Intergenic
926574461 2:14564705-14564727 CTCAAGAAGAAGAAACAGGAGGG + Intergenic
927205584 2:20608276-20608298 TAGAAGTAGCAGAAACAGGCCGG + Intronic
927339830 2:21970585-21970607 CAGAAGCAGCAGAAAAAGGATGG + Intergenic
927360970 2:22232990-22233012 ATGAAAAAGCAGAAACAGAAAGG + Intergenic
927850253 2:26494367-26494389 ATGAAGGAGCCGAGCCAAGAGGG + Intronic
928295930 2:30083983-30084005 ATGAGGGTGCAGGTACAGGAGGG + Intergenic
928401124 2:30979459-30979481 ATCAAGGAGGAGAGACAGGGAGG + Intronic
928901074 2:36318002-36318024 ATGAAAGACCAGAAACAAGTTGG - Intergenic
929137451 2:38638054-38638076 AGGAAAGAGAAGAGACAGGAGGG + Intergenic
929246742 2:39710463-39710485 AGGAAGGAGAAGAAAGGGGAGGG + Intronic
929334251 2:40721634-40721656 ATGAGGGACAAGAGACAGGAAGG - Intergenic
930510254 2:52335492-52335514 AAGAAGGAGCAGAAGCAGGAAGG - Intergenic
933996933 2:87677014-87677036 ATGAAGGCACAGAAGCAAGACGG + Intergenic
934035757 2:88087436-88087458 ATGATGGAGAAGTAGCAGGAAGG - Intronic
934586167 2:95498051-95498073 GAGAAGGAGGAGAAAGAGGAGGG - Intergenic
934589189 2:95530950-95530972 ATGTAGGAGCTGACACAGCACGG - Intergenic
934729005 2:96644549-96644571 ATGTAGGTGGAGATACAGGACGG + Intergenic
935058984 2:99592088-99592110 ATGAAGATACAGTAACAGGAGGG + Intronic
935072624 2:99709002-99709024 AAGAAGGAAGAGAAACAGAAGGG + Intronic
935100719 2:99992990-99993012 AAGAAGGAACAGAAAGGGGAGGG - Intronic
935133840 2:100281018-100281040 AAGAAGGAGAAGAAACAGATGGG + Exonic
935239034 2:101162199-101162221 ATGAGGGAGCAGAACTAGGCAGG + Intronic
935287498 2:101578550-101578572 AGGAAGGAGAAGGAAAAGGAAGG + Intergenic
935287554 2:101578931-101578953 AGGAAGGAGAAGGAAAAGGAAGG + Intergenic
935287558 2:101578951-101578973 AGGAAGGAGAAGGAAAAGGAAGG + Intergenic
935416066 2:102820745-102820767 ATGAAGTTGGAGAAGCAGGAAGG + Intronic
935854977 2:107263944-107263966 ATGAGGAAGCAGAGACTGGAGGG - Intergenic
936019719 2:108985633-108985655 AGGAAGGAGCAGACACATGTGGG - Intronic
936296917 2:111273896-111273918 ATGAAGGCACAGAAGCAAGACGG - Intergenic
936386028 2:112030125-112030147 ATGCAGGAGCAGGAGCAAGAGGG + Intergenic
936553137 2:113468053-113468075 AGGAAGGAGGAGCAACAGGTCGG + Intronic
936689172 2:114865661-114865683 ATGATGGAGAGGGAACAGGAAGG + Intronic
936754210 2:115686079-115686101 GTAAAAGAGCTGAAACAGGAAGG - Intronic
936920505 2:117684056-117684078 ATAAAGGAACAGGATCAGGATGG - Intergenic
936944348 2:117917175-117917197 ATGAGGCAGCAGAAATATGAGGG + Exonic
937278699 2:120702841-120702863 AGGAAGGAGCAGAATGAGGTCGG - Intergenic
937320343 2:120957002-120957024 GTGAAGGAGCAGCCAGAGGAGGG - Intronic
937444084 2:121941936-121941958 AGGAAGGAAAAGAAACAGGGAGG - Intergenic
937637905 2:124177275-124177297 ATGAGGGGCCAGAGACAGGAGGG + Intronic
937920040 2:127122402-127122424 AGGGAGGAGCAGAAATAGGAGGG - Intergenic
938091061 2:128435097-128435119 AGGAAGCAGCAGAAGCAGGAAGG + Intergenic
938255004 2:129850794-129850816 AAGAAGGAGCCCAAAAAGGAAGG + Intergenic
938394105 2:130929348-130929370 ATGGAGGAAGAGAAACTGGATGG - Intronic
938758405 2:134401397-134401419 ATGATGTAGCAGACTCAGGAAGG - Intronic
939024603 2:136997241-136997263 ATGAAAGGGAAGAAAAAGGAGGG - Intronic
939229438 2:139407648-139407670 ATGAAGTAGGAGTAAAAGGAAGG + Intergenic
939335407 2:140820889-140820911 AAGAAGCAACAGAAAGAGGAGGG - Intronic
939861543 2:147426950-147426972 AAAGAGGAGTAGAAACAGGAAGG + Intergenic
940097408 2:149993294-149993316 AGGAAATAGCAGAAGCAGGAAGG - Intergenic
940327343 2:152439543-152439565 ATGAAGGTTCAGAAAAAAGATGG - Intronic
940480645 2:154226122-154226144 ATGAATGAACAGAGACAGGAGGG + Intronic
941231967 2:162921466-162921488 AAGAAAGAGGAGAAAGAGGAAGG + Intergenic
941438543 2:165504250-165504272 ATGAAGGATCAGACGCAAGAGGG - Intronic
941465190 2:165817242-165817264 AAGAAGGAGGAGAAGAAGGAAGG + Intergenic
941575416 2:167224099-167224121 CTGAAGGAGCAAGAACAAGAAGG + Intronic
941950827 2:171154677-171154699 ATGAAGTAGTAGAAGCAGTATGG - Intronic
942087590 2:172457889-172457911 ATGAAGAAGCAGAAAGCAGATGG + Intronic
942229338 2:173845139-173845161 ATGAGGTAGCTGAACCAGGATGG - Intergenic
942235310 2:173898364-173898386 GTGAAGGAACAGAAACCAGATGG + Intergenic
942602189 2:177652700-177652722 ATGAAGGAGAAAAATCATGATGG + Intronic
942745460 2:179226912-179226934 AGGAAGCAGGAGAAAAAGGAAGG + Intronic
943553941 2:189377715-189377737 GTGAAGGAGGAGAAAGTGGAGGG - Intergenic
943649814 2:190445090-190445112 AATAAGGAGCACAAGCAGGATGG - Intronic
