ID: 1151542832

View in Genome Browser
Species Human (GRCh38)
Location 17:74773532-74773554
Sequence CCCCTAGCCCTGGTACTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 153}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151542832 Original CRISPR CCCCTAGCCCTGGTACTGGG AGG (reversed) Intronic
900100394 1:959953-959975 CCCCCAGCCCTGGCGCTGAGGGG + Intergenic
900557955 1:3289513-3289535 CCCCCAGCCCTGGCACAGGGTGG - Intronic
901512549 1:9724683-9724705 GCCCTTGCCCTGATAATGGGTGG - Intronic
901754918 1:11435575-11435597 CCCCTAGTTCTGGAGCTGGGTGG - Intergenic
905946101 1:41902467-41902489 CACCTTGCCCTGGCAGTGGGGGG - Intronic
912641614 1:111351653-111351675 CCACTAGCCCTGGTCATAGGAGG + Exonic
915593898 1:156885635-156885657 GCCCTAGCCCTGGTATGTGGAGG + Intergenic
919072288 1:192771545-192771567 TTTCTAGCTCTGGTACTGGGAGG + Intergenic
920380134 1:205530377-205530399 CCCCTTTCCTTGGTTCTGGGTGG - Intronic
920924318 1:210327899-210327921 CCCCAAAACCTGGTACTGGATGG - Intergenic
922727068 1:227927541-227927563 TCCCTAGCCCTGGGGCTTGGAGG - Intronic
924025054 1:239823416-239823438 CCCCCAGCCTTGGTCCAGGGAGG + Intronic
1063065489 10:2604173-2604195 CCCCAAGTCCAGGTGCTGGGAGG + Intergenic
1063921864 10:10941318-10941340 CCCTTGACCCTGGAACTGGGTGG + Intergenic
1065218058 10:23469730-23469752 CTCCTAGCCCTGATCCTGGCTGG - Intergenic
1066456285 10:35575035-35575057 CACCAAGGCCTGGTCCTGGGGGG - Intergenic
1067058055 10:43063937-43063959 CTTCCAGCCCTGGAACTGGGGGG - Intergenic
1071470954 10:85983801-85983823 CCCCAAGCCCTGGTCAAGGGAGG + Intronic
1072633635 10:97163900-97163922 CCCCTCCCCCTGATACTGGCCGG - Intronic
1076928250 10:133506641-133506663 CACCTAGCTCTGGTAGTGGAAGG + Intergenic
1077069887 11:664342-664364 CCCCAAGCCATGGCACTGAGAGG + Intronic
1077168111 11:1152788-1152810 CCCACAGCTCTGGTCCTGGGCGG - Intergenic
1077247343 11:1546192-1546214 CCCCCAGCCCAGGTGCAGGGCGG - Intergenic
1078708062 11:13764299-13764321 CCCCTAGCCCTGGTTGGGGATGG + Intergenic
1081524490 11:43916530-43916552 TCCTTAGCCCTGGTTTTGGGGGG + Intronic
1082991176 11:59208263-59208285 CCACAAGCCCTGCCACTGGGTGG + Exonic
1083203329 11:61132841-61132863 GCACTAGCCCAGGGACTGGGAGG + Intronic
1083798452 11:65032301-65032323 CCCCTCGCCCAGGGACAGGGAGG - Intronic
1089112186 11:116065541-116065563 CTCCTACCCCTGGGATTGGGAGG + Intergenic
1089261366 11:117226063-117226085 CTCCTAGCCGGGGAACTGGGAGG + Intronic
1091222168 11:133936075-133936097 CACCTACACCTGGTACTGGCAGG - Exonic
1091589920 12:1836892-1836914 GCCCCAGCCCTGGCCCTGGGTGG - Intronic
1094603271 12:31929268-31929290 CTTCTCTCCCTGGTACTGGGTGG + Intergenic
1103596901 12:122029718-122029740 ACCCCAGCCCTGCTTCTGGGAGG + Intronic
1104091835 12:125524030-125524052 CCTCTAATCCTGGGACTGGGAGG + Intronic
1106433724 13:29706073-29706095 CTCCTGGCCCAGGTGCTGGGAGG + Intergenic
1108091368 13:46853361-46853383 CCCCTAACCCTTGGGCTGGGAGG + Intronic
1109859744 13:68180961-68180983 CTCCTATCCCTGGTGCTTGGTGG + Intergenic
