ID: 1151544830

View in Genome Browser
Species Human (GRCh38)
Location 17:74786376-74786398
Sequence CTTGGTGCACAGATGGGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 253
Summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 225}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151544830_1151544838 -3 Left 1151544830 17:74786376-74786398 CCCTGCCCCATCTGTGCACCAAG 0: 1
1: 0
2: 0
3: 27
4: 225
Right 1151544838 17:74786396-74786418 AAGCACCCTTCTGGGTACTGAGG 0: 1
1: 1
2: 8
3: 58
4: 359
1151544830_1151544840 -1 Left 1151544830 17:74786376-74786398 CCCTGCCCCATCTGTGCACCAAG 0: 1
1: 0
2: 0
3: 27
4: 225
Right 1151544840 17:74786398-74786420 GCACCCTTCTGGGTACTGAGGGG 0: 1
1: 0
2: 1
3: 16
4: 152
1151544830_1151544841 0 Left 1151544830 17:74786376-74786398 CCCTGCCCCATCTGTGCACCAAG 0: 1
1: 0
2: 0
3: 27
4: 225
Right 1151544841 17:74786399-74786421 CACCCTTCTGGGTACTGAGGGGG 0: 1
1: 0
2: 2
3: 16
4: 157
1151544830_1151544839 -2 Left 1151544830 17:74786376-74786398 CCCTGCCCCATCTGTGCACCAAG 0: 1
1: 0
2: 0
3: 27
4: 225
Right 1151544839 17:74786397-74786419 AGCACCCTTCTGGGTACTGAGGG 0: 1
1: 0
2: 2
3: 20
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151544830 Original CRISPR CTTGGTGCACAGATGGGGCA GGG (reversed) Intronic
900252529 1:1678556-1678578 CCTGGTGCACCGAGGGGTCAGGG - Intronic
901951191 1:12748223-12748245 CTTGGAGCTCAGATGGGAAAAGG + Intronic
902994887 1:20216632-20216654 CGGGGTCCCCAGATGGGGCAGGG + Intergenic
903008556 1:20314538-20314560 CTTGGTGCAGAACTGGGGCACGG - Exonic
903262442 1:22138789-22138811 CCTGGGGCAGGGATGGGGCACGG - Intronic
904619164 1:31765157-31765179 CTTAGTGCCAAGATGGGGAAGGG - Intergenic
904675151 1:32194710-32194732 CATGGTGCAGAAAAGGGGCACGG - Intronic
905305480 1:37015072-37015094 CTTGATGCAGAGATGGGACCAGG - Intronic
905940728 1:41861171-41861193 CATGGTCCCCAGATGGAGCATGG - Intronic
906210835 1:44011411-44011433 CTGGGGGCACAGAGTGGGCAGGG + Intronic
907271928 1:53296367-53296389 CTGGGTGCACAGAAGGGACTTGG + Intronic
911370307 1:96988086-96988108 CTGGGAACACAGATGGGGAAGGG - Intergenic
912225544 1:107729547-107729569 CATGGTGCACTGAAGGGGCATGG + Intronic
914947377 1:152079265-152079287 CTCACTGCCCAGATGGGGCAGGG + Intergenic
917453555 1:175166981-175167003 CTTGGAGCACAGAAAGGACAGGG - Intronic
919805128 1:201376917-201376939 CTTGGGGGGCAGATGGGGAAAGG - Intronic
920051977 1:203169786-203169808 CTTGGGGCACACAAGGGACAGGG + Intronic
920204597 1:204282470-204282492 CCTGGCCCAGAGATGGGGCAGGG - Intronic
921254211 1:213325008-213325030 CTGGGTGCAGAAAGGGGGCAGGG - Intergenic
922427382 1:225511715-225511737 CTTGGTCCAAATATGGGGAAAGG + Intronic
923055386 1:230422852-230422874 CTTGGTGCCCAGCTGGGAGAGGG - Intronic