944064703 2:195606631-195606653 ATGGAGAAGCAGGAACAAGAAGG + Intronic
944614315 2:201444328-201444350 ATGAGGGAGGAGAAGCAGGCAGG - Intronic
944936279 2:204572302-204572324 TTGAAGGAGGAGGAAAAGGAGGG + Intronic
945028615 2:205642976-205642998 AAAAAGGAGCAAAAATAGGAGGG - Intergenic
945045876 2:205781380-205781402 AGGTAGGAGCAGAAACAGACCGG - Intronic
945199408 2:207266190-207266212 TTAAAGGAACAAAAACAGGAAGG - Intergenic
945775537 2:214102512-214102534 ATGAGGCAGCATAAACTGGAAGG - Intronic
945786781 2:214249399-214249421 AAGAAGGAGAAGGAAGAGGAGGG + Intronic
946017332 2:216614528-216614550 AGGAAGGAGGAGAAAGAAGAAGG - Intergenic
946640022 2:221773983-221774005 ATGGAGGACCAGAAACAGGTAGG - Intergenic
946946084 2:224824359-224824381 ATGCAGGAGTCCAAACAGGAGGG - Intronic
947036879 2:225869141-225869163 ACGAAGGGGAAGAAACAAGATGG - Intergenic
947118285 2:226794784-226794806 ATGTAGGAGCAGCCACAGGAGGG - Intronic
947810894 2:233003348-233003370 AGGAAGGATCAGAAATAGGCTGG - Intronic
947884258 2:233552674-233552696 ATGAAGGGGCAAAAACTGGATGG + Intronic
947900048 2:233713663-233713685 CATAAGGAGCAGAAACAGCATGG - Exonic
948000868 2:234566249-234566271 ATAATGGAACAGAAACGGGACGG - Intergenic
948216143 2:236234312-236234334 CTGAAGGGGCTGAAGCAGGAAGG - Intronic
948422298 2:237867313-237867335 AAGAAGGAGGAGCAAGAGGAGGG + Intronic
948648886 2:239426536-239426558 ATGCCTGAGCAGAAACTGGAAGG - Intergenic
1169427210 20:5505775-5505797 CTTAAGGAGCTGAGACAGGAGGG - Intergenic
1169611810 20:7389313-7389335 ATGAAGGGGGAAAAAAAGGAAGG - Intergenic
1169777652 20:9273600-9273622 GTGAAGGAGGAGGAAGAGGAAGG + Intronic
1170853737 20:20028594-20028616 ATGAAGGCTTAGAAACTGGAAGG - Intronic
1170962241 20:21035768-21035790 ATTGAGGAGCAAAAAGAGGAAGG + Intergenic
1170976995 20:21174028-21174050 AAGAACGAGGAGAACCAGGAGGG + Intronic
1171147241 20:22795601-22795623 CTGAAGAAGCAGACAGAGGAAGG + Intergenic
1171941201 20:31331462-31331484 AAAATGGAGCAGAAAGAGGAAGG + Intergenic
1172227040 20:33311966-33311988 ATAAAGGAGCAGAGAGAAGAAGG - Intergenic
1172517941 20:35548618-35548640 ATGCAGGAGCAGAAGAATGAAGG + Exonic
1172913502 20:38427435-38427457 ATGCAGGAGCAGAAACAGACAGG + Intergenic
1172913723 20:38428800-38428822 ATCAAGGACCAGAGACAGGCAGG - Intergenic
1173096058 20:40029619-40029641 AGGAAGGAACAAAAAGAGGATGG + Intergenic
1173529108 20:43754906-43754928 AGAATGGAGCAGAAACCGGAAGG - Intergenic
1173614374 20:44393217-44393239 ATTCAGGAACATAAACAGGAGGG + Intronic
1174175465 20:48641901-48641923 AGGAAGGAAAAGAAACAGGAGGG + Intronic
1174732937 20:52935883-52935905 TTCTAGGTGCAGAAACAGGAAGG - Intergenic
1174748449 20:53087604-53087626 AAGAAGGATCAGAAACAGACTGG + Intronic
1174783964 20:53415424-53415446 AGGAAGGAGCAGAGACTGTAGGG - Intronic
1174958849 20:55132612-55132634 CTGAAGGGTCAGAAACAGGTGGG - Intergenic
1175159471 20:56997134-56997156 ATGAAGCTGAAGAAAGAGGAAGG + Intergenic
1175459573 20:59142214-59142236 ATGAAGGAGCAGAGCCATGAAGG + Intergenic
1178083486 21:29089928-29089950 AAGAAGGAGGAAAGACAGGAAGG + Intronic
1178202526 21:30423647-30423669 ATGATGGAGGAGAAGGAGGAGGG + Intronic
1178360122 21:31942280-31942302 AGGAAAGGGAAGAAACAGGATGG - Intronic
1180469421 22:15641860-15641882 ATGGAGGGGGAGAAACAGGGTGG - Intergenic
1181284262 22:21740729-21740751 ATGGAGGAGGAGAGAGAGGAAGG - Intergenic
1181323624 22:22027798-22027820 CAGAAGTAGCAGAAACAGGGTGG + Intergenic
1182029533 22:27147005-27147027 AGGAAGGAGGAGATACAGGCTGG - Intergenic
1182099525 22:27648162-27648184 AAGAAGGAGAAGAAGGAGGAGGG + Intergenic
1182178231 22:28315849-28315871 ATGAAGGAGCAGGGACACAAAGG + Intronic
1183111770 22:35654825-35654847 AAGAAGCAGCAGATGCAGGAAGG + Intronic
1183415159 22:37677424-37677446 ATGAATGACCAGACGCAGGAAGG - Intronic
1184124810 22:42479628-42479650 ATGAGGGACCACAGACAGGAGGG - Intergenic
1184295925 22:43525541-43525563 AAGGAGGAGGAGAAAGAGGAAGG - Intergenic
1184485453 22:44775971-44775993 ATGAGTGACCAGAATCAGGAAGG - Intronic
1184525761 22:45021336-45021358 AACAAGGAGAAGAAACAGAAAGG + Intergenic
1184928400 22:47660741-47660763 ATGAAGAAGGAGGAAGAGGAGGG - Intergenic
1184997012 22:48214661-48214683 AAGATGGTGCAGAAACAGGCTGG + Intergenic
1185121039 22:48970276-48970298 ATCAAGGAACAAAAAGAGGATGG - Intergenic
949730223 3:7102644-7102666 CGGAAGGAGAAGAAACAGAATGG - Intronic
950120402 3:10478649-10478671 ATGATGGAGAAGAAAGAGGCAGG - Intronic
950575931 3:13832069-13832091 AAGCAGGAGCAGGAACAGGAGGG - Intronic
