ID: 1151545159

View in Genome Browser
Species Human (GRCh38)
Location 17:74788392-74788414
Sequence CTGTCCTTCCAGAGGCTGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 399
Summary {0: 1, 1: 0, 2: 1, 3: 37, 4: 360}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151545151_1151545159 13 Left 1151545151 17:74788356-74788378 CCTGTGTCCTTGCAAGGTTGACG 0: 1
1: 0
2: 0
3: 7
4: 80
Right 1151545159 17:74788392-74788414 CTGTCCTTCCAGAGGCTGGGGGG 0: 1
1: 0
2: 1
3: 37
4: 360
1151545152_1151545159 6 Left 1151545152 17:74788363-74788385 CCTTGCAAGGTTGACGTGAAAGC 0: 1
1: 0
2: 0
3: 3
4: 53
Right 1151545159 17:74788392-74788414 CTGTCCTTCCAGAGGCTGGGGGG 0: 1
1: 0
2: 1
3: 37
4: 360
1151545149_1151545159 20 Left 1151545149 17:74788349-74788371 CCACTCGCCTGTGTCCTTGCAAG 0: 1
1: 0
2: 1
3: 9
4: 140
Right 1151545159 17:74788392-74788414 CTGTCCTTCCAGAGGCTGGGGGG 0: 1
1: 0
2: 1
3: 37
4: 360

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151545159 Original CRISPR CTGTCCTTCCAGAGGCTGGG GGG Intronic
900292396 1:1929044-1929066 CTGTCCCCCAGGAGGCTGGGCGG + Intronic
900537782 1:3187350-3187372 CGGGCACTCCAGAGGCTGGGAGG - Intronic
902040780 1:13490783-13490805 CTGACCATCCAGAGGCCGTGTGG - Intronic
902697523 1:18150339-18150361 CCTTCCTTACGGAGGCTGGGAGG + Intronic
902958162 1:19941162-19941184 CTGTCCTTCCCAAGGCCTGGTGG + Intergenic
903886172 1:26542346-26542368 CTGTCCTTGCAGAGTCTCTGCGG - Intronic
904396754 1:30227524-30227546 CTTTCCTTGGAAAGGCTGGGAGG - Intergenic
904507953 1:30974657-30974679 CTGTCCTTGCTGAGCCTGTGGGG + Exonic
905522625 1:38612223-38612245 TGGTCCTTCCAGAGCTTGGGTGG + Intergenic
905872804 1:41414826-41414848 CTGTCCCTGCTGAGGCTGGGGGG + Intergenic
906197351 1:43937106-43937128 CTGTCCCTACAGGGCCTGGGCGG - Exonic
906279924 1:44546222-44546244 CTGGCCATGAAGAGGCTGGGTGG - Intronic
906546154 1:46620804-46620826 CAGTCCCTCCAGAGACGGGGAGG + Intergenic
907714165 1:56912311-56912333 CAGGCCTTCCAGAAGCTTGGTGG + Intronic
907975083 1:59423719-59423741 ATGACCTGCCAGAAGCTGGGTGG - Intronic
908175835 1:61554311-61554333 CAGTCCTTCCTGGGACTGGGTGG - Intergenic
908187939 1:61670592-61670614 CTGTCCTTCCGGAGGCTGTAGGG - Intergenic
914463915 1:147909356-147909378 CTGTCCAACCAGAGGCTGGTGGG - Intergenic
915950439 1:160186657-160186679 CTTCTCTTCCACAGGCTGGGTGG + Exonic
916274382 1:162978085-162978107 TTGTTCTTCCAGAGACTGAGAGG - Intergenic
916530042 1:165648242-165648264 CTGCCCCTCCGGGGGCTGGGGGG - Intronic
917524898 1:175779882-175779904 GTGGCCTACCAGAGGCTGGAGGG + Intergenic
917825003 1:178809988-178810010 CTGTAGTTCCAGCTGCTGGGCGG + Intronic
919539498 1:198829984-198830006 GCCTCCTTCCAGAGGGTGGGGGG + Intergenic
919590259 1:199493568-199493590 CTGTTCCTCCCCAGGCTGGGTGG - Intergenic
919699539 1:200617531-200617553 CTGACCTTCCAAAGGCAGAGAGG + Intronic
919704040 1:200659439-200659461 GTGACATTCCTGAGGCTGGGAGG + Intronic
920185424 1:204156391-204156413 ATGTCCTTCCTGAGTGTGGGTGG + Intronic
920212282 1:204336894-204336916 CTGCCCTGCCAGAGCCTTGGAGG - Intronic
920252924 1:204633993-204634015 ATTTCCTTCCACAGGCTTGGGGG - Intronic
920692831 1:208159843-208159865 CTGTGCTTCCAGAGCCAGGGAGG + Intronic
920920342 1:210292839-210292861 CTGCCCCTCCTGAGGCGGGGGGG - Intergenic
924917652 1:248590267-248590289 TTGTCCTTCCGGGGCCTGGGCGG - Intergenic
1062862430 10:821394-821416 ATGTGGTTCCTGAGGCTGGGAGG - Intronic
1064017477 10:11783795-11783817 CCGCCCTGCCAGAGGCTGGGCGG - Intergenic
1064218627 10:13420789-13420811 CTGTCACTGCAGAGGCTGGCAGG - Intergenic
1064275522 10:13901782-13901804 CTGTTCTCCCTGGGGCTGGGAGG - Intronic
1064944251 10:20770560-20770582 CTGAGCTTCCTGAGGCAGGGTGG + Intergenic