1113357929 13:109601049-109601071 CCCCCAGCCCAGGGACTTGGCGG + Intergenic
1118317223 14:64732689-64732711 CTCCTGGCCCTGGAGCTGGGTGG + Intronic
1119046345 14:71321191-71321213 CCCCGCGCCCGGGTCCTGGGGGG + Intronic
1119378804 14:74215633-74215655 CCCCCAGCCATGGTCCTGGGAGG + Intergenic
1121410811 14:93747064-93747086 CACCTAGCCCTGAGACTGGAGGG + Intronic
1121443978 14:93967151-93967173 CCTCTGGCCCTTGTACTGGCAGG + Intronic
1121919983 14:97871878-97871900 CCCCCAGTCTTGGTACTAGGTGG + Intergenic
1122919774 14:104875233-104875255 CCCCCAGCCCTGGGACAGGACGG - Intronic
1123117491 14:105901263-105901285 CCCTCAACCCTGGTTCTGGGGGG + Intergenic
1125723260 15:41855245-41855267 CCCGTAGTCCTGGGACTCGGCGG + Exonic
1128689308 15:69711131-69711153 CTCATATCCCTGGTACTGGCAGG + Intergenic
1129250233 15:74304688-74304710 CCCCCAGCCCTGGAGCTGGCGGG + Intronic
1131097867 15:89667238-89667260 CCTCTAGCCCTGGGGCTGGTGGG - Intronic
1131115244 15:89791359-89791381 CCCCAAGCCCTGGCACCAGGTGG + Intronic
1132656807 16:1044884-1044906 CACCCAGCCCTGGGCCTGGGAGG - Intergenic
1141648093 16:85378100-85378122 CCCCGAGCCCTGGCACCGGGTGG - Intergenic
1141692943 16:85606787-85606809 CCCCTTGCCCTGTTACTGTCTGG - Intergenic
1142500234 17:328130-328152 CCCCTTGGCATGGTGCTGGGTGG - Intronic
1143887654 17:10076809-10076831 TTTCTCGCCCTGGTACTGGGAGG - Intronic
1145865369 17:28237831-28237853 CCCCTCTCCCTGGTAAGGGGAGG + Intergenic
1147995123 17:44355982-44356004 CCCCCAGCTGGGGTACTGGGTGG - Exonic
1149447449 17:56724645-56724667 CTCCAGGCCCTGGTAATGGGAGG + Intergenic
1149475893 17:56960677-56960699 CCGCTAGACCTGGTAGTGGAGGG - Intronic
1151542832 17:74773532-74773554 CCCCTAGCCCTGGTACTGGGAGG - Intronic
1152537224 17:80957748-80957770 CCCCAAGCCCTGGGCCTGTGGGG + Intronic
1152562905 17:81087449-81087471 GGCCTCGCCCTGGGACTGGGAGG + Intronic
1152609099 17:81306947-81306969 CCCCCGGCTCTGGCACTGGGCGG - Intergenic
1152782300 17:82231734-82231756 CTCCTGGCCCTGGCCCTGGGTGG + Intronic
1156400041 18:36731765-36731787 CCCATGGCCCTGGGAATGGGAGG + Intronic
1157894377 18:51450110-51450132 TCTCTAGAACTGGTACTGGGTGG - Intergenic
1157947084 18:51992496-51992518 ACCCCAACCCTGGTACAGGGTGG + Intergenic
1159081684 18:63742552-63742574 CCTCTAGCCTTTGTGCTGGGAGG + Intergenic
1162523464 19:11194859-11194881 CACATAGCCCTGGGGCTGGGGGG + Intronic
1163554325 19:17983710-17983732 CCCCCAGCCGTGCTCCTGGGTGG + Intronic
1164649351 19:29880874-29880896 ACCCTGGCCCTGGTGCTGGAGGG + Intergenic
1165987970 19:39787205-39787227 CCCCTAGCTCTGGAAATGGAAGG + Intergenic
1167291615 19:48628089-48628111 CCCCTAGCCCTGGGCCCTGGGGG + Intronic
926686888 2:15704888-15704910 ACCCTACTCCTGGTAATGGGAGG + Intronic
926712380 2:15891659-15891681 CCCCTAGCCCTGGGACCCGCAGG + Intergenic
927250416 2:20991195-20991217 CCCTTAGGCCAGGTACAGGGCGG + Intergenic
928410902 2:31053117-31053139 CCCCAAGCCCTAGTCTTGGGTGG + Intronic
929947642 2:46382551-46382573 GCTGTAGTCCTGGTACTGGGTGG - Exonic
934745364 2:96756222-96756244 CCCCAGGCCCTGGTACTAGCAGG + Intergenic