951093272 3:18599634-18599656 ATGAAGGAGCAGAAAAGCAAGGG - Intergenic
951580100 3:24153610-24153632 CTGAAGGAGCAAAGACAGGAGGG - Intronic
951738469 3:25894194-25894216 TCCAAGGAGCAGAAAGAGGAAGG + Intergenic
952516944 3:34114011-34114033 ATGAAGAAGAAGAAAAAGAAAGG - Intergenic
953043730 3:39277506-39277528 ATGGAGGAGCTGAACAAGGAGGG - Intronic
953847631 3:46440667-46440689 TAGAAGGAGCAGAAGCAGAAGGG + Intronic
954294175 3:49665004-49665026 ATGTGGGAGGAGAAAAAGGAGGG + Intronic
954367420 3:50154107-50154129 AGGAAAGAGGAGAAAGAGGAGGG + Intergenic
956785343 3:72637614-72637636 ATGAAGGAAATAAAACAGGAAGG - Intergenic
956916882 3:73881039-73881061 AAGCAGCAGTAGAAACAGGAAGG + Intergenic
957179884 3:76862718-76862740 AGAAAAAAGCAGAAACAGGAAGG - Intronic
957191103 3:77010885-77010907 AGGAAGGAGAAGAAAGAGGGAGG - Intronic
957553558 3:81736960-81736982 ATGGAGTAGTAGAAGCAGGAAGG + Intronic
957573289 3:81976712-81976734 AAGAAGGAGGAGAAAGAGGAGGG + Intergenic
957969874 3:87368982-87369004 ATGGAAGATCAGAATCAGGAGGG - Intergenic
958075835 3:88677033-88677055 GAGGAGGAGCAGAAAAAGGAAGG - Intergenic
958682173 3:97344907-97344929 ATGAAGGAACAAAAGAAGGAAGG + Intronic
958880831 3:99667052-99667074 ATGAAGAAACAGATTCAGGAAGG + Intronic
959847392 3:111049705-111049727 ATGAAAGGCCAGAGACAGGAGGG + Intergenic
959989647 3:112616761-112616783 ATGGAGAAGCAGAAGAAGGAGGG - Exonic
960052596 3:113252527-113252549 ATGGAGAAGCAGTAACAGAATGG + Intronic
960174164 3:114497519-114497541 ATGAAAGAGCAGAAAGAAAAGGG - Intronic
960266384 3:115625140-115625162 GAGAAGGAGCAGGAAGAGGATGG + Intronic
960678861 3:120226109-120226131 ATGAAGGGTCACAACCAGGATGG + Intronic
960738499 3:120806392-120806414 AAGAAGCAGCAGAAACACAAGGG + Intergenic
960988994 3:123298396-123298418 GGGAAGGAGCAGTAAGAGGAGGG + Intronic
961464029 3:127070710-127070732 TTATAGGAGCAGAACCAGGACGG - Intergenic
962137783 3:132755823-132755845 AAGAGGGACCAGAAGCAGGAAGG + Intergenic
962201325 3:133403327-133403349 CTGCAGGTGGAGAAACAGGAGGG - Intronic
962365038 3:134773163-134773185 ATGGGGGAGGAGAACCAGGAAGG - Intronic
962965616 3:140351059-140351081 AAGAAGGACCAATAACAGGATGG + Intronic
963648172 3:147943798-147943820 ATGAGGGGCAAGAAACAGGAGGG + Intergenic
964716923 3:159732383-159732405 AGCAAGGATCAGACACAGGATGG - Intronic
964735862 3:159916244-159916266 ATGAAGGAGCAGGCACAGTGAGG - Intergenic
964947234 3:162240763-162240785 TTGCAGGAGCAGAAACAGGATGG + Intergenic
965199746 3:165642469-165642491 AAGAAGGAGCAGAGGCAAGAAGG - Intergenic
965764430 3:172115158-172115180 AAGAATGAGGAGACACAGGATGG - Intronic
966240718 3:177752819-177752841 ACTAAGGAGCAAAAGCAGGAAGG - Intergenic
966522256 3:180886410-180886432 ACCAGGGAGCAGAATCAGGAGGG + Intronic
967280669 3:187820261-187820283 AGGAAGGAGGAGGAAGAGGAGGG - Intergenic
967365482 3:188681657-188681679 AGGAAGGAGAAGGAAAAGGAGGG + Intronic
967549634 3:190775595-190775617 ATGAAGGAGCAGACGGAGGTGGG - Intergenic
968708465 4:2095206-2095228 GGAGAGGAGCAGAAACAGGAAGG + Intronic
968914403 4:3491000-3491022 ATGAATGAGCAGGAAGAAGAAGG - Intronic
970044064 4:11830093-11830115 ATGGAGCAGAAGAAAAAGGAAGG + Intergenic
970852663 4:20619819-20619841 ATCAAGGAACAGTAAAAGGATGG - Exonic
970916184 4:21338002-21338024 ATGGTGGAGCAGAAAGTGGAAGG - Intronic
971278366 4:25219555-25219577 GAGAAGGAGGAGAAACAGGAGGG + Intronic
971577401 4:28293226-28293248 TTGAAGAAGCAGAAAGATGAAGG + Intergenic
971735660 4:30447116-30447138 GTGAAGAAGCATACACAGGAGGG + Intergenic
973730797 4:53820611-53820633 ATGAAGGGGGAGAGAAAGGAGGG - Intronic
973835634 4:54806580-54806602 AGGAAGGAGCAAAGAAAGGAAGG - Intergenic
974054554 4:56972385-56972407 ATGAAAGAGAAGAAAAGGGAGGG + Intronic
974305582 4:60134549-60134571 ATGAAGCATCAGAAGCAGGCTGG - Intergenic
974332859 4:60502888-60502910 AAAAAGGAGGAGAAAAAGGAGGG - Intergenic
974546047 4:63308206-63308228 AGGAAACAGAAGAAACAGGAAGG + Intergenic
974685927 4:65229229-65229251 AGGAAGAAACAGAAACAGCAGGG - Intergenic
974845403 4:67345712-67345734 AAGATAGAGCAGAAGCAGGAAGG - Intergenic
975611049 4:76203707-76203729 ATGAAGGAACAGATGCAGGCTGG + Intronic
976208513 4:82644301-82644323 AAGAAGGGGCAGAAGCAAGATGG - Intronic
977209180 4:94198574-94198596 ATGCATAAGCAGAAAAAGGAAGG + Intergenic
978682765 4:111402368-111402390 GAGAAGGAGCAGGAAGAGGAGGG + Intergenic
978815057 4:112894759-112894781 TTATAGGAGCAGAAACAAGAGGG + Intronic