1066272750 10:33839445-33839467 CTTGCCTTCCAGAGACTGTGAGG - Intergenic
1067420440 10:46140839-46140861 CTGTCTTTCCAGTGGCTGCCAGG - Intergenic
1067425581 10:46208694-46208716 CTGTCTTTCCAGTGGCTGCCAGG + Intergenic
1067505784 10:46847320-46847342 CTGTCTTTCCAGTGGCTGCCAGG - Intergenic
1067552344 10:47244781-47244803 CTGACCTGCCTGAAGCTGGGGGG + Intergenic
1067919453 10:50438491-50438513 CTGTCTTACCTGAGGCTGGATGG - Intronic
1069823706 10:71242644-71242666 CTGTCCCTGCAGAGGGTTGGCGG + Intronic
1070562096 10:77575819-77575841 CTGGCCTTCCAGTGGCTCTGAGG - Intronic
1071297751 10:84234441-84234463 CTGTCCTTCCAGAGGGGAAGGGG - Intronic
1071359404 10:84830796-84830818 CTCTGCTTCCAGAGGCTCTGTGG + Intergenic
1072227789 10:93386528-93386550 GGTTCCTTCCTGAGGCTGGGGGG + Intronic
1072789715 10:98309355-98309377 CAGTCCTTCCCGAGGCTTGATGG - Intergenic
1073523990 10:104162457-104162479 CTTTCCTTCCACATACTGGGAGG + Intronic
1074154336 10:110785201-110785223 CTGACATGCCACAGGCTGGGAGG + Intronic
1074389109 10:113042184-113042206 CATTCCTTCCAGAGCCTGTGTGG + Intronic
1074509445 10:114099439-114099461 CCTTCCTTCCCGAGGCAGGGAGG - Intergenic
1075474200 10:122719249-122719271 CTCACCATCCAGAGGATGGGAGG - Intergenic
1076548850 10:131264359-131264381 CTTTCCTTCCTGTGGGTGGGTGG - Intronic
1076745259 10:132509743-132509765 CTCTCCTTCCAGAGGGTGACAGG - Intergenic
1076833289 10:133007552-133007574 CTGGCCTCCCAGGGCCTGGGTGG + Intergenic
1077117747 11:892997-893019 CTCTCCCTCCAGAGGCAGAGAGG - Intronic
1077465741 11:2732916-2732938 CTGGGCCTCCAGAGGGTGGGTGG - Intronic
1077529944 11:3090379-3090401 CTGCCCTCTCAGAGTCTGGGAGG - Intronic
1079475867 11:20828663-20828685 CTGTCCTACGTGAGACTGGGTGG - Intronic
1079787318 11:24689599-24689621 CTGACATTCCTGAGACTGGGTGG + Intronic
1082187605 11:49203827-49203849 CTGACATTCTAGAGGGTGGGGGG - Intronic
1082904596 11:58292325-58292347 CTGTGCGTGCAGATGCTGGGCGG - Intergenic
1083323600 11:61862407-61862429 CAGTCCAGCCAGAGGCAGGGAGG + Intronic
1084384328 11:68833188-68833210 CTGTCCTTCCAGAGCCTTCCTGG - Intronic
1084609299 11:70191929-70191951 GGGTCCTCCCAGAGCCTGGGAGG + Intergenic
1085016404 11:73176996-73177018 GAGTCCTTCCTGAGGCAGGGTGG + Intergenic
1087097347 11:94331836-94331858 GTGTCCTTTCAGGGGGTGGGGGG + Intergenic
1088689864 11:112316426-112316448 CTGTCCATCCACAGAATGGGTGG - Intergenic
1088738595 11:112748714-112748736 CTGTCAATTCAGGGGCTGGGGGG + Intergenic
1089695844 11:120215922-120215944 CTATCCTCCCTGATGCTGGGAGG - Intronic
1090508041 11:127340598-127340620 GTTTCCTGCCAGAGGCTAGGAGG + Intergenic
1091370795 11:135056387-135056409 CTGTCCCTACAGAGCCTGGGAGG - Intergenic
1091397436 12:162670-162692 CTGTCCCTGCACAGACTGGGAGG - Intronic
1092056099 12:5509622-5509644 CTGTCCTTCCAAAGACTGCAGGG - Intronic
1094361315 12:29634341-29634363 CTGTGCTTCCAGAGATTGGGAGG - Intronic
1100269902 12:93014684-93014706 CTGTCCTTGAAGAGGCAGTGGGG + Intergenic
1100792954 12:98150810-98150832 CTGCTCTTCTAGAGACTGGGAGG - Intergenic
1102455105 12:113066070-113066092 GTGTCAACCCAGAGGCTGGGTGG - Intronic
1102779999 12:115556074-115556096 AGTTCCTTCCAGAGGCTTGGAGG + Intergenic
1103267591 12:119644021-119644043 CTGTCTTTCCACAGGCTGGTAGG - Intergenic
1103792184 12:123479551-123479573 CTGTGAGCCCAGAGGCTGGGAGG - Intronic
1103885808 12:124199218-124199240 CTGTCCTCCCGGAGTCTGAGAGG - Intronic
1103929150 12:124440056-124440078 CTGGCCTCCCAGGGCCTGGGGGG + Intronic
1104946159 12:132415724-132415746 CTGTCCTTGCAGGGGCCTGGTGG - Intergenic
1106132001 13:26948591-26948613 CTGAGCTTCCAGAGGGTGAGGGG - Intergenic