924554551 1:245107559-245107581 TGTGGGGCACTGATGGGGCAGGG + Intronic
1063967737 10:11359927-11359949 ATTGGTGCACAGAAGCCGCACGG + Intergenic
1067294810 10:44969424-44969446 CTTGTTGCACAGACGAGGAAAGG + Intronic
1067427578 10:46221396-46221418 CTTGGTGGTCAGATCAGGCATGG + Intergenic
1070795242 10:79212478-79212500 TTTTTTGCACAGATGGGGCTGGG + Intronic
1072874952 10:99162733-99162755 CTTGGTAAACTGAAGGGGCAGGG - Intronic
1074700289 10:116086562-116086584 CTTTTTGCACAAATGAGGCAGGG - Intronic
1076731131 10:132439454-132439476 CTTGGAGCTCAGATTGGCCAAGG - Intergenic
1077213867 11:1386859-1386881 CTTGGGTCAGGGATGGGGCAAGG - Intergenic
1077300050 11:1842583-1842605 CTTGGTGGCCAGATGGGGCTGGG - Intergenic
1078529059 11:12122326-12122348 CTTGGAGCACAGATGTGGGCAGG + Intronic
1078659299 11:13273982-13274004 CTTGGTGCTCAGATGTGAAAGGG - Intergenic
1083083051 11:60113464-60113486 CTTGGAGCAGGGATGGGGGATGG + Intergenic
1083145576 11:60755907-60755929 ATTGGTGAACAAAGGGGGCAAGG - Intergenic
1083161268 11:60855709-60855731 CTTGGTGCTCAGAGGAGGGAAGG - Intronic
1083246890 11:61435762-61435784 CTTGGGGCACTGATGGGACATGG - Intronic
1083726691 11:64632108-64632130 GGTGGCTCACAGATGGGGCAAGG + Intronic
1084172491 11:67407187-67407209 CCTGGTGCAGAGCTGGGCCAGGG + Intronic
1084500858 11:69534340-69534362 CCAGGTGCACTGATGGGGCCGGG - Intergenic
1084970863 11:72771391-72771413 CTGAGTCCAAAGATGGGGCAAGG - Intronic
1085524912 11:77158451-77158473 CTTGGCGCAGGGGTGGGGCAGGG - Intronic
1085976499 11:81661465-81661487 CACAATGCACAGATGGGGCATGG - Intergenic
1086930482 11:92687745-92687767 CTTGGTGGCCAGATGGGGCTAGG + Intronic
1087272279 11:96123725-96123747 CAGTGTGCACAGATGGGGAAGGG + Intronic
1088821192 11:113458893-113458915 CTGGGGGCAGCGATGGGGCAGGG + Intronic
1089331506 11:117692104-117692126 CTTGGTGCAGAGGTGATGCAAGG + Intronic
1090628776 11:128628078-128628100 CTTGACGCACAGATGGGACATGG - Intergenic
1090667759 11:128926111-128926133 CTTGGGACACAGAAGGGGCTTGG - Intergenic
1091208369 11:133835841-133835863 CTGGGGGCACAGTTGGGGGATGG - Intergenic
1091833164 12:3564717-3564739 CTTGGGGTCCAGATTGGGCATGG + Intronic
1092526428 12:9312716-9312738 CTGGGTGGACAGATGGGGGCTGG + Intergenic
1094147015 12:27239668-27239690 CTTGGTGGACATAAGGGTCATGG + Intergenic
1094331345 12:29297615-29297637 CTTGGGGCTCAGAGAGGGCAAGG - Intronic
1094399312 12:30044543-30044565 CTTGGACTAGAGATGGGGCAAGG + Intergenic
1094512199 12:31103416-31103438 CTGGGTGGACAGATGGGGGCTGG + Intronic
1096872749 12:54604411-54604433 GTTGGTGCAGAGCTGGTGCATGG + Intergenic
1098605060 12:72380398-72380420 TGTGGGGGACAGATGGGGCATGG + Intronic
1101042605 12:100771875-100771897 CTTGGTGCACAAATGATGTATGG - Intronic