979105742 4:116684580-116684602 ATGAAGGTGTAGATGCAGGAGGG + Intergenic
979188335 4:117826840-117826862 ATAGGGGAACAGAAACAGGAAGG + Intergenic
979717208 4:123854356-123854378 ATGCCGCAGTAGAAACAGGAAGG - Intergenic
979809813 4:125022315-125022337 AGTAAGGGGCAGAGACAGGAGGG + Intergenic
979887467 4:126047001-126047023 ATGCATGAAAAGAAACAGGAAGG + Intergenic
979957314 4:126969930-126969952 AAGAAGGAACACAAACAGCAGGG + Intergenic
980156280 4:129110825-129110847 GTGAAGGATAAGAAAAAGGAAGG - Intronic
980395671 4:132211733-132211755 ATGAAGTATAAGAAATAGGAAGG + Intergenic
981173720 4:141655246-141655268 ATGAAGGTTCATAAAGAGGATGG + Intronic
981583382 4:146273277-146273299 GTGATGGAGCAGGAACAAGAGGG - Intronic
981806692 4:148724363-148724385 ATGAAGAATCAAAAACATGATGG - Intergenic
981910581 4:149976737-149976759 ATGAAGGAGCCAAATCAGGATGG + Intergenic
981957626 4:150498405-150498427 ATGAAGGAGAAGAACAAAGAAGG + Intronic
982016235 4:151156434-151156456 ATGTAGTAGCAAAAACAGCATGG + Intronic
982101406 4:151971801-151971823 AAGAAGGAAGAGAGACAGGAGGG - Intergenic
982106574 4:152016568-152016590 ATGAGAGAGGAGAGACAGGAGGG + Intergenic
982458702 4:155641122-155641144 AAGAAGGAGAAGAAATAGAATGG + Intergenic
982822818 4:159965735-159965757 ATGCAGGAGAAGAAATGGGAAGG - Intergenic
983226384 4:165089732-165089754 AAGAAGGACAAGAAACAGGAGGG + Intronic
983266833 4:165516146-165516168 ATGAAGCAGCAGGACCAGGTGGG + Intergenic
983349046 4:166563225-166563247 AAGAAGGAGTAGTAAAAGGAGGG + Intergenic
983432444 4:167668781-167668803 AGGAAGGATCAGAGGCAGGATGG + Intergenic
983640759 4:169942127-169942149 TTGAAAAAGCAGAAGCAGGAAGG + Intergenic
983661268 4:170132734-170132756 AAAAAGGAGGAGAAACGGGAAGG - Intergenic
983856748 4:172656237-172656259 ATTAAGGAGCAGACACTGCATGG - Intronic
984085034 4:175299698-175299720 ATAAAGTAGAAGAAACAGGAAGG + Intergenic
984418700 4:179492487-179492509 AGGAAGGAAAAGAAAGAGGAAGG - Intergenic
984614280 4:181878320-181878342 ATGAGGGGGCAGGAAAAGGAAGG + Intergenic
984989387 4:185364239-185364261 ATGGGGGAGCGGAAAGAGGAGGG + Exonic
984993330 4:185403422-185403444 ATGAAGGATCACAAACTGGCTGG - Intronic
985136943 4:186795495-186795517 AGGAAACAGCAGAAACAAGAAGG - Intergenic
985487314 5:158721-158743 AGGAAGGAGTAGAACGAGGAAGG - Intronic
985707847 5:1411640-1411662 AGGAAGGGGCAGAAACAAGGAGG + Intronic
985851629 5:2392633-2392655 AGGAAGGAAGAGAAAGAGGAAGG - Intergenic
986206192 5:5627469-5627491 ACGGAGGGGCAGGAACAGGAGGG + Intergenic
986342001 5:6797266-6797288 ATGAAGGAATAGAAAGAGCAGGG - Intergenic
986470375 5:8067830-8067852 ATGAAGTAGGAGAGAAAGGAGGG + Intergenic
986685266 5:10270841-10270863 ATGAAGGGCCAGAAACAGGAGGG - Intergenic
987255160 5:16143119-16143141 ATGAAGGAACAGAGAAAGGAGGG - Intronic
988087313 5:26488289-26488311 ATGAAGGAAGAGAAGGAGGAAGG - Intergenic
988671130 5:33383086-33383108 AAGAAACAGCAGAAACAAGAAGG + Intergenic
988706106 5:33727329-33727351 ATGGAGGAGAAGAAACAAGGAGG - Intronic
989126587 5:38059243-38059265 AAGAAGGATTAGAAACATGAAGG - Intergenic
989238509 5:39176908-39176930 AGGCAGGAGCAAAAACAGAAAGG + Intronic
989483726 5:41963725-41963747 AAGGAGGAGCAGGAAGAGGAAGG + Intergenic
989637429 5:43551121-43551143 AGGAAGTAGGAAAAACAGGATGG + Intronic
989644095 5:43610490-43610512 ATTAAGGTGAAGGAACAGGATGG + Intronic
990082922 5:51939072-51939094 ATGAAGCAGAAGAAACATCATGG - Intergenic
990237242 5:53781398-53781420 TTGATGGAACAGAAACAGGTGGG - Intergenic
990529665 5:56660732-56660754 ACCAAGGAGCAGTAACAGGCCGG + Intergenic
990647423 5:57859913-57859935 TTTAAGGAGCAGAACCAGTATGG + Intergenic
990725461 5:58748748-58748770 AAGAAGGAGCATAAACTTGATGG - Intronic
990876581 5:60493303-60493325 TTGAAGGAGGAGAAAAAAGAGGG + Intronic
991035875 5:62126951-62126973 ATGCAGCAGCAGAAAAAGAATGG + Intergenic
991361793 5:65828380-65828402 TTGCAGGAGCAGTAACAAGATGG + Exonic
992107928 5:73465422-73465444 ATGCAGTAGCAGAAACAAGCTGG - Intergenic
992194612 5:74326897-74326919 TTGAAGGAGTACAAACAGGCAGG + Intergenic
992250722 5:74873466-74873488 ATGAAGCTGCAGAAATAGGCAGG + Intergenic
992603829 5:78434551-78434573 AAGAAGGAGGAGGAAAAGGAAGG - Intronic
993033711 5:82733739-82733761 ATGAAGGATGAGAGACAGGAGGG + Intergenic
993130472 5:83891458-83891480 ATGAAATTGCAGAACCAGGAAGG + Intergenic
993168465 5:84385036-84385058 CAGAAGGAGCTGAAAGAGGAGGG - Intergenic
993389295 5:87298425-87298447 AAAAAGAAGAAGAAACAGGAAGG + Intronic
994379916 5:99058625-99058647 GTGAAGGAGCTGAACAAGGAAGG + Intergenic