1107399310 13:40053503-40053525 CAGTCATTCCAGAGCCTGGAAGG - Intergenic
1110827609 13:79990842-79990864 CATTCCTTCCAGAAGCTTGGGGG - Intergenic
1112715706 13:102182325-102182347 CTGCCCCTCCAGAGGCTCTGAGG - Intronic
1113375569 13:109762407-109762429 CTGTTCTTCCACAGACTGGCAGG - Intronic
1113499332 13:110760784-110760806 CTGTACTTCCAGAGGATTGAGGG + Intergenic
1113587565 13:111475723-111475745 CTGTCCTGCTGGGGGCTGGGAGG + Intergenic
1113741813 13:112716496-112716518 CCGTCCTCCCAGAGGCGGAGGGG - Intronic
1113778518 13:112962707-112962729 CTTCCCTCCCAGAGCCTGGGGGG - Intronic
1116849627 14:49894275-49894297 CTCTCCTTCCAGGGGATGGGTGG - Exonic
1117970725 14:61248446-61248468 CTGCCCTTCCACAGGTTGAGTGG - Intronic
1118808269 14:69256266-69256288 CTGTCCTGCCCGTGGGTGGGTGG - Intergenic
1119610153 14:76054906-76054928 CTGTCCTCACACAGTCTGGGAGG + Intronic
1119890274 14:78177235-78177257 TTGTGTTTCCAGAGGCTGGTTGG + Intergenic
1120566893 14:86071216-86071238 CTGTCATGCAAGAGGTTGGGGGG + Intergenic
1121751160 14:96358175-96358197 CTGTAATTCCAGAAACTGGGGGG + Intronic
1122144916 14:99683603-99683625 CTGTTCTCCCAGAGACTCGGGGG - Intergenic
1122464687 14:101923256-101923278 CTGTCCTTTCAGAAGCTCTGGGG + Intronic
1122634499 14:103123697-103123719 CGGGCCTGCCAGAGGCAGGGAGG + Exonic
1122767276 14:104081247-104081269 CTGGCCTTCCAGAGGCAGAGGGG - Intergenic
1122922871 14:104887163-104887185 CTGTGCCCGCAGAGGCTGGGGGG - Exonic
1123098400 14:105777137-105777159 CCGTCCTCCCCCAGGCTGGGAGG - Intergenic
1123201783 14:106673050-106673072 CTGTATTTCCAGATACTGGGAGG + Intergenic
1124487140 15:30128504-30128526 CTGGCCTTACAGTGTCTGGGTGG + Intergenic
1124542226 15:30597479-30597501 CTGGCCTTACAGTGTCTGGGTGG + Intergenic
1124548931 15:30659584-30659606 CTGTCCTTATAGTGTCTGGGTGG + Intronic
1124756385 15:32409819-32409841 CTGGCCTTACAGTGTCTGGGTGG - Intergenic
1125806136 15:42495459-42495481 CAGTCCTGCCCGAAGCTGGGAGG - Exonic
1125821167 15:42633018-42633040 CTGTAGTTCCAGCTGCTGGGGGG + Intronic
1126295089 15:47130411-47130433 GTGTCCTTCCTGGGGGTGGGTGG + Intergenic
1126385336 15:48088218-48088240 CAGACCTTTCAGAGGCTGGTGGG + Intergenic
1126408047 15:48343157-48343179 CTGTGCTTCCACAAACTGGGTGG - Exonic
1126634127 15:50765424-50765446 CAGGCCTCCCAGGGGCTGGGCGG - Intronic
1127286704 15:57539371-57539393 CTGTCCCTCCACTTGCTGGGTGG + Intronic
1127981360 15:64037657-64037679 CTGTCCCTTCAGAAGCTGAGTGG + Intronic
1128159988 15:65417254-65417276 CTCTCCTTCCAGCTGTTGGGGGG - Intronic
1128783803 15:70380083-70380105 ATGTGCTTCCTGAGGCTTGGAGG - Intergenic
1129771192 15:78204514-78204536 CTGTCCAGGCAGGGGCTGGGTGG + Intronic
1129823385 15:78619503-78619525 GTGTTCTCCCGGAGGCTGGGAGG - Intronic
1132076820 15:98828387-98828409 CTGTCCATCCATAGGATGGTTGG + Intronic
1132372734 15:101309488-101309510 CTGTCCTTCCAGAATGTGGCAGG - Intronic
1133217064 16:4299068-4299090 CACTCCCTCCAGGGGCTGGGAGG - Intergenic
1133302558 16:4791652-4791674 CTGTCCTGCCTGGGACTGGGCGG + Intronic
1133805891 16:9125827-9125849 CTGTCCTTGCATAGGCTGCTGGG + Intergenic
1134096266 16:11420936-11420958 CTGTCATCCCAGAGGGTGGGTGG - Intronic
1134217498 16:12327390-12327412 CTCACCTTCCGGAGGCTGGAAGG + Intronic
1135064907 16:19301242-19301264 CTGTTCTCCCAGGGGCTGGCTGG - Intronic
1136556925 16:31012379-31012401 CTGTGCTTTGAGTGGCTGGGTGG - Intergenic
1136584944 16:31178748-31178770 CTCTCCTTCCAAAGGCGGTGGGG + Intergenic
1136929619 16:34407376-34407398 CTGTCACTGCAGAGGCTGGCAGG + Intergenic
1136974955 16:35004428-35004450 CTGTCACTGCAGAGGCTGGCAGG - Intergenic
1137248192 16:46722353-46722375 CTGTCCCCCCAGAGGGTGTGAGG + Intronic
1138343242 16:56304528-56304550 TTGTCCTTTCAGGGGCTGTGAGG - Intronic