1102539057 12:113605327-113605349 CTTTTTGCAGAGATGGGGCGGGG + Intergenic
1103613477 12:122137972-122137994 AATGGTGCACAGCTGGGGCTGGG - Intronic
1103955551 12:124574569-124574591 CTTGGTGGACATAAGGCGCATGG - Intergenic
1107045237 13:35986350-35986372 CCTGGTTCACAGAGGAGGCAGGG + Intronic
1111077506 13:83257139-83257161 TTCGGTGCACAGATGGGGAATGG + Intergenic
1111771680 13:92604468-92604490 CTAGGTGCCCAGACAGGGCAAGG - Intronic
1113445619 13:110364155-110364177 CATGCTGCACAGAAAGGGCAAGG + Intronic
1114613680 14:24057464-24057486 CAGGGTGCACAGCTGGGGAAGGG - Intronic
1116868682 14:50051830-50051852 CAAGGTGCCAAGATGGGGCATGG - Intergenic
1117558549 14:56911412-56911434 CTTGGTGGAATGATGGGGCATGG + Intergenic
1122127294 14:99586237-99586259 CTTGGGAGACAGATGGGGCCTGG - Intronic
1122266325 14:100548598-100548620 CAGGGTGCCCAGAAGGGGCAGGG - Intronic
1123936418 15:25196294-25196316 CTTGGTGCACAGGTGAGTCCTGG + Intergenic
1123944610 15:25233010-25233032 CTTGGTGGACAGATCAGGCCTGG + Intergenic
1128223389 15:65984080-65984102 CTTGGGGCACAGATGAAGAAGGG - Intronic
1128699942 15:69796804-69796826 CTTGGGACAGAGATGGGGCAGGG - Intergenic
1131072282 15:89473374-89473396 CCAGGACCACAGATGGGGCAAGG - Intronic
1131698016 15:94901353-94901375 CTTGGGGACCAGATAGGGCAGGG - Intergenic
1132966106 16:2655526-2655548 CATGGTGCAGAGATTGGGCATGG + Intergenic
1132983075 16:2749202-2749224 CTGGGAGCACACATGGGGCCTGG + Intergenic
1137461684 16:48670314-48670336 CTTTGTGCACAGATGGATCTAGG - Intergenic
1137584767 16:49657750-49657772 CTTAGTGCACATATGTGGCGAGG - Intronic
1137674393 16:50297103-50297125 CCTATTGCACAGATGGGGAAAGG + Intronic
1139374401 16:66487780-66487802 CTAGGTGGGCTGATGGGGCATGG - Intronic
1139530916 16:67542346-67542368 CTAGGTGTGCAGATGGGGCAGGG - Exonic
1142140849 16:88472098-88472120 CTGGGTCCACAGATGGGGTGGGG - Intronic
1142585820 17:972650-972672 CTTTGTGCACAGCTGGGGTCGGG - Intronic
1144132282 17:12258157-12258179 TTTGGAGGACAGATGGGCCACGG + Intergenic
1144262992 17:13541457-13541479 CTTGGTACACACATTGGGAATGG + Intronic
1145303367 17:21655484-21655506 CCTGGTGTACACATGGGGCCTGG - Intergenic
1145346674 17:22046356-22046378 CCTGGTGTACACATGGGGCCTGG + Intergenic
1147154256 17:38535629-38535651 CTGGGGGCACAGAGAGGGCAGGG - Intronic
1147159719 17:38562952-38562974 CATTGTGCACAGCTGGGGGATGG - Intronic
1147961608 17:44170957-44170979 CTTGGTGGACAGCTGGGTCTCGG - Exonic
1150121712 17:62608916-62608938 CTTGGTTTACAGATGTGGCAAGG - Intronic
1151216308 17:72579063-72579085 CGTGCAGCTCAGATGGGGCAAGG + Intergenic
1151544830 17:74786376-74786398 CTTGGTGCACAGATGGGGCAGGG - Intronic
1152341541 17:79728570-79728592 CGGGGTGCACAGAAGGGGCCTGG - Intergenic
1152568614 17:81111489-81111511 CTTGGGGGACAGAAGAGGCAAGG - Intronic