994793717 5:104265884-104265906 AAGAAGGAGGAAAAGCAGGAAGG + Intergenic
995008358 5:107229214-107229236 ATGCAGGGACAGAGACAGGAGGG - Intergenic
995242285 5:109899061-109899083 ATCATGGAGCAGAAATAAGAAGG + Intergenic
996207631 5:120761142-120761164 ATGAAGCAATAGATACAGGAGGG - Intergenic
996596823 5:125212881-125212903 ATGAAGGAAGAGAAAAGGGAAGG - Intergenic
997051183 5:130382510-130382532 AAGAAGGATCAGATGCAGGAAGG + Intergenic
997401541 5:133607435-133607457 ATCATGGAGTAGAAAAAGGAGGG - Intronic
997745758 5:136298778-136298800 TTGAAGGGGCAGAAGCAGGATGG - Intronic
998809371 5:145950640-145950662 AAGAAGGAGGAGAAAAGGGAGGG + Intronic
999334700 5:150705514-150705536 ATGAAGGGCCAGAGACAGGAAGG + Intergenic
1000136175 5:158353302-158353324 ATGAAGGAGCTGTCACAGAATGG - Intergenic
1000152148 5:158513834-158513856 AACGAGGAGGAGAAACAGGAGGG + Intergenic
1000202633 5:159026821-159026843 GGCAAGGAGCAGAAAAAGGAAGG - Intronic
1000313270 5:160064876-160064898 AGGAATGAACAGAAGCAGGAAGG - Intronic
1000422294 5:161052617-161052639 AGGAAGTAGTAGAATCAGGATGG - Intergenic
1000668941 5:164035756-164035778 AAGAAAGAGCAGAGAAAGGAAGG - Intergenic
1000770720 5:165350404-165350426 ATGAAAGATCAAAAACATGATGG - Intergenic
1001143697 5:169166021-169166043 ATAAAGAAACAGAAACAGGGAGG + Intronic
1001249111 5:170132518-170132540 ATGAAGGAGAAGAAGCTGGTAGG + Intergenic
1001264865 5:170266877-170266899 TTGAAGGAGCAGGGACTGGAAGG + Exonic
1001810092 5:174620976-174620998 ATGAAGAGGCAGAGATAGGAAGG - Intergenic
1001917181 5:175571590-175571612 ATGCAGGAGCAGGGAGAGGAAGG - Intergenic
1002309043 5:178303466-178303488 ATAAAGGAGCAAAAACAAGGGGG - Intronic
1002388987 5:178894688-178894710 AGAAAACAGCAGAAACAGGAAGG - Intergenic
1002809681 6:615539-615561 ATGAAAAACCAGAAACAGGCTGG + Intronic
1003014133 6:2454418-2454440 ATGAAGCAGCGGAGACATGAAGG - Intergenic
1003597024 6:7482652-7482674 TTGAGGGAGCAGAAACGGGTGGG - Intergenic
1003834771 6:10059013-10059035 ATGCAGGAGCAGCAACAGCTGGG + Intronic
1004351457 6:14893655-14893677 ATGCAGGTGCAGATAAAGGAAGG - Intergenic
1004471190 6:15930918-15930940 ATGAAGTACCACAAACTGGATGG + Intergenic
1004755924 6:18610123-18610145 AAGAAAGAGTAGAGACAGGAAGG - Intergenic
1004884805 6:20041181-20041203 ATGAAGGAGCAAGAAATGGAAGG + Intergenic
1005009375 6:21321560-21321582 AGAAAGTAGCAGAATCAGGAAGG + Intergenic
1005333876 6:24774413-24774435 TTGAAGGAGCAGAAACACCTTGG - Intergenic
1005345331 6:24883869-24883891 GTGGGGGAGCATAAACAGGATGG - Intronic
1005364887 6:25066925-25066947 AAAAAGCAGCAGATACAGGATGG + Intergenic
1005901070 6:30216649-30216671 AGAAAATAGCAGAAACAGGAAGG + Intergenic
1006925825 6:37654663-37654685 AAGACGGAGCAGGAAGAGGAGGG + Intronic
1007509846 6:42366515-42366537 ATGCAGGTGCAGGAAGAGGAGGG - Intronic
1007783914 6:44269782-44269804 ATTAAGGCTCAGAGACAGGAAGG + Intergenic
1008073771 6:47124655-47124677 TTGAAGAAGCAGAACCAGGTTGG - Intergenic
1008265135 6:49415655-49415677 ATGAGAGAGTAGAAAGAGGAAGG + Intergenic
1008612986 6:53201458-53201480 ATGAAGGGCCAGAGACAGCAGGG - Intergenic
1008793349 6:55267849-55267871 TTGCAGGGGCAGAATCAGGAAGG + Intronic
1008800492 6:55362978-55363000 AGGAAGAAGAGGAAACAGGAAGG + Intronic
1008906298 6:56681151-56681173 ATGCAGGAGGAAATACAGGAAGG - Intronic
1009234456 6:61105664-61105686 GAGAAGGAGGAGAAAGAGGAGGG + Intergenic
1009317333 6:62237513-62237535 ATCAAAAAGCAGAAACATGATGG + Intronic
1009792884 6:68425999-68426021 ATAAAGGAGCATATGCAGGATGG + Intergenic
1009917837 6:70018123-70018145 ATGAGGGAGCAGAAAAAGATAGG + Intronic
1009961464 6:70527764-70527786 AAGAAGGAGCAGAACGAAGAGGG - Intronic
1009969163 6:70608406-70608428 ATGAAAGTGTTGAAACAGGATGG - Intergenic
1010275584 6:73965192-73965214 TTGCATGAGAAGAAACAGGATGG + Intergenic
1010292035 6:74148398-74148420 ATAAAGAAACAGAAACAGGGAGG - Intergenic
1011113126 6:83860059-83860081 ATAAAGGACCAGAAAGAAGAGGG - Intronic
1011385172 6:86788711-86788733 AGGAAACTGCAGAAACAGGAAGG - Intergenic
1011421332 6:87176540-87176562 AGAAAGTAGCAGAAGCAGGAAGG - Intronic
1011501904 6:87999858-87999880 ATGAAAAAGCAGCAAGAGGATGG + Intergenic
1012247294 6:96939783-96939805 ATGAAGTGGCAGGAACTGGAAGG + Intronic
1012393107 6:98766012-98766034 ATGAAAGAGAAGATACAGGCTGG + Intergenic
1012609988 6:101205461-101205483 ATCAAGGAGCTGACAGAGGAGGG + Intergenic
1012930638 6:105312796-105312818 AAAAATGAGCAGAACCAGGATGG + Intronic