1138385142 16:56631481-56631503 CTTTCCTTTAAGAGGCTGGCTGG + Intergenic
1138426521 16:56937227-56937249 GTGTCCTTCCAAAGACTTGGGGG + Intronic
1139433628 16:66924277-66924299 CTTCCCTACCAAAGGCTGGGGGG + Intronic
1140809843 16:78566553-78566575 CTGTCTGTGCTGAGGCTGGGAGG + Intronic
1141637309 16:85321113-85321135 CTGTCCTTCCAGTTGCCTGGAGG - Intergenic
1141802914 16:86323258-86323280 CTGTGAATCCAGGGGCTGGGGGG + Intergenic
1144970810 17:19108330-19108352 CTGCCCTTGCAGAGGTTTGGAGG - Intergenic
1144991112 17:19234492-19234514 CTGCCCTTGCAGAGGTTTGGAGG - Intronic
1145264015 17:21370851-21370873 CTGTCCCTTTAGAGGCAGGGAGG + Intergenic
1145863947 17:28228240-28228262 CTGTCCAGCCCCAGGCTGGGTGG - Intergenic
1146891763 17:36510903-36510925 CCGTCCTGACAGAGTCTGGGAGG + Exonic
1147263073 17:39219965-39219987 CTGGCCTCCCGGAGGCTGGTGGG - Intronic
1147317859 17:39629390-39629412 CTCTCCCTCCTGCGGCTGGGAGG - Intronic
1147325505 17:39667789-39667811 CTGTCCTTTCTGGGGCGGGGTGG + Intergenic
1148027784 17:44600335-44600357 CTGGCTTCCCAGAGGCTGGAGGG + Intergenic
1149440722 17:56671535-56671557 CTGTGGTTCCAGAGACTGGTAGG + Intergenic
1151025502 17:70671834-70671856 CGGTCCATCCAGAGGCTCGAGGG - Intergenic
1151545159 17:74788392-74788414 CTGTCCTTCCAGAGGCTGGGGGG + Intronic
1152077463 17:78168446-78168468 CTGCGCTTCTAGAGGCGGGGAGG - Intergenic
1152291301 17:79441579-79441601 AACTCCTTCCAGAGGCTTGGAGG - Intronic
1152516005 17:80825283-80825305 CTCTCCCTCCAGAGGCCGCGTGG + Intronic
1152604705 17:81283265-81283287 CTGTCATTCTAGGGGCTTGGTGG - Intronic
1153232026 18:2947373-2947395 TTGTCCTTCTAGAGGATGGATGG - Intronic
1153659553 18:7314923-7314945 CTCTCCTTGGAGAAGCTGGGAGG - Intergenic
1153942641 18:9991010-9991032 CTGGCTTCCCAGAGGATGGGAGG + Intergenic
1154130620 18:11734070-11734092 CCATCTTTCCAGAGGCTCGGTGG + Intronic
1156493719 18:37512098-37512120 CTGTCCTTCGCTGGGCTGGGAGG + Intronic
1158090932 18:53712463-53712485 CTGTAGTCCCAGAGGCTGAGGGG - Intergenic
1160238656 18:77106404-77106426 CAATCCTTCCAGTGGCTGTGGGG - Intronic
1161054310 19:2182292-2182314 CAGTGCTTTGAGAGGCTGGGAGG + Intronic
1162490662 19:10989426-10989448 CTGAACTTCCAGAGGCAGGTGGG + Exonic
1162853987 19:13454189-13454211 CTGCCCTCCCAGAGGTTGGGGGG + Intronic
1162959871 19:14119162-14119184 CTATCCATCCAGAGGCGGAGTGG - Intergenic
1163189997 19:15670619-15670641 CTGTCCTTGCAGAGGTAGTGGGG + Intergenic
1163214398 19:15864963-15864985 GTTTCCTTCCAAGGGCTGGGTGG - Intergenic
1163521474 19:17794621-17794643 CTGTACTTCCAGAGGCCGAGGGG - Intergenic
1163814469 19:19455745-19455767 CTGTCCCTCCAGACCCTTGGAGG - Intronic
1163984988 19:20937812-20937834 CTGCCCTTCCAGAGTCCTGGAGG - Intronic
1164008043 19:21169922-21169944 CTGCCCTTCCAGAGACCTGGAGG - Intronic
1164102994 19:22075493-22075515 CTGTCCTTTCACAGGCCTGGAGG - Intronic
1164116358 19:22223063-22223085 CTGCCCTTCCAGAGGCCTGGAGG - Intergenic
1164141230 19:22466280-22466302 CTGCCCTTCCAGAGGCCTGGAGG - Intronic
1164224395 19:23229315-23229337 CTGCCCTTCCAGAGGCCTGGAGG + Intronic
1164239563 19:23372665-23372687 CTGCCCTTCCAGAGGCCTGGAGG + Intronic
1164253224 19:23503249-23503271 TTGCCCTTCCAGAGGCCTGGAGG + Intergenic
1164297197 19:23922455-23922477 CTGCCCTTCCAGAGGCCTGGAGG - Intronic
1164703371 19:30302261-30302283 CTGTCCGTCCTGCGGCAGGGAGG + Intronic
1166055460 19:40285389-40285411 ATTTCCGTCCAGAGGGTGGGAGG - Exonic
1166074837 19:40408023-40408045 CTGTCCTCCCACAGGCTCAGAGG - Exonic
1168152353 19:54455912-54455934 CTGTCCTGCCAGTGTCTGGCGGG + Intronic
1168476370 19:56678371-56678393 CTGTCCTGGCAGAGGATGAGAGG - Intergenic