1152712415 17:81879543-81879565 CTGGGTGCAGAGCTGGGACAAGG + Intergenic
1154111219 18:11570148-11570170 CTTGGTGTGCAGAGGGGGAATGG - Intergenic
1158856318 18:61545961-61545983 CTTTGGGCACAGATGGGAAAAGG + Intronic
1160191875 18:76721497-76721519 CATGGGGCACAGTAGGGGCAGGG + Intergenic
1160317357 18:77859943-77859965 CTTGCTGGACAGATGAGGAAAGG - Intergenic
1160493153 18:79354713-79354735 CGAGGTGAACAGAGGGGGCAAGG + Intronic
1161387987 19:4007207-4007229 CCTGGTGTGCAGATGGGGCGTGG - Intergenic
1162582793 19:11540703-11540725 CAGGGGGCACAGAGGGGGCAGGG + Intronic
1162968624 19:14167378-14167400 CTTGGTGCAAGGCGGGGGCAGGG + Intronic
1163555404 19:17989496-17989518 CATGGTGCATAGAAGGGGCCTGG + Intronic
1163967329 19:20759071-20759093 GTTGGTGCACAGTTGAGGTAAGG - Intronic
1165470358 19:35999881-35999903 CTTGTTTAACAGATGGGTCAAGG - Intergenic
1165510299 19:36262857-36262879 GTTCCTGCACAGATGGGACATGG + Intergenic
1166719886 19:44990733-44990755 TTTGGGTCACACATGGGGCAGGG + Intronic
1167418776 19:49390709-49390731 CCTGGGGCACAGGTGGGGCTAGG + Intronic
1167432551 19:49462744-49462766 CAGGGTGCACAGGTGAGGCAGGG + Exonic
926444118 2:12923114-12923136 CCTGGTGCACAGATGGGATGTGG + Intergenic
926808596 2:16736203-16736225 CTTGGATCACAGCTGTGGCAAGG + Intergenic
927079127 2:19610388-19610410 CTTAGAGCACAGATGAGGTAAGG - Intergenic
927684788 2:25162791-25162813 CTTAGTGCAGAGATGGAGCTGGG - Intronic
929547744 2:42866677-42866699 CTTCCTCCAGAGATGGGGCAGGG + Intergenic
931700017 2:64901917-64901939 CTGGGTGCACAGATGAGGGGAGG - Intergenic
933056998 2:77683133-77683155 ATTTTTCCACAGATGGGGCACGG + Intergenic
933833397 2:86227845-86227867 CTTGGTGCACATCTGGGCCTTGG + Intronic
933887254 2:86730078-86730100 GTTGGTGCACAGATGGAGTCTGG + Intronic
933922921 2:87066635-87066657 GTTGGTGCACAGATGGAGTCTGG - Intergenic
933927130 2:87104276-87104298 ATTTTTCCACAGATGGGGCACGG + Intergenic
936080506 2:109429633-109429655 CCTGGGGCACAGCTGGGGCAGGG - Intronic
936401547 2:112168377-112168399 CTTGAAGCATAGATGGGGCCTGG + Intronic
937111045 2:119367333-119367355 CTTGATGGAGAGATGGGGGAAGG + Intronic
937195946 2:120156467-120156489 ATAGGTGCACTGGTGGGGCAAGG - Intronic
937883222 2:126883632-126883654 CAAGGTGCATAGATAGGGCAGGG + Intergenic
938015856 2:127866680-127866702 CTGGGGGCACAGTTGGAGCAGGG - Intronic
938066423 2:128284190-128284212 CTAGGTGCTCAGACAGGGCAGGG + Intronic
939119417 2:138098987-138099009 CATGGTGAGCAGATAGGGCATGG + Intergenic
939814216 2:146874108-146874130 CTCAGTGTACAGATGGAGCAAGG - Intergenic
940088644 2:149891661-149891683 ATTGGTGAAGAGATGGAGCATGG + Intergenic
940422929 2:153499876-153499898 CTGGGTGCACAGCTGCGGCTGGG + Intergenic
941889778 2:170567973-170567995 CAAGGTGCACTGATGGGTCATGG + Intronic
