ID: 1151545473

View in Genome Browser
Species Human (GRCh38)
Location 17:74790369-74790391
Sequence AATCTGCGGGGAGCCTCTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 90}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151545473_1151545480 6 Left 1151545473 17:74790369-74790391 CCTGGAGAGGCTCCCCGCAGATT 0: 1
1: 0
2: 0
3: 5
4: 90
Right 1151545480 17:74790398-74790420 TTTCCTGCCCCTGGGTTCTGAGG 0: 1
1: 0
2: 0
3: 42
4: 376
1151545473_1151545478 -3 Left 1151545473 17:74790369-74790391 CCTGGAGAGGCTCCCCGCAGATT 0: 1
1: 0
2: 0
3: 5
4: 90
Right 1151545478 17:74790389-74790411 ATTCTGGCATTTCCTGCCCCTGG 0: 1
1: 0
2: 0
3: 13
4: 206
1151545473_1151545479 -2 Left 1151545473 17:74790369-74790391 CCTGGAGAGGCTCCCCGCAGATT 0: 1
1: 0
2: 0
3: 5
4: 90
Right 1151545479 17:74790390-74790412 TTCTGGCATTTCCTGCCCCTGGG 0: 1
1: 0
2: 2
3: 21
4: 251
1151545473_1151545486 18 Left 1151545473 17:74790369-74790391 CCTGGAGAGGCTCCCCGCAGATT 0: 1
1: 0
2: 0
3: 5
4: 90
Right 1151545486 17:74790410-74790432 GGGTTCTGAGGCAGGCCCTGTGG 0: 1
1: 0
2: 1
3: 48
4: 401
1151545473_1151545482 10 Left 1151545473 17:74790369-74790391 CCTGGAGAGGCTCCCCGCAGATT 0: 1
1: 0
2: 0
3: 5
4: 90
Right 1151545482 17:74790402-74790424 CTGCCCCTGGGTTCTGAGGCAGG 0: 1
1: 0
2: 3
3: 39
4: 399

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151545473 Original CRISPR AATCTGCGGGGAGCCTCTCC AGG (reversed) Intronic
900254507 1:1691023-1691045 AATCTGCGGGAAGCTTAGCCAGG + Exonic
900263258 1:1744298-1744320 AATCTGCGGGAAGCTTAGCCAGG + Intronic
904494153 1:30877379-30877401 ATTCTGGGGGCCGCCTCTCCCGG + Intronic
907268056 1:53274793-53274815 AATCTGCGGGGACCCTCACAGGG + Intronic
914756298 1:150563291-150563313 AATCTGGAGGGAGGCTCTCCTGG - Intergenic
915831549 1:159135766-159135788 AATCTGAAGGGAGCATCTTCTGG - Intronic
920998871 1:211022380-211022402 AAACTTCGGGGAAACTCTCCAGG + Intronic
1069371980 10:67757775-67757797 AATCTGCGGACAGCCTATCGTGG + Intergenic
1071769731 10:88713864-88713886 CCTCTGCAGTGAGCCTCTCCTGG - Intergenic
1072021687 10:91409741-91409763 AAGCTCCGGGCCGCCTCTCCTGG + Intergenic
1081708458 11:45200719-45200741 AGTCTGCAGGGACCCTCCCCTGG - Intronic
1082006858 11:47424135-47424157 ACTCTGTGGGCAGCGTCTCCAGG + Exonic
1083285628 11:61656847-61656869 GATATGCTGGGAGCATCTCCTGG + Intergenic
1084144563 11:67257495-67257517 AGTCTGAGGGCAGGCTCTCCTGG - Exonic
1084466812 11:69328110-69328132 AACCTGTGAGCAGCCTCTCCGGG - Intronic
1091597702 12:1890032-1890054 GATTGGCTGGGAGCCTCTCCAGG + Intronic
1094124733 12:27012175-27012197 AATTTGCAGGGAGACTCACCTGG + Intronic
1096572216 12:52530123-52530145 AATCTGCCAGGACCCTCTGCGGG + Intergenic
1101037141 12:100717175-100717197 AATCCGCGGCGCGCCTCTGCCGG + Intergenic