1012958367 6:105595072-105595094 AAGATGGAGAAGAACCAGGAAGG + Intergenic
1013091546 6:106905052-106905074 ATGAGGGACCAGGGACAGGAGGG - Intergenic
1013279514 6:108622579-108622601 AGGAAGGAGCAACAACAGAAAGG - Intronic
1013351705 6:109311802-109311824 GTGATGAAGCAGAAAGAGGAAGG - Intergenic
1014336703 6:120146830-120146852 CTGCAGGAGCAGGAGCAGGAGGG - Intergenic
1014618614 6:123636898-123636920 AAGAAGCAGCAGAAACAGCCAGG - Exonic
1014952550 6:127574477-127574499 ATGAAGGAGCAAGAAAAGGTAGG - Intronic
1015210663 6:130694865-130694887 ATGGAGAAGCAGCAGCAGGAAGG + Intergenic
1015386795 6:132633750-132633772 CTGCAGGAGCAAAAACAGAAAGG + Intergenic
1015691320 6:135926690-135926712 AGAAAGCAGTAGAAACAGGAAGG - Intronic
1016012403 6:139151478-139151500 ATTAAGTAGCAGAAAAAGCACGG - Intronic
1016029876 6:139326348-139326370 ATAAAGGATGAGAGACAGGAGGG - Intergenic
1016148611 6:140707368-140707390 AAGAAGGAAAAGAAACAAGAAGG - Intergenic
1016428890 6:143962720-143962742 GTGAATGAGCTGAAACTGGAAGG - Intronic
1016498395 6:144690147-144690169 GTGAAGGGGCAAAACCAGGAGGG + Intronic
1016528907 6:145036630-145036652 ATGGAGGAGGAGCCACAGGACGG - Intergenic
1017055392 6:150431432-150431454 ATGTAGAACCAGAAGCAGGAGGG + Intergenic
1017209401 6:151838219-151838241 CCGAAGGAGCAGAAGAAGGATGG + Intronic
1017971752 6:159317819-159317841 ATTAAGGGGCAAAAGCAGGATGG + Intergenic
1018038060 6:159898597-159898619 AGGAAGGAGGAGGAAGAGGAAGG - Intergenic
1018038084 6:159898681-159898703 ATGAAGGAGGAGGAAGAGGGAGG - Intergenic
1018438255 6:163782759-163782781 ATGAAGGAGCAGTCAGAGGCTGG + Intergenic
1018776999 6:167026712-167026734 CTGAATGAGCAGCAGCAGGAAGG - Intronic
1019021907 6:168925920-168925942 AGGAAGGAGCAGAAGATGGAAGG - Intergenic
1019511027 7:1417352-1417374 AGGAAGGGGCAGAAAGGGGATGG - Intergenic
1020226994 7:6288317-6288339 AGGAAGGAGGAAAAAGAGGAAGG - Intergenic
1020376194 7:7490193-7490215 ATAAAGGGGCAGAAACCAGAAGG - Intronic
1020472359 7:8553409-8553431 ATGATGGAGCAGAAATTGGCTGG + Intronic
1020994475 7:15245484-15245506 AGGGAGGATCAGAAAAAGGAAGG - Intronic
1021131391 7:16916716-16916738 AAGAATGAGCAGAAAAAGCATGG + Intergenic
1023115706 7:36859946-36859968 ATGAGGGAGAAGGAAGAGGACGG - Intronic
1023317210 7:38951690-38951712 ATGAGGGTGCAGACACAGAAGGG + Intergenic
1023602092 7:41890318-41890340 AAGAAGGAGGAGAAAAAGAAGGG - Intergenic
1023795728 7:43790301-43790323 AACCAGGAGCAGAAGCAGGAGGG - Intronic
1024032259 7:45471425-45471447 AAGAAGGAGGAGAAACAAGAAGG + Intergenic
1024475198 7:49801907-49801929 GTGAAGGAGGAGAAACAGGGTGG - Intronic
1024511416 7:50207578-50207600 ATCAAGGAGCTTAAAAAGGAGGG + Intergenic
1026284147 7:68948375-68948397 AAGGAGGAGGAGAAAGAGGAGGG - Intergenic
1028017100 7:85729788-85729810 GAGAAGGAGCAGAAAAAGAATGG - Intergenic
1028453934 7:91018110-91018132 AGGAAGCAAAAGAAACAGGAAGG + Intronic
1028628700 7:92908345-92908367 ATGATGGAGTGGAAAAAGGATGG - Intergenic
1029414177 7:100432719-100432741 AGGAAGAAGCAGAGGCAGGAAGG + Intronic
1029956686 7:104647772-104647794 AGGAAGAAGGAGAAAGAGGAAGG + Intronic
1029966397 7:104745245-104745267 AGGAAGAAGGAGAAAGAGGAAGG - Intronic
1030289514 7:107858407-107858429 ATGAAGGAGCCCAATCAGGCGGG - Intergenic
1030853828 7:114525747-114525769 ATTAAGGAGCAGCAGCAGGTAGG - Intronic
1031014901 7:116562891-116562913 AGGAAGGAAGAGAAAGAGGAAGG + Intergenic
1031555968 7:123176778-123176800 AGGTAGGAGGAGAACCAGGAGGG - Intronic
1032252728 7:130271895-130271917 ATGGAGTAGCAGATGCAGGAAGG - Intronic
1032531605 7:132625288-132625310 CTGAAGGAGCAGAATTATGAAGG + Intronic
1033331467 7:140420447-140420469 AAGAAGGAGCAGAAGGAGGCAGG + Intronic
1033586696 7:142779641-142779663 ATGGAGGAGCAGGAGCAGGAGGG - Intergenic
1033604214 7:142913894-142913916 AGGGAGGGGCAGAAAGAGGAAGG - Intronic
1033718553 7:144030721-144030743 ATGAGAGAGGAGAGACAGGAAGG - Intergenic
1034534900 7:151720644-151720666 ATGAAGGAGGAGAGAATGGAGGG + Intronic
1034567816 7:151929537-151929559 ATGAAAGATCAGAAGCAGAAGGG - Intergenic
1035060283 7:156063904-156063926 ATGAAAGGGCAGAAACTAGACGG - Intergenic
1035440030 7:158889382-158889404 ATGAACTAGGAAAAACAGGAGGG - Intronic
1036587731 8:10140331-10140353 AGAAAGCAGCAGAAGCAGGAAGG - Intronic
1036670615 8:10783484-10783506 TTGAAGGAGCAGCAACTGGCAGG - Intronic
1037058654 8:14478908-14478930 ATGTAGGTGTAGATACAGGAAGG - Intronic
1037187582 8:16082345-16082367 ATGCAGGAGCAAAAGCAGCACGG + Intergenic