938548186 2:132353487-132353509 CATCTAGCCCTGGTTCTGCGAGG - Intergenic
938684113 2:133720345-133720367 CCCCTATCCCTGGTAACAGGAGG - Intergenic
938812197 2:134863663-134863685 CCCCCGGCCCAGGCACTGGGCGG - Intronic
943141998 2:183993867-183993889 GCCCTAGGCCTGCTACAGGGAGG + Intergenic
944934379 2:204552380-204552402 CCTCTGTCTCTGGTACTGGGTGG + Intronic
947746021 2:232507773-232507795 GCCCTAGGCCTGGTTTTGGGGGG - Intergenic
948354706 2:237368814-237368836 CACCTGGTCCTGGTCCTGGGTGG - Exonic
1170046409 20:12090085-12090107 CCCCTAACCCTAGGACTTGGGGG + Intergenic
1171202225 20:23251316-23251338 CCCCTAGCCCTGGCTCTGTCAGG + Intergenic
1171487943 20:25497389-25497411 CCCCTGGCCTTGGGACAGGGAGG - Intronic
1173135306 20:40433737-40433759 CCCACAGCCCTGGAAATGGGAGG + Intergenic
1176125002 20:63471415-63471437 CCCCCAGCCCTGGGCCTGGAAGG - Intronic
1179626538 21:42652671-42652693 CCACTGGCCCTGGCACTGGCTGG + Intergenic
1179985449 21:44918367-44918389 CCCACAGCCCTGGTACCTGGTGG + Intronic
1180013749 21:45069479-45069501 GGCCTAGCTCTGGAACTGGGAGG - Intergenic
1180796630 22:18608961-18608983 TCCCTGGCCCTGGAAATGGGGGG - Exonic
1181225094 22:21386310-21386332 TCCCTGGCCCTGGAAATGGGGGG + Exonic
1181253538 22:21548503-21548525 TCCCTGGCCCTGGAAATGGGGGG - Exonic
1181626082 22:24123143-24123165 CCTCCATCCCTGCTACTGGGTGG - Intronic
1183226390 22:36553116-36553138 CCCTGAGCCCTGGTTCTGGCTGG + Intergenic
1183486523 22:38089939-38089961 CCCCTACCCCTGAAGCTGGGCGG - Intronic
1184347438 22:43922426-43922448 GACCTACCCCTGGCACTGGGTGG - Intergenic
1184451694 22:44586322-44586344 CTCCTGGCCCTGGGAGTGGGTGG - Intergenic
1185094225 22:48797429-48797451 TCCCGAGCCCTGGCACTGAGGGG + Intronic
1185278388 22:49959676-49959698 CCACTAGCCCTGGGGCTGGCGGG + Intergenic
950469891 3:13177945-13177967 CCCCTAGGCCTGGGGCTGGGTGG + Intergenic
959917946 3:111839110-111839132 CCATTACCCCTGGTACTGAGAGG + Intronic
960785759 3:121371755-121371777 GCCCTGGCCTTGGCACTGGGCGG - Intronic
961591488 3:127984947-127984969 CAGCTAGCCCTGCTGCTGGGTGG - Exonic
966269402 3:178086426-178086448 CACCTAGCCCTGGTTCTTGGTGG - Intergenic
968083597 3:195863865-195863887 CCTCTGGCCCTGGTCCTGGGCGG - Exonic
979349462 4:119628064-119628086 CCCCTCGCCCTGGCCCTGGCTGG - Intronic
985745696 5:1645565-1645587 CCGCTAGCCCCGGTGCTGGCTGG - Intergenic
992069846 5:73138255-73138277 CCCTTAGCACTGGTAATTGGCGG + Intergenic
992196023 5:74339991-74340013 CCCCTATTGCTGGCACTGGGTGG + Intergenic
998160313 5:139809377-139809399 CCTCTAGACCTGGCAGTGGGTGG - Exonic
998191478 5:140028906-140028928 GGCCTAGCCATGGTACTGTGAGG + Intronic
1002668661 5:180846799-180846821 TCCCTGTCCCAGGTACTGGGTGG - Intergenic
1002815796 6:678676-678698 CCCCATGCCCTGGTTCTGGGAGG - Intronic
1004306396 6:14505493-14505515 CCCTTTGCCCTGGTCCTGGGAGG + Intergenic
1004417157 6:15435483-15435505 TCCCTAGCACTGGCACTGGGAGG - Intronic
1006283306 6:33073661-33073683 CCTCTAGCACTGGAAATGGGTGG + Exonic
1006645498 6:35512078-35512100 CGCCGAGCCCTGGAACGGGGTGG - Intronic