925941208 2:8821293-8821315 CTGTCTTTCTAGATACTGGGTGG - Intronic
927813212 2:26191953-26191975 CTGTCCTTCCAGCGGCTCTCTGG + Intronic
928601525 2:32908554-32908576 CGGTCTTTCCAGAGTCTGGGAGG + Intergenic
929039920 2:37734310-37734332 GTTTTCTTCCAGATGCTGGGAGG + Intronic
929946637 2:46377121-46377143 CTGTCCTTCCAGACCCTGGTAGG - Intronic
930697796 2:54429886-54429908 CTGTGGATCAAGAGGCTGGGTGG - Intergenic
931628972 2:64282658-64282680 CTCTCCTTCCACAGGCCTGGGGG - Intergenic
931865085 2:66400986-66401008 CTGTCTCTCCAGATACTGGGTGG - Intergenic
932968132 2:76502672-76502694 CTGTCCTTCCTGAGCCTGTCAGG + Intergenic
933831252 2:86211072-86211094 CTACTCTTCCTGAGGCTGGGAGG - Exonic
934705596 2:96476231-96476253 CTGTTCTTCCTGGGGCTGGAGGG - Intergenic
935173008 2:100625255-100625277 CTGTCCGTTCAGAGGCTTTGTGG - Intergenic
936974436 2:118205019-118205041 CTGGCCTTCCAGAGGTTTCGTGG - Intergenic
937157921 2:119734321-119734343 CTGTCATTCCAGGGCCTGGGTGG - Intergenic
938804596 2:134794495-134794517 CTGTTCCAACAGAGGCTGGGAGG + Intergenic
938976017 2:136479727-136479749 CTGTTCCTCCACAAGCTGGGTGG + Intergenic
940838702 2:158554295-158554317 CTGCCCTACCAGAGCCTGGATGG - Intronic
940897500 2:159094813-159094835 CTTTCCTCCTAGAGGCTGTGTGG - Intronic
941790363 2:169546051-169546073 CTGTAATTCCAGCGGTTGGGAGG - Intronic
942427701 2:175877116-175877138 CCTTCCTTCCAGAGGCTGAAAGG - Intergenic
943051060 2:182913854-182913876 CTGTATTTCCACAGGCTGTGGGG - Intronic
943648403 2:190431245-190431267 CTCACCTCCCAGAGGATGGGCGG + Intronic
944546494 2:200804101-200804123 CTGTAATCCCAGAGGTTGGGAGG - Intergenic
944948710 2:204721391-204721413 CAGTCGTTTCAGAGGCTGGAGGG + Intronic
946371163 2:219282111-219282133 CTGTCCTTCCATCAGCTGGGAGG + Intronic
947136459 2:226981040-226981062 TTGGCCTTCCTGAGGCTGGATGG + Intronic
947496697 2:230642990-230643012 CTGCACTTCCAGAGCCTGGTGGG + Intergenic
948056786 2:235014588-235014610 CTGTTCCTCCCGAGGCTGTGAGG + Intronic
948103842 2:235396998-235397020 CTTTCCTTCCAGTGTGTGGGTGG - Intergenic
948383395 2:237566938-237566960 CTGTGCTCCCAGAGGCAGCGGGG - Intronic
948641214 2:239377112-239377134 CTGTCCTCCCAAAGCCGGGGTGG + Intronic
948711044 2:239825761-239825783 CTGTGCCTTCTGAGGCTGGGAGG - Intergenic
948884036 2:240874191-240874213 TTGGCCTCCCAGAGGGTGGGCGG - Intronic
948931584 2:241135755-241135777 TTGTCCCTCCAGAGGCTCAGGGG - Intronic
1169875270 20:10290581-10290603 CTGTGCTTCCAGAGATTAGGAGG - Intronic
1170575168 20:17657185-17657207 CCCTACTTCCAGAGGCTGGCAGG - Intronic
1170593288 20:17787275-17787297 CTGTCCCTCCAAAGGCTGCAGGG + Intergenic
1171164341 20:22957207-22957229 ATGTCCCTGCAGAGGCTGAGAGG + Intergenic
1171545545 20:25997889-25997911 CTGTCCTCCCAGAAGCTGGAGGG - Intergenic
1172134241 20:32676287-32676309 CTGGGCTTCCAGAGGCTGCCAGG - Intergenic
1172929350 20:38573524-38573546 CTGCCTTGCCAGAGGCTGTGAGG + Intronic
1173186049 20:40841132-40841154 TTGTCCCTCCAAAGGGTGGGAGG + Intergenic
1173768891 20:45640595-45640617 GTCTCCTTCCAGAGGTCGGGGGG + Intergenic
1173938576 20:46890541-46890563 CTGTCCTTGCAGTGGCTGCCTGG + Intergenic
1174395097 20:50242508-50242530 CTTTCCCTCCAGAAGGTGGGTGG + Intergenic
1175249160 20:57598353-57598375 CTGACCAGCCAGGGGCTGGGAGG + Intergenic
1175790797 20:61738721-61738743 TGGTTCTTCCCGAGGCTGGGAGG - Intronic
1175874341 20:62222283-62222305 CTGTCCCTCCTGAGGCTCTGGGG - Intergenic
1175885541 20:62288384-62288406 CTGTGGGTGCAGAGGCTGGGAGG + Intronic
1175885547 20:62288407-62288429 CTGTGGGTGCAGAGGCTGGGAGG + Intronic
1175885565 20:62288475-62288497 CTGTGGGTGCAGAGGCTGGGAGG + Intronic
1175885577 20:62288520-62288542 CTGTGGGTGCAGAGGCTGGGAGG + Intronic