946215011 2:218177405-218177427 CATCCTGCACAGATGGGACACGG + Intergenic
946300822 2:218823030-218823052 CTGGGAGCACAGGTAGGGCAAGG + Exonic
946442264 2:219706763-219706785 CTTGGAGCAGAGATGGTGCCTGG + Intergenic
947313970 2:228834965-228834987 CTTGGTGCACTCAAGGGACAGGG - Intergenic
947497982 2:230652588-230652610 CTATGTGCTCAGATGGGGCCTGG - Intergenic
948120710 2:235528323-235528345 CTGAGTGCACAGATGGTGGATGG - Intronic
948883305 2:240871133-240871155 TTTGGTGCAGAGATGGAGGAGGG - Intronic
1169990461 20:11497512-11497534 TTTGGTGCACACTTGGTGCATGG + Intergenic
1171520883 20:25773175-25773197 CCTGGTGTACACATGGGGCCTGG - Intronic
1171556041 20:26083316-26083338 CCTGGTGTACACATGGGGCCTGG + Intergenic
1172447916 20:35002761-35002783 CTTGGCTCACAGATGGGGGGTGG + Exonic
1176654741 21:9578280-9578302 CCTGGTGTACACATGGGGCCTGG - Intergenic
1179255637 21:39713078-39713100 CTTGGTTCACAGATGGCAGATGG - Intergenic
1179308075 21:40172965-40172987 GCTGGTGCCCAGATGGGGAAAGG + Intronic
1179808398 21:43854612-43854634 CTGGGTGCACAGAAGGGCCAAGG + Intergenic
1180949665 22:19715337-19715359 CTGGGTGCCCAGATGGGTCCTGG + Intronic
1183064269 22:35352779-35352801 CACGGTGCACAGAGGGTGCAGGG - Intergenic
1183428704 22:37752869-37752891 CTTGGTGCACAGACAGGAGACGG + Intronic
1183716934 22:39538562-39538584 CCTTGTCCACAGATGGAGCAGGG - Intergenic
1185067784 22:48640655-48640677 CATGGCGCACAGATGGTGCCCGG + Intronic
950196380 3:11011966-11011988 CTAGCTGCAGGGATGGGGCAGGG - Intronic
950354915 3:12399098-12399120 TGTGCTGCACAGATGGGGCTGGG - Intronic
953886146 3:46715412-46715434 CTTGGAGCCCAGATGAGGCTGGG + Intronic
954283952 3:49604685-49604707 CCTGGTGGACAGCTGGAGCAGGG + Intronic
954431702 3:50474129-50474151 CTTGTAGCAGAGCTGGGGCATGG - Intronic
956449259 3:69357104-69357126 CTAGGTGCAAAGACGGGACAAGG + Intronic
958632100 3:96698102-96698124 CTTGTTGGACAGATGTGGTATGG + Intergenic
958821405 3:98977756-98977778 CTTGGTGCCAAGTTGAGGCAGGG - Intergenic
960056207 3:113278340-113278362 CAAGGTGAACAGCTGGGGCAAGG - Intronic
960855465 3:122098008-122098030 CTTGGTGCACAGTCAGTGCATGG - Intronic
961380390 3:126492811-126492833 CCTGGAGCACAGATGGCTCAGGG - Intronic
961454631 3:127017929-127017951 CAGGGTCCACAGGTGGGGCATGG - Intronic
964798828 3:160530369-160530391 CTTGGTGGACTGATGCGGAAGGG + Intronic
966066859 3:175830050-175830072 GGTCGTGCACAGATGGGACACGG - Intergenic
967493253 3:190117217-190117239 CTTGGTTCACAGATGAGGAAAGG - Intronic
968066413 3:195761943-195761965 CTTGGGGCACAGAGCGGGCCGGG - Intronic
968603978 4:1522844-1522866 CAGGGTGCCCACATGGGGCAGGG + Intergenic
969476455 4:7425006-7425028 CTCGGCCCACAGATGGGGCAAGG - Intronic
969566600 4:7982297-7982319 CTTGGGGCTCAGATGGTGCTGGG + Intronic