1038027915 8:23608809-23608831 ATCAGAGAGCAGCAACAGGATGG - Intergenic
1038967047 8:32585978-32586000 ATGAAGAAACAGAAACAGAGAGG - Intronic
1039065983 8:33607832-33607854 AGGAAGGAGAAGGAAAAGGAAGG - Intergenic
1039379834 8:37074716-37074738 ATGATTGAGCAGAGAGAGGAAGG - Intergenic
1039485217 8:37904542-37904564 ATGGAGGAGCAGAAAGGGGCTGG + Intergenic
1039567717 8:38563514-38563536 AGGAAGGGGCATCAACAGGATGG - Intergenic
1039854007 8:41397171-41397193 AAGAAGGAGCAGCAAGACGAAGG + Intergenic
1039963761 8:42269503-42269525 AGGAAGGAGGAGAGATAGGAAGG + Intergenic
1040063626 8:43126395-43126417 AGGCAGGAGGAGCAACAGGAGGG - Intergenic
1041174486 8:55180287-55180309 ATGAATGAGCATAAATTGGATGG + Intronic
1041224027 8:55680622-55680644 ATGAAGGACCATAAACTGGATGG - Intergenic
1041904142 8:63013196-63013218 AAGAATGAACAGAAACAGGAAGG - Intergenic
1042120399 8:65481259-65481281 AGGAAGAAGAAGAAACAGGTGGG - Intergenic
1042748302 8:72131540-72131562 AGAAAGGAGAAGAAAAAGGAAGG - Intergenic
1042753449 8:72184192-72184214 ACCAAGGAGCAGAAACATGGGGG + Intergenic
1043503952 8:80884610-80884632 AGGAAGAAGAAGAAAGAGGAAGG + Intergenic
1044552343 8:93526211-93526233 ATGGAAGAGTAGAAAAAGGAGGG - Intergenic
1044834150 8:96279486-96279508 GTGAAGGAGGGGACACAGGATGG - Intronic
1046969066 8:120200878-120200900 AATAAGGAAAAGAAACAGGAGGG - Intronic
1047426635 8:124752449-124752471 AAGAAGGAGGAAAAACAGAAGGG + Intergenic
1048106880 8:131420686-131420708 ATGAAGGAAAAAAAAGAGGAAGG - Intergenic
1048478073 8:134760979-134761001 ATGGATGAGCAGACACCGGAAGG + Intergenic
1048872026 8:138807033-138807055 ATGCAGGAGGAGAAATAGGGGGG + Intronic
1049057979 8:140254177-140254199 CTGCAGGAGCAGAGTCAGGAGGG - Intronic
1049794893 8:144492749-144492771 AGGAGGGTGCAGAAAGAGGATGG - Intronic
1049899861 9:149135-149157 AGGAAGGAGGAGCAACAGGTCGG - Intronic
1049908259 9:239499-239521 TTGAAAGAGCAGAACCATGAAGG + Intronic
1050000249 9:1069947-1069969 AGGAAGGAGGAGGAAGAGGAGGG + Intergenic
1050337087 9:4599977-4599999 GTGAGGGAGCAGGAATAGGAAGG - Intronic
1050778426 9:9298632-9298654 ATAAAGAAGCTGAAGCAGGAGGG + Intronic
1051099956 9:13509577-13509599 ATGAAGGGGTAGAAACTGAAAGG + Intergenic
1051182015 9:14421166-14421188 ATGAAGGAAGAAAAACAGGAAGG - Intergenic
1051283373 9:15466954-15466976 ATTAAGTAGTAGAAACACGATGG - Intronic
1051722218 9:20049187-20049209 AGGAAGTAGCCCAAACAGGAAGG + Intergenic
1052236499 9:26217459-26217481 ATGCAGAAGCAGGCACAGGAAGG + Intergenic
1052327787 9:27234198-27234220 AAGAAGGAGAAGAGACAGAAAGG + Intergenic
1052754991 9:32531840-32531862 ATCAAAAAGCAGAAACTGGAGGG - Intergenic
1053433328 9:38058399-38058421 ATGAGGGAGAAGAGCCAGGATGG - Intronic
1053504048 9:38625560-38625582 AAGAAGAGGCAGAAAGAGGATGG - Intergenic
1053742911 9:41159426-41159448 AGGAAGGAGGAGCAACAGGTCGG - Intronic
1054348187 9:63989250-63989272 AGGAAGGAGGAGCAACAGGTCGG - Intergenic
1054445914 9:65315609-65315631 AGGAAGGAGGAGCAACAGGTCGG - Intergenic
1054484356 9:65705901-65705923 AGGAAGGAGGAGCAACAGGTCGG + Intronic
1054685431 9:68271874-68271896 AGGAAGGAGGAGCAACAGGTCGG + Intronic
1054769859 9:69073568-69073590 ATGAAGGGGCAGATAAAGGAAGG + Exonic
1054972296 9:71102442-71102464 AGCTAGGACCAGAAACAGGAAGG - Intronic
1055018225 9:71642191-71642213 ATGGGGGAGCAGGAAGAGGAGGG + Intergenic
1055072342 9:72179658-72179680 ATGAAGTACCACAAACAGGGAGG + Intronic
1055166305 9:73199596-73199618 AAGAAGGAAAAGAAAAAGGAAGG + Intergenic
1055326111 9:75131806-75131828 ATGAAGCAGCAAAAAGAGGTAGG + Exonic
1055377449 9:75665166-75665188 TTCTAGGAGCAGAACCAGGAAGG - Intergenic
1055798863 9:80009097-80009119 CTGCAGTAGCAGAAACACGATGG + Intergenic
1055874117 9:80922364-80922386 ATGAAGGAGCAGTAAAAGAAGGG + Intergenic
1056309139 9:85321857-85321879 AAGAAGGAGAAGAGACAGAAAGG + Intergenic
1056945191 9:90988869-90988891 ACAAAGGAGTAGAAACATGAAGG - Intergenic
1057073049 9:92116880-92116902 ATGAAAGAGCAGAAACAACTAGG - Intergenic
1057317054 9:93976243-93976265 ATGTAGGATCAGACACAGGAGGG - Intergenic
1057384200 9:94593077-94593099 ATGAGAGAGCAGATGCAGGAAGG + Intronic
1058164111 9:101601526-101601548 ATGAAGCAGCACAAACGGGGTGG + Intronic
1058719237 9:107748708-107748730 ATGAAGGAGATGACAGAGGATGG - Intergenic
1059287339 9:113186177-113186199 ATGAAGGAGGAGCAAGAAGAGGG + Intronic
1059368476 9:113805958-113805980 ATCATGCAGCAGGAACAGGAAGG + Intergenic
1059492619 9:114681792-114681814 ATGAATGAGGTCAAACAGGAAGG + Intergenic