1175885589 20:62288565-62288587 CTGTGGGTGCAGAGGCTGGGAGG + Intronic
1175922629 20:62457258-62457280 CTGTCCTGCCACAGGTGGGGAGG - Intergenic
1176516043 21:7784127-7784149 CTCTCCTTCCTAAGGCTGGGAGG + Intergenic
1178533414 21:33393504-33393526 TGGTCCTTCCAGAGGCTCTGGGG - Intergenic
1178635329 21:34297568-34297590 CTGTCCTTCCTGACCCTGGAGGG - Intergenic
1178650071 21:34414139-34414161 CTCTCCTTCCTAAGGCTGGGAGG + Intergenic
1179412482 21:41172877-41172899 CTGTCCCTCCGGAGGCTCTGGGG + Intronic
1180057598 21:45366990-45367012 CTGACCCTCCAGAGCCTGGAGGG - Intergenic
1180183785 21:46129612-46129634 CAGTCCTTCCAGGGGCTCTGGGG + Intronic
1180597497 22:16988290-16988312 CTGTCCTCCCAGAGGAGGGCTGG + Intronic
1181165982 22:20983171-20983193 CTGTCCTTTCAGATGCTAGCTGG + Intronic
1181492556 22:23269592-23269614 CTGTTCTTCCAGAGTCTGTGGGG + Intronic
1181947287 22:26528114-26528136 CTGTCCTTCCAGAGCCTCCCTGG - Intronic
1182193447 22:28489033-28489055 CAGCACTTTCAGAGGCTGGGGGG + Intronic
1183070077 22:35390094-35390116 CTGTCCTTACAGGGGCAGTGGGG - Intronic
1183342766 22:37290925-37290947 CTTTCCTCCCAGCAGCTGGGGGG + Intronic
1183986982 22:41575405-41575427 CTCCCCTGCCAGAGGCTGAGAGG - Exonic
1184943961 22:47787944-47787966 CTGCCCTTTGAGAGGCGGGGAGG + Intergenic
1185067772 22:48640601-48640623 CATTTCTTGCAGAGGCTGGGCGG + Intronic
1185169257 22:49282941-49282963 CTGGCCTTCCAGAGGTAGGTGGG + Intergenic
1185213810 22:49587251-49587273 CTATCCTCTCAGTGGCTGGGTGG - Intronic
1185368184 22:50446484-50446506 CTGACCTCACAGAGGCTTGGGGG - Exonic
949395987 3:3615272-3615294 GTGACCTTGCACAGGCTGGGTGG + Intergenic
950475931 3:13214770-13214792 CTGACCTTCCAGATGGTGTGCGG + Intergenic
951342670 3:21508274-21508296 CTGTCCTTTCAGAAGTTGAGTGG - Intronic
951472692 3:23072775-23072797 CTGCCCTCACTGAGGCTGGGGGG + Intergenic
952407288 3:33015825-33015847 CTGTCCTGCCCTAGCCTGGGTGG + Intronic
952809411 3:37387821-37387843 CCATCCTTCCAGAGGCTGTCCGG + Intronic
953786672 3:45916424-45916446 CAGTCCTTCCTGAGGCTTGGGGG - Intergenic
954289560 3:49642515-49642537 CTGCCCCTCCAGAGGTGGGGAGG + Exonic
954432367 3:50477750-50477772 GGGTACCTCCAGAGGCTGGGGGG - Intronic
955182062 3:56682361-56682383 CTCTGCTTTCAGGGGCTGGGAGG + Intronic
956165721 3:66396925-66396947 CTCTCCTTCCAGAGCAGGGGAGG - Intronic
956481308 3:69676430-69676452 CTATTATTCCAGAGGCAGGGTGG + Intergenic
959184183 3:103023587-103023609 CTGTCCATGCAGAGGCTCTGAGG - Intergenic
960953338 3:123013725-123013747 GTGTGCTTCCAGAGGCTGGATGG - Intronic
961003755 3:123391048-123391070 CTGCCCCTCCAGGGGCTTGGGGG + Intronic
961433261 3:126898180-126898202 CTGTCCTTCCAAAGTCAGGCTGG + Intronic
962275699 3:134011781-134011803 TTGTCCTTTTAGAGGCTGGAGGG + Intronic
962504018 3:136027825-136027847 CTGTGCTTCAAGAGGCAGAGGGG + Intronic
962702147 3:138010262-138010284 CTGTCCATCCTGGGGCTGGCCGG + Exonic
963103074 3:141623840-141623862 AAGTCCTTACTGAGGCTGGGCGG - Intergenic
964384286 3:156130815-156130837 CTGTCTATCAAAAGGCTGGGAGG + Intronic
964394781 3:156234063-156234085 CTGACAATCCTGAGGCTGGGTGG + Intronic
964558498 3:157967120-157967142 CAGTCCTTCTAGAGGCTCTGAGG + Intergenic
965371180 3:167864073-167864095 CTGTCCTTCCACAGGAAGGTGGG - Intergenic
966287720 3:178317206-178317228 CTGTACTTCCAAATGCTGGCTGG - Intergenic
968489256 4:881274-881296 CTGCTCTTTCAGAGGCTAGGAGG + Intronic
968653579 4:1769392-1769414 CTGCCTTTCCAGAGGCAAGGGGG - Intergenic
973705052 4:53572913-53572935 CTGTCCTTCAAGAAGGTGTGAGG - Intronic
975364438 4:73512271-73512293 TTGCCATGCCAGAGGCTGGGAGG - Intergenic
976113834 4:81705701-81705723 CTCTCCCTCCAGAGGCTCTGGGG + Intronic