970087483 4:12365543-12365565 ATTGCTGGGCAGATGGGGCAGGG - Intergenic
971041671 4:22760187-22760209 CTATGTGCAGAGATGGGGGAGGG + Intergenic
978688923 4:111483574-111483596 ATTCGTGCACTGGTGGGGCAAGG - Intergenic
979366789 4:119834780-119834802 CATGGTGCTGAGATGGGGCAGGG + Intergenic
979478422 4:121185486-121185508 CCTGGGACATAGATGGGGCAAGG - Intronic
979485306 4:121263723-121263745 TTTTTTGCACAGATGGGGCAAGG + Intergenic
979533143 4:121790524-121790546 CATGGTGGAGACATGGGGCAGGG - Intergenic
981829062 4:148979434-148979456 CTTGGTGAATAGATGGGGCCTGG - Intergenic
982112680 4:152071156-152071178 CTTGGTGGGCAGAGAGGGCAGGG + Intergenic
985054405 4:186023901-186023923 CTGGGTGCCCAGCTGGGCCAGGG - Intergenic
985563016 5:601424-601446 CCTGGTGCACAGGTGGAGCCCGG - Intergenic
985767174 5:1786211-1786233 CTGGGGGGTCAGATGGGGCAGGG - Intergenic
985819321 5:2148876-2148898 CGTGGACCACAGATGGGGCAGGG - Intergenic
989550266 5:42726746-42726768 CTTGGTGCACAGTAGGTGCTTGG - Intergenic
990767024 5:59195343-59195365 CCTGGTGCACTGAAGTGGCAAGG + Intronic
991066235 5:62427759-62427781 ATTTTTCCACAGATGGGGCAGGG - Intronic
992805576 5:80334091-80334113 CTTGGGGGTCAGATGGGGTAAGG - Intergenic
995836745 5:116407013-116407035 TTAGGTGCACAGAAGGGCCAAGG - Intronic
999251293 5:150183824-150183846 CTTACTGCACAGATGGGCCAAGG - Exonic
1001518467 5:172373715-172373737 CCTGGTGCACAGTTGGTGCTCGG + Intronic
1002132824 5:177091918-177091940 CTTGGTGAGCAGGTGGGTCAGGG + Intronic
1006328511 6:33372432-33372454 GGTGGTGCCCAGATGGGCCATGG + Intergenic
1007933423 6:45712635-45712657 CTTGGGGTACAAGTGGGGCATGG - Intergenic
1008010862 6:46466273-46466295 TTTGGTTTTCAGATGGGGCATGG + Intronic
1008446175 6:51594832-51594854 CTTGGGGCACTGATGGGACTTGG - Intergenic
1009028709 6:58031256-58031278 GTTGGTGCACACATGGGCCCAGG + Intergenic
1009204242 6:60782643-60782665 GTTGGTGCACACATGGGCCCAGG + Intergenic
1009398417 6:63228715-63228737 CTCACTGCCCAGATGGGGCAGGG + Intergenic
1013951221 6:115784156-115784178 TCTGGTGCAGAGATTGGGCATGG + Intergenic
1014289248 6:119539568-119539590 CTTGGAGCAAAGTTGGGGCCAGG + Intergenic
1017013341 6:150080008-150080030 CTTGGAGGGCAGATGGGGGAAGG - Intergenic
1018030199 6:159835686-159835708 CTGGCTGCCCAGATGGGGTAGGG + Intergenic
1019275449 7:173269-173291 CTGTGTCCACAGATGGGGCAGGG + Intergenic
1019442549 7:1054782-1054804 CTCCGTGCACAGAAGGGACATGG - Intronic
1020749289 7:12120168-12120190 CATAGTGAACAGATGGGGGATGG + Intergenic
1022028104 7:26467263-26467285 CCTGGTGCACAGGAGGGGCTCGG + Intergenic
1022175086 7:27864782-27864804 CTTGGTTAACGGATGGGGAAAGG - Intronic
1022970285 7:35510794-35510816 CTTGATGGACAGATGTGGCAAGG + Intergenic
1023153065 7:37220805-37220827 CTTCTTTCACAGATGGGGAAAGG + Intronic