1101969971 12:109306052-109306074 AGTCTGATGGGAGCCCCTCCTGG + Intronic
1108601065 13:51995691-51995713 AGACTGCTGGCAGCCTCTCCTGG - Intronic
1118784538 14:69035081-69035103 AAGCTGTGGGGAACCTTTCCTGG + Intergenic
1120027256 14:79600516-79600538 AATCTGCAGGGACACTGTCCTGG + Intronic
1121404733 14:93712818-93712840 CACCTGCGGGGAGCCTGTCTGGG - Intergenic
1124497646 15:30196198-30196220 AAGGGGCGGGGAGCCTCGCCGGG - Intergenic
1128136125 15:65264946-65264968 AATCTGCAGGCAACTTCTCCAGG + Intronic
1134009153 16:10838479-10838501 AATCTGCTGTAAGCCTCTCCTGG - Intergenic
1134059504 16:11190632-11190654 AAGCTGCTGGGGGCCTCACCTGG - Intergenic
1135310803 16:21403324-21403346 CGTCTGCGGGGAGCGTCTGCGGG - Intronic
1135363774 16:21835884-21835906 CGTCTGCGGGGAGCGTCTGCGGG - Intronic
1135448084 16:22535575-22535597 CGTCTGCGGGGAGCGTCTGCGGG + Exonic
1135895816 16:26401289-26401311 ATTCTCCCGGGAGGCTCTCCTGG + Intergenic
1136321029 16:29484477-29484499 CGTCTGCGGGGAGCGTCTGCGGG - Intronic
1136435666 16:30224195-30224217 CGTCTGCGGGGAGCGTCTGCGGG - Exonic
1139923353 16:70473001-70473023 ACTCTGCGGGCAGCGTCTCAGGG - Exonic
1141973884 16:87501124-87501146 CATCTGTGGGGGGCCTCCCCTGG + Intergenic
1142006229 16:87690736-87690758 AACCTGGGGGCAGCCTCTCACGG - Intronic
1142987170 17:3703037-3703059 AATGTGCTGGGGGCCTCACCTGG + Intergenic
1151545473 17:74790369-74790391 AATCTGCGGGGAGCCTCTCCAGG - Intronic
1152124533 17:78438366-78438388 AATGTGCAGAGAGCATCTCCTGG + Intronic
1153839123 18:8990432-8990454 AAGCTGCTGGGCACCTCTCCAGG - Intergenic
1155665103 18:28298900-28298922 CATCTGGTGGGTGCCTCTCCGGG - Intergenic
1158301387 18:56057172-56057194 AATCTCAGGGGAGACCCTCCAGG + Intergenic
1159003526 18:62993090-62993112 AATCTCCGGGCGGCCACTCCTGG + Intergenic
1163791009 19:19306108-19306130 GATCTGCAGGGCACCTCTCCCGG + Intronic
1164394685 19:27852232-27852254 ATTCTGTGGGGAGCGACTCCTGG + Intergenic
1166130516 19:40743104-40743126 AAGCTGAGCGGAGCCTCCCCCGG + Intronic
926621243 2:15048934-15048956 ACTGGGCTGGGAGCCTCTCCTGG - Intergenic
930047195 2:47183183-47183205 TATCTGCAGAGAGCCTTTCCTGG + Intergenic
934753610 2:96810230-96810252 ACTCTGCCGACAGCCTCTCCTGG + Exonic
934859924 2:97755917-97755939 AATCTGCGGTCAGCCTGACCTGG + Intergenic
937263272 2:120600081-120600103 AGCCTACGGGGGGCCTCTCCAGG - Intergenic
937862333 2:126720830-126720852 GAGCTGAGGGGAGCCCCTCCAGG + Intergenic
942000354 2:171640464-171640486 AAACTTCGGGGAAACTCTCCAGG - Intergenic
948123126 2:235545627-235545649 AATCTGCAGGGAGAGCCTCCAGG - Intronic
1170393060 20:15895796-15895818 AATCTCCGGGTTGCCACTCCTGG + Intronic
1172320762 20:33993817-33993839 GAGCTGCGGGGAGCCGCTCCGGG + Exonic