981420677 4:144546682-144546704 CTTTCTTTCCAGGGGGTGGGTGG + Intergenic
983795300 4:171854636-171854658 CTATTTTTCTAGAGGCTGGGAGG + Intronic
985845188 5:2339330-2339352 CTGTCCCTCCAGGGGCTTTGGGG + Intergenic
986269494 5:6218488-6218510 CCATGCATCCAGAGGCTGGGAGG - Intergenic
987274323 5:16345966-16345988 CTGACATTCCTGAGGTTGGGCGG + Intergenic
987516605 5:18918288-18918310 CTGTCCTTCCTTGGCCTGGGTGG + Intergenic
990365594 5:55067021-55067043 CTGTACTAACAGAGGCTGTGGGG - Intergenic
992071630 5:73154185-73154207 CAGCCCTTCCAGAGACAGGGTGG - Intergenic
992686018 5:79200232-79200254 CTGTGGTTCCAGCTGCTGGGAGG - Intronic
994210226 5:97079582-97079604 CTGTTCTACTAGAGGCAGGGTGG + Intergenic
994516317 5:100776760-100776782 CTCACCATCCAGAGGCTGGGAGG - Intergenic
996362972 5:122670867-122670889 CTGGCCTTTCAGAGGGTGGAAGG - Intergenic
997434615 5:133865407-133865429 CTCTCATTCCAGAGCCCGGGTGG - Intergenic
997817705 5:137034650-137034672 TTGTCCATCCTGAGGCTAGGAGG + Intronic
998538771 5:142959544-142959566 CGCTGCCTCCAGAGGCTGGGAGG - Intronic
1001030903 5:168262092-168262114 CTGTCCTTCCAGAGCCATGAAGG - Exonic
1001117905 5:168955072-168955094 CTGGCCTTCCTGATGTTGGGGGG + Intronic
1001270921 5:170311051-170311073 CTGTCATACCAGAGGCAGGATGG - Intergenic
1001731737 5:173965223-173965245 CTGTCGTTCCAGCTGCTGCGGGG + Intergenic
1002767799 6:257880-257902 CTGTCCTGCCTGTGGGTGGGTGG - Intergenic
1003017646 6:2480980-2481002 CTGTCCTGCCAGAGCCCTGGGGG + Intergenic
1004379000 6:15116047-15116069 CTGTCCTTCCAGTTCCTTGGTGG - Intergenic
1005317921 6:24622101-24622123 CTCTCCTTCCAGTGGCTGCCTGG + Intronic
1006022546 6:31125993-31126015 CTGTGCTTGCAGGGGGTGGGGGG - Intronic
1006083404 6:31580385-31580407 CTGGCCATTCAGAGGCAGGGAGG + Intergenic
1006111936 6:31752314-31752336 CTGTAATTCCAGAACCTGGGAGG + Intronic
1006249191 6:32766165-32766187 CTGTCCCCACAGAGGCCGGGTGG - Intergenic
1006644311 6:35505712-35505734 CTGGGCTTCCTGGGGCTGGGGGG - Intronic
1006894396 6:37457816-37457838 CTGTCCAACCAAAGGCTGGGGGG - Intronic
1007048788 6:38804592-38804614 GTCTCCTTCGAGAGTCTGGGTGG - Intronic
1007074280 6:39056908-39056930 CAGTCCATGCACAGGCTGGGAGG - Intronic
1007224928 6:40306954-40306976 CTGTGCTTCCAGCCCCTGGGAGG + Intergenic
1007702833 6:43774424-43774446 CTGTCCTCTCAGGGGATGGGTGG + Intronic
1009868266 6:69424942-69424964 CAGTCCTTCCGGGGGCTGGGCGG + Intergenic
1010103576 6:72140974-72140996 CTATCCTTCCACAGGATGGCAGG + Intronic
1010839109 6:80626318-80626340 CTGTAGTTCCAGCTGCTGGGAGG + Intergenic
1011560657 6:88610853-88610875 CTGCCTTTCCACAGGCTCGGAGG + Exonic
1013300636 6:108801941-108801963 CTGTGCTGCTAGTGGCTGGGTGG + Intergenic
1015758077 6:136628367-136628389 CTGTACTCCCAGTGGTTGGGAGG - Intronic
1017590604 6:155974657-155974679 CCGTACTGCCAGATGCTGGGAGG + Intergenic
1018711676 6:166501769-166501791 CTGTTCTTCCAGATGCTGGGAGG + Intronic
1019140071 6:169937419-169937441 CTGACCTTCCAGATACTGTGCGG + Intergenic
1019311851 7:366145-366167 CTGTGCTATGAGAGGCTGGGAGG - Intergenic
1021806680 7:24364148-24364170 CTGTTATTCTGGAGGCTGGGTGG - Intergenic
1024445965 7:49479402-49479424 CTGTCATTCTTGAGGGTGGGGGG + Intergenic
1024707084 7:51972560-51972582 GTGTCATCCCAGAGGCTGGAAGG + Intergenic
1025773957 7:64541776-64541798 GTGCCCTTCCAGAGGCCTGGAGG + Intronic
1025791747 7:64694228-64694250 CTGTCTTTCCAGAGGCCTGGAGG - Intronic
1025866912 7:65390875-65390897 CTGCCCTTCCAGCGGCCTGGAGG - Intronic
1026229580 7:68471371-68471393 CAGTCCTGCCAGAGGCTGCTGGG - Intergenic
1026422902 7:70258970-70258992 CGGGCCCTCCAGAGTCTGGGAGG + Intronic
1028029915 7:85897802-85897824 CTCTATTTCCAGAAGCTGGGTGG - Intergenic