1059578590 9:115519183-115519205 AAGAAGGAGGAGGAAGAGGAGGG - Intergenic
1059610635 9:115889065-115889087 CTCAAGGACCAGAAATAGGATGG - Intergenic
1060682977 9:125582013-125582035 ATGAAAGAGAAGAGACATGAAGG - Intronic
1061014211 9:127972608-127972630 AGCAAGTAGCAGAAGCAGGATGG + Intronic
1061195111 9:129103228-129103250 ATGAAGAAGCACACACAGGCTGG - Intronic
1062097960 9:134712424-134712446 AAGAAGGAGGGGGAACAGGAAGG - Intronic
1062098022 9:134712624-134712646 AGGAAGGAGGGGGAACAGGAAGG - Intronic
1062098028 9:134712640-134712662 AGGAAGGAGGGGGAACAGGAAGG - Intronic
1062112436 9:134789411-134789433 AGGAAGGGGCAGAGGCAGGAAGG + Intronic
1203365408 Un_KI270442v1:251028-251050 AAGAAGAAGCAAACACAGGAAGG - Intergenic
1185550627 X:980670-980692 ATGATGGAGGAGGAAGAGGAGGG + Intergenic
1185735526 X:2492855-2492877 ATAAAGTACCAGAAACCGGAGGG - Intronic
1185921758 X:4100849-4100871 AAGGAGGAGGAGAAACAAGAGGG + Intergenic
1186072904 X:5842106-5842128 AAGCAGAAGCAGAAACAGGAGGG + Intronic
1186645430 X:11501838-11501860 GAGAAGGAGCAGGAAGAGGAGGG + Intronic
1187025794 X:15434156-15434178 AAGAAGGAGGAGAAAGAAGAAGG + Intronic
1187149463 X:16668689-16668711 AGGAAGGAGAAGGAAAAGGAAGG + Intronic
1187307890 X:18113715-18113737 ATGGTGGAGGAGAAACAGGCAGG - Intergenic
1187703287 X:21985185-21985207 ATGAAAGTGTTGAAACAGGATGG + Exonic
1187707778 X:22024968-22024990 ATCAAGGAGCAGAAGGAGCAAGG - Intergenic
1189285645 X:39850518-39850540 AAGGAGGAGCAGAAACATAAGGG + Intergenic
1189540246 X:41979985-41980007 CAGAAGGAACAGAAAAAGGAAGG + Intergenic
1189709704 X:43796555-43796577 AAGGAGGAGGAGAAAGAGGAGGG + Intronic
1189716057 X:43867249-43867271 AAGAAGGAGCAGGCAAAGGAAGG + Intronic
1189985657 X:46551262-46551284 ATGATGGAGCATAAACCAGAAGG + Intergenic
1190257897 X:48777589-48777611 ATGAAGGAATAGAAGAAGGAAGG + Intergenic
1190440605 X:50471164-50471186 GTGAGAGAGCAGACACAGGATGG - Intergenic
1190497852 X:51043853-51043875 ATGAAGGAGCAGACAAAAAAAGG - Intergenic
1191000115 X:55650769-55650791 AGAAAACAGCAGAAACAGGAAGG + Intergenic
1191896255 X:65996496-65996518 ATGAGGGAGCTGACACAGCATGG - Intergenic
1192449357 X:71233834-71233856 AAGCTGGAGCAGAAACAGAAAGG - Intergenic
1192672720 X:73162730-73162752 ATTAGGTAGCAGAAACAGGGTGG - Intergenic
1192681850 X:73260955-73260977 CTGAAGAAGTAGAATCAGGAAGG - Intergenic
1193046469 X:77059905-77059927 AGGAAGGAAGAGAAAGAGGAGGG + Intergenic
1193435320 X:81468276-81468298 ACCAAGGAGTAGAAGCAGGATGG - Intergenic
1194540620 X:95166657-95166679 ATGAAGTAGCATAAAAAGTATGG + Intergenic
1194762899 X:97815482-97815504 ATGAAATAGCAGAGAAAGGATGG + Intergenic
1195061140 X:101196018-101196040 GTGAGGGAGCAGAAAGAGGTGGG - Intergenic
1195863222 X:109403192-109403214 AAGAAGGAGCAGATAGATGAGGG - Intronic
1196011647 X:110894427-110894449 CTGAAGAAGAAGAAAAAGGAAGG + Intergenic
1196032200 X:111103096-111103118 ATGAGGGAGCAGTAGCAGGTGGG + Intronic
1196034927 X:111133926-111133948 ATGCAGGAAAAGAAAAAGGATGG - Intronic
1196102201 X:111858407-111858429 AGGAAAGAGGAGAAACAAGAAGG + Intronic
1196345624 X:114653645-114653667 ATGAACAAGGAGAAACAGGAGGG - Intronic
1196903770 X:120412043-120412065 ATGGAGGGGCATTAACAGGAGGG - Intergenic
1197013304 X:121593621-121593643 ATGAAGGAACAGAGGCAGGGTGG - Intergenic
1197829396 X:130625843-130625865 ATAATGGAGAAGTAACAGGAAGG + Intronic
1197839458 X:130730065-130730087 TTGGAGGAGCAAACACAGGAAGG - Intronic
1197876982 X:131119020-131119042 ATGAAAGACAAGAAATAGGAAGG - Intergenic
1197882470 X:131181349-131181371 CAGAAGGAAGAGAAACAGGAAGG - Intergenic
1198457834 X:136835008-136835030 ATGAAGGAGCATTATCATGATGG - Intergenic
1198767210 X:140091743-140091765 ATGGAGGAGCAGCAGAAGGAGGG + Intergenic
1200148807 X:153941616-153941638 ATGACGGAGCAGAAACCAGCCGG + Exonic
1200211100 X:154346873-154346895 GTGATGGAGCAGACACAGGGAGG + Intergenic
1200219752 X:154385219-154385241 GTGATGGAGCAGACACAGGGAGG - Intergenic
1200406479 Y:2817036-2817058 ATGAATGAGCAAAAGCTGGAAGG - Intergenic
1200691282 Y:6307670-6307692 ATCAAGAAGAAGAAAGAGGATGG - Intergenic
1201043990 Y:9867046-9867068 ATCAAGAAGAAGAAAGAGGATGG + Intergenic
1201461675 Y:14232565-14232587 AAGAAGAAGCAGAAGAAGGAAGG - Intergenic
1202161648 Y:21941027-21941049 GTCAAGAAGGAGAAACAGGATGG - Intergenic
1202229708 Y:22645346-22645368 GTCAAGAAGGAGAAACAGGATGG + Intergenic
1202313448 Y:23550819-23550841 GTCAAGAAGGAGAAACAGGATGG - Intergenic
1202557355 Y:26119776-26119798 GTCAAGAAGGAGAAACAGGATGG + Intergenic