1018911425 6:168102446-168102468 CCCCGAGCCCTGATGCTGGGCGG - Intergenic
1019151704 6:170010849-170010871 ACCCCATCCCTGGTGCTGGGAGG - Intergenic
1019217407 6:170452599-170452621 CCCCTTGCCCTGGTCCTGCTGGG - Intergenic
1021461208 7:20888885-20888907 CCCACACCCCAGGTACTGGGTGG - Intergenic
1023938174 7:44754452-44754474 CACCGAGCACTGGGACTGGGGGG - Intronic
1026489194 7:70848205-70848227 AGCCTAGCCCTGGGACTGAGTGG - Intergenic
1029547652 7:101218821-101218843 CATCTAGCCCAGGTTCTGGGAGG + Intronic
1033135463 7:138780468-138780490 CCGCCAGCTATGGTACTGGGGGG - Intronic
1034158683 7:148976460-148976482 CCTCTAGACCTGGTCCTTGGAGG - Intergenic
1035056185 7:156038389-156038411 CCACTGGCCCAGGTGCTGGGCGG + Intergenic
1035691005 8:1559807-1559829 CCCCGTGCCCAGGAACTGGGTGG + Intronic
1036692085 8:10950384-10950406 CCCCCAGCCCTGGCACAGGGAGG - Intronic
1038037486 8:23698847-23698869 CCCCTAGCCCTGGGACAGTCAGG + Intergenic
1039648642 8:39315818-39315840 ACCCTAATCCTGGTCCTGGGGGG - Intergenic
1041259662 8:56009932-56009954 CCTGTAGCCCTGGGACAGGGCGG - Exonic
1042122226 8:65500600-65500622 CCCCTACCCCTGGCTCAGGGAGG + Intergenic
1045269705 8:100651276-100651298 CCCCTGGCCTTGGTATAGGGAGG - Intronic
1049145876 8:141000942-141000964 CCCCCGGCCCGGGTTCTGGGAGG - Intronic
1049387987 8:142353883-142353905 GCCCGAGGCCTGGCACTGGGTGG + Intronic
1053476405 9:38385078-38385100 CCCCCAGCCCTGCAGCTGGGTGG - Intergenic
1056571465 9:87820409-87820431 CACCAAGCCATGGTGCTGGGAGG + Intergenic
1059437282 9:114284421-114284443 CCCCTGTCCCTGGTTCTGGCTGG + Intronic
1060103981 9:120862259-120862281 CCCCTCATCCTGGCACTGGGGGG - Intronic
1060154808 9:121312268-121312290 CCCCAAGCCCTGTCGCTGGGCGG + Intronic
1060213213 9:121723120-121723142 CCCATAGCTATGGTGCTGGGTGG + Intronic
1060545887 9:124458710-124458732 CACCGGGCCCAGGTACTGGGTGG + Exonic
1060781546 9:126416803-126416825 CCCCCAGCCCAGGTCCTGGCAGG + Intronic
1061008669 9:127942705-127942727 TCCCTTGCCCTGGTGGTGGGGGG - Exonic
1061758611 9:132833943-132833965 CCCCACGCTCTGGTCCTGGGAGG - Intronic
1061791822 9:133063134-133063156 TCCCTGGCCCTGGGACCGGGAGG + Intronic
1061795497 9:133083700-133083722 TCCCTGGCCCTGGGACCGGGAGG + Intronic
1061921942 9:133787372-133787394 CCCCCAGCCTGGGCACTGGGGGG - Intronic
1062277050 9:135736178-135736200 CCCCCAGCCCTGGTGTGGGGTGG - Intronic
1062569800 9:137179813-137179835 CCCCAAGCCCCGGTTCTGAGAGG + Intronic
1062723756 9:138059371-138059393 CCCCCAGCCTAGGTCCTGGGAGG + Intronic
1186874292 X:13801794-13801816 CCCCTAGAGCTGGTCCTTGGGGG + Intronic
1189161195 X:38810795-38810817 CCCCTAGGCCTGGGGCTTGGTGG + Intergenic
1192435615 X:71141875-71141897 CCCCTGGCGCTGGAACTGGGTGG - Exonic
1198046145 X:132904889-132904911 CACCAAGCCTTGGTACTGTGGGG - Intronic
1199338516 X:146647768-146647790 ACCCTTGCCCTTGTTCTGGGAGG - Intergenic
1202388629 Y:24348013-24348035 GCTCAAGCCCTGGTACTAGGGGG - Intergenic
1202482158 Y:25322115-25322137 GCTCAAGCCCTGGTACTAGGGGG + Intergenic