1029308256 7:99638207-99638229 CTCTCCTTCCAGGGGATGGGTGG + Intergenic
1030280694 7:107771542-107771564 CTGTCCTGCCAGAGTCAGGGAGG + Intronic
1034275052 7:149820330-149820352 GTGTCCACCCAGAGGATGGGTGG - Intergenic
1036434762 8:8723273-8723295 CAGACCTCCCAGTGGCTGGGAGG - Intergenic
1036447112 8:8831015-8831037 CTCACAGTCCAGAGGCTGGGAGG + Intronic
1037403052 8:18512939-18512961 CAGTTATTCCAGGGGCTGGGAGG - Intergenic
1037948960 8:23006652-23006674 CTGTTCTTCCACAGGCTGGAGGG - Intronic
1038671461 8:29586458-29586480 CATTCCTTCCAGAAGGTGGGAGG + Intergenic
1038745434 8:30250527-30250549 CTGTCTTTCCAATGGCCGGGGGG - Intergenic
1039466220 8:37787199-37787221 CTGTCATTCCAGTGTTTGGGAGG + Intronic
1040697796 8:50023122-50023144 CTGTTCTTCCAGAGCCTGAAAGG - Intronic
1042693711 8:71532263-71532285 CTGTGCTTTCAGTGGATGGGAGG - Intronic
1044725906 8:95193999-95194021 CATTCCTTCCAGAGGCTCCGGGG - Intergenic
1045231525 8:100310665-100310687 CTGTCTTTGCAGAGGCTGTTAGG + Intronic
1045777838 8:105826688-105826710 CTGGCCATCCATAGCCTGGGAGG + Intergenic
1047039518 8:120977342-120977364 CTTTCCTAACTGAGGCTGGGAGG - Intergenic
1047495422 8:125405380-125405402 CTGTGCTTCCAGCGGCTGCGTGG + Intergenic
1049319040 8:141986193-141986215 GTGCCCTCCCAGGGGCTGGGCGG + Intergenic
1049454183 8:142678644-142678666 CTCTCCTGCCAGTGGCTGGGTGG - Intronic
1049454198 8:142678705-142678727 CTCTGCTGCCAGTGGCTGGGTGG - Intronic
1049808505 8:144552345-144552367 CTGTCCCTGCAGAGCCTGGACGG + Intronic
1051590975 9:18776769-18776791 CTCTCCTTCCAGGGCCCGGGCGG + Exonic
1052127324 9:24793078-24793100 CTGGCCTTTCAGGGGTTGGGGGG + Intergenic
1053014324 9:34653479-34653501 CTGTGCTTCCAGGGGAAGGGAGG - Intronic
1053310587 9:37016159-37016181 TTGTAGTTCAAGAGGCTGGGTGG - Intronic
1053416211 9:37948422-37948444 CTGCCCTTCCAGAAGATGAGGGG - Intronic
1056586853 9:87932714-87932736 CTGTCCTTCCTGTGTCTTGGAGG - Intergenic
1057270453 9:93647381-93647403 CTGTCCCTGCAGAAGCAGGGAGG + Intronic
1060876640 9:127088830-127088852 CAGTTCATCCTGAGGCTGGGAGG - Exonic
1061199793 9:129131206-129131228 CTGACCTTCCAGAGTCTCTGTGG + Intronic
1061396937 9:130348547-130348569 CCGTCCTCCCGGATGCTGGGGGG - Intronic
1061447405 9:130648185-130648207 CTGTAGTTCCAGCTGCTGGGAGG - Intergenic
1061566750 9:131445887-131445909 CTGTCCTTCCAGTGGAGGTGTGG - Intronic
1061599554 9:131658510-131658532 CATTCCTTCCAGAGGAAGGGTGG + Intronic
1062265261 9:135683957-135683979 CTGTCATTGCAGAGGAGGGGAGG - Intergenic
1062307675 9:135918843-135918865 CAGCCATTCCAGTGGCTGGGAGG - Intergenic
1062610306 9:137370485-137370507 CTCTGCTGCCAGAGGATGGGAGG + Intronic
1186480432 X:9892698-9892720 CTGTTCTTACAGAAGATGGGTGG + Intronic
1189469785 X:41304731-41304753 CTGTTCATCCACAGTCTGGGTGG - Intergenic
1189962716 X:46339928-46339950 CTGTCTTTCCAAAAGCTCGGAGG + Intergenic
1190287816 X:48972218-48972240 CTGCCTTTCCACAGTCTGGGGGG - Intergenic
1191652921 X:63561003-63561025 CTGTGCTTCCAGCGGGTGGTGGG - Intergenic
1191682427 X:63854937-63854959 CTTTGCTTCCAGAGGATGGTGGG - Intergenic
1191831524 X:65420431-65420453 CTGCCCATCCAGATTCTGGGTGG - Intronic
1192165794 X:68826984-68827006 CTGTCCTTCAAGAGGTTGCCAGG - Intergenic
1193568426 X:83109872-83109894 CTGTAATTCCAGAGTTTGGGAGG - Intergenic
1193945438 X:87728143-87728165 CTGACCTCCCTGATGCTGGGAGG + Intergenic
1196809186 X:119615060-119615082 CTTTCCTTACAGAGGCCTGGAGG - Intergenic
1197923174 X:131617824-131617846 CAATCCTGCAAGAGGCTGGGTGG + Intergenic
1198220585 X:134597698-134597720 CTGTCCATGCAAAGGCTGAGTGG - Intronic
1201060298 Y:10038360-10038382 CAGTACTTCCAGAGGGAGGGAGG + Intergenic
1201482102 Y:14450947-14450969 CTGTACTTCAGGAGGCTGAGGGG + Intergenic