1174195403 20:48769325-48769347 ATCCTGAGGGGATCCTCTCCAGG + Intronic
1179161594 21:38903978-38904000 AGGCTGCGGGGAGCCCTTCCCGG - Intergenic
1181688711 22:24546343-24546365 AATCTGAGAAGAGCCTGTCCAGG + Intronic
1182320582 22:29476298-29476320 AACCTGCGGGCAGCCTCCCTAGG + Intergenic
1184357124 22:43989878-43989900 CATCTGCTGGGAGTCTCTTCTGG - Intronic
1184792092 22:46706386-46706408 GATCTCGGGGGAGCCTCTGCTGG - Intronic
1184982928 22:48107027-48107049 CATCTGAGAGGAGCCTCTTCAGG - Intergenic
953102263 3:39841836-39841858 CATCTGCGGGGTGCCCCTCTAGG - Intronic
955233064 3:57115912-57115934 AATGTGCAGGGAGACTCTACAGG - Intronic
956796578 3:72723482-72723504 AATGTGTGGGGAGTCCCTCCTGG - Intergenic
961794289 3:129398509-129398531 AGTCTTAGTGGAGCCTCTCCTGG - Intergenic
969701762 4:8771486-8771508 AATCTGCAGGGAGCTGCTCCTGG + Intergenic
985215675 4:187650777-187650799 AATGTTGGGGTAGCCTCTCCAGG - Intergenic
988713873 5:33805201-33805223 AGTATTTGGGGAGCCTCTCCTGG - Intronic
989460759 5:41696234-41696256 AATCTACAGGGAGCTTCTCATGG - Intergenic
993878921 5:93340802-93340824 AGCCTGGGGAGAGCCTCTCCTGG - Intergenic
997304598 5:132828283-132828305 GGTCTGCTGAGAGCCTCTCCTGG - Intronic
998353935 5:141518888-141518910 GATCTATGGGCAGCCTCTCCTGG - Intronic
999842139 5:155439321-155439343 AATCTGGGAGAAGCCTATCCAGG + Intergenic
1005755277 6:28920612-28920634 AATGAGCGGGAAGCCTTTCCAGG + Intronic
1007585184 6:42984902-42984924 TATGTGGGGGGAGTCTCTCCGGG - Intronic
1011449013 6:87473155-87473177 AGTTTGCGTGGAGCCGCTCCCGG + Intronic
1018226478 6:161634256-161634278 CATCTGCGGGGACGCTCACCAGG - Intronic
1019543954 7:1564090-1564112 AAAATGCGGGGAGCCACTCACGG + Intergenic
1028521542 7:91736729-91736751 AAACTTCGGGGAAACTCTCCAGG - Intronic
1031564858 7:123283499-123283521 AATCTGCAGGCAGACTCTACTGG + Intergenic
1032382716 7:131501939-131501961 AATCAGCCCAGAGCCTCTCCGGG + Intronic
1036794186 8:11743447-11743469 AGTCTGAGGGGAGCATCTGCAGG + Intronic
1043419635 8:80085500-80085522 TATCTGCGGCCTGCCTCTCCTGG - Intronic
1045710594 8:104978836-104978858 AATCTGGAGGTAGCCTCCCCGGG - Intronic
1049437208 8:142592238-142592260 ACTGTGCGGGCAGCCCCTCCTGG - Intergenic
1051101064 9:13522372-13522394 AATCTGTTGGCATCCTCTCCTGG + Intergenic
1186526403 X:10252960-10252982 AATCTGCTGGCGGCCTCTCAGGG + Intergenic
1189471179 X:41315384-41315406 AATCTGAGGTGACCCTCTACTGG - Intergenic
1199151407 X:144490873-144490895 AATCAGCTGGGAGCATCTGCAGG - Intergenic
1199731267 X:150634817-150634839 AATCTTCAGCCAGCCTCTCCAGG - Intronic
1201278863 Y:12323421-12323443 AATCTGTGGTCTGCCTCTCCAGG + Intergenic
1202178113 Y:22116290-22116312 ATTCTGCAGGAAGCCCCTCCTGG + Intergenic
1202213248 Y:22470105-22470127 ATTCTGCAGGAAGCCCCTCCTGG - Intergenic