1023180381 7:37476402-37476424 TTTGGTGCCCAGAATGGGCAAGG + Intergenic
1024907286 7:54400771-54400793 CTATGTTCAGAGATGGGGCATGG - Intergenic
1028471680 7:91212927-91212949 CATGCTGCACAGATGGCGTAAGG + Intergenic
1029527662 7:101104866-101104888 CTTGGTGTTTAGATGGGGAAGGG + Intergenic
1030087874 7:105832573-105832595 GTTGGTGCACAGAAGGTGCAGGG - Intronic
1033274341 7:139959909-139959931 CATGGAGCAGAGCTGGGGCAGGG - Intronic
1034149712 7:148905386-148905408 CTTGGTCCACAGAGCAGGCAGGG + Intergenic
1035279111 7:157766164-157766186 ATTGGTGGACAGATGGGGGATGG - Intronic
1035734250 8:1876311-1876333 CTCGGGGTACAGATGGGGCAGGG + Intronic
1035756049 8:2033870-2033892 CTGGGAGCTCAGATAGGGCAAGG - Intergenic
1037613095 8:20492993-20493015 ATTGGTGTTCAGATGGAGCATGG - Intergenic
1039561291 8:38514298-38514320 CCTGCTGAACAGATGGTGCAGGG + Intronic
1040528200 8:48242899-48242921 CTTGTTGTACAAATGGGCCATGG - Intergenic
1043285559 8:78525151-78525173 CTGGGTAAACAGATGGTGCATGG - Intronic
1043722319 8:83560462-83560484 AGTGATGCACAGATGGGTCAGGG + Intergenic
1043865048 8:85365033-85365055 GTGGGTGGTCAGATGGGGCAGGG + Intronic
1047206024 8:122803425-122803447 CCTGGTCTAGAGATGGGGCAGGG - Intronic
1048054922 8:130854239-130854261 GTTGGTGCACATAAGAGGCAAGG + Intronic
1048269764 8:133019270-133019292 CTTGGAGCAAAGAAGGGCCAAGG + Intronic
1050686175 9:8171803-8171825 TTTGGTGAAAAGGTGGGGCACGG - Intergenic
1052955842 9:34252730-34252752 CTTGGTCCACAGACGGAGCTGGG - Exonic
1056577663 9:87868599-87868621 CTTGGTGGGCAGGTGGGGCAAGG - Intergenic
1056932238 9:90888880-90888902 AATGGTGGAGAGATGGGGCAAGG + Intronic
1058663202 9:107284042-107284064 ATGGGTGCACAGGTGGGGGAGGG + Intronic
1059304922 9:113346668-113346690 CTTGATGAACAGATAGGGAAAGG + Intergenic
1060487069 9:124054510-124054532 CCTGAGGCACAGCTGGGGCAAGG - Intergenic
1060944564 9:127562252-127562274 CGTGGTGCCCAGACTGGGCAGGG - Intronic
1061938529 9:133871878-133871900 CTGGGGGCTCAGAAGGGGCAGGG - Intronic
1062521284 9:136959033-136959055 CCTGGTGCAGACATGGGGAAAGG - Intergenic
1062679485 9:137770746-137770768 CTGGGTGCTCAGAGGAGGCAGGG - Intronic
1203632462 Un_KI270750v1:81738-81760 CCTGGTGTACACATGGGGCCTGG - Intergenic
1185716777 X:2349002-2349024 CTTTTTGCACAGCTGGGACAGGG + Intronic
1196046543 X:111261732-111261754 CTTGGTGCACTTCTGGGGAATGG + Intronic
1197562982 X:128047347-128047369 CTTGGTGGGCAGAAGAGGCAGGG + Intergenic
1198962497 X:142197018-142197040 GTGCGTGCACACATGGGGCAGGG - Intergenic
1198965942 X:142228884-142228906 GTTCCTGCACAGATGGGACATGG - Intergenic
1199819130 X:151427306-151427328 CTTGGTGCAGAGGTGAAGCATGG + Intergenic
1200078321 X:153562942-153562964 CATGGTGGACAGAGGGAGCAAGG + Intronic