ID: 1151549796

View in Genome Browser
Species Human (GRCh38)
Location 17:74815660-74815682
Sequence CTGTAGGGTTAGAACTGGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 139}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151549791_1151549796 1 Left 1151549791 17:74815636-74815658 CCTTTCTTCTGTAAGTGCCATGT 0: 1
1: 0
2: 2
3: 17
4: 216
Right 1151549796 17:74815660-74815682 CTGTAGGGTTAGAACTGGAGAGG 0: 1
1: 0
2: 1
3: 10
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151549796 Original CRISPR CTGTAGGGTTAGAACTGGAG AGG Intronic
902633981 1:17723198-17723220 CTGTAGGATCAGGAATGGAGAGG - Intergenic
905418845 1:37825025-37825047 CTGTAGGGGTAGAGGTGGATTGG - Intronic
905943723 1:41884615-41884637 CTGAAGGGTTAGCATTGGAAGGG + Intronic
906096955 1:43230418-43230440 CTGAAGGCTTAGACCAGGAGTGG - Intronic
906514656 1:46431830-46431852 CAGAAGGGTCACAACTGGAGTGG - Intergenic
908499446 1:64728657-64728679 CTGAAGGGGTAAAACTGAAGTGG + Intergenic
909036983 1:70604475-70604497 TTGTACCATTAGAACTGGAGTGG + Intergenic
915528252 1:156489180-156489202 CTGCAGGCTGAGGACTGGAGGGG + Intronic
917790250 1:178494803-178494825 CTGCAGGGCTGGAACAGGAGAGG + Intergenic
918753122 1:188298981-188299003 CTGAATGGTGAGAACAGGAGTGG + Intergenic
923274046 1:232381326-232381348 GTGGAGGGTTAGAACTAAAGAGG - Intergenic
1066477303 10:35760406-35760428 CTCTAGAGTTAGCACTGGGGTGG + Intergenic
1068378915 10:56222350-56222372 CTCTAGGCTTAGAATTGGTGTGG + Intergenic
1069686714 10:70323562-70323584 CTGGTAGGTGAGAACTGGAGAGG + Intronic
1069876315 10:71565346-71565368 CTGCTGGGGTAGAGCTGGAGGGG + Intronic
1070162913 10:73876461-73876483 CTGTTGGGTCAGGACAGGAGGGG - Intergenic
1072479660 10:95798409-95798431 CTGGAGGGAGAGAACTGAAGGGG + Intronic
1075240731 10:120776028-120776050 CTGTAGGCTCAGTTCTGGAGAGG + Intergenic
1080721947 11:34858191-34858213 TTGAAGGGGTAGAAGTGGAGGGG - Intronic
1084014841 11:66372031-66372053 CTGTAGGGGCAGCACTGGTGCGG + Intronic
1084041289 11:66544146-66544168 CTGTAGTGCTAGAACTAGAAGGG - Intronic
1085254998 11:75167513-75167535 CTGGAGAGTCAGAACAGGAGGGG - Intronic
1085417722 11:76330317-76330339 CTGGAGAGGTAGAACTGAAGTGG + Intergenic
1085451925 11:76639341-76639363 CTTCAGGGGTAGAGCTGGAGAGG - Intergenic
1089291465 11:117439960-117439982 GTGCAGGGGTAGAAGTGGAGTGG - Intronic
1097105777 12:56623318-56623340 CTGGAGGGTTAGAATTGGTCAGG - Intronic
1098088162 12:66870822-66870844 ATGTAGGCTTTGAAATGGAGTGG - Intergenic
1098499792 12:71177983-71178005 CTGTGGGGTTGGAATTGCAGAGG - Intronic
1101982876 12:109422729-109422751 CTGTAGGTTTAGAACTGCAATGG + Intronic
1102930707 12:116859997-116860019 CTGGCGTCTTAGAACTGGAGCGG + Exonic
1104939636 12:132388955-132388977 CTGTAGGGTTGGATCTGTGGGGG - Intergenic
1108856870 13:54803443-54803465 CTCTGGGTTTAGAGCTGGAGTGG + Intergenic
1111291731 13:86180036-86180058 CAGTAGGGTAAGATGTGGAGGGG + Intergenic
1114667335 14:24387082-24387104 CTGGAGTGTTAGAATTGGAAGGG - Intergenic
1115277495 14:31624122-31624144 CTGAAGTGATAGAAATGGAGAGG + Intronic
1115502398 14:34060981-34061003 CTGTAGGTCTAGAACTTAAGCGG - Intronic
1115509880 14:34129030-34129052 CTGTAGGGATAACACTGAAGTGG - Intronic
1117252665 14:53952313-53952335 ATTTAGGGCTAGAAATGGAGGGG + Intronic
1118611209 14:67541756-67541778 CTGTGGGGAAAGAACGGGAGGGG - Intronic
1121321599 14:92994817-92994839 CTGAAGGGTTAAGACTTGAGAGG - Intronic
1121378478 14:93436940-93436962 ATGTGGGATTAAAACTGGAGTGG + Intronic
1121739732 14:96243009-96243031 CTGGAGGGCTAGAACTGGAGAGG + Exonic
1123135098 14:106020970-106020992 CTGTAGTGTTAGAAAGAGAGTGG - Intergenic
1124715661 15:32058733-32058755 CTGTGGGGGCAGAACTAGAGTGG + Intronic
1125932126 15:43607892-43607914 CTGTAGGGCCAGAACTGAACGGG - Exonic
1125945225 15:43707366-43707388 CTGTAGGGCCAGAACTGAACGGG - Intergenic
1127836598 15:62795545-62795567 CAGGAGTGTTAGAAGTGGAGAGG + Intronic
1128718901 15:69931210-69931232 CTGGAGAGGTAGAGCTGGAGGGG + Intergenic
1130103183 15:80909347-80909369 ATGGATGGTTAGCACTGGAGGGG + Intronic
1133081223 16:3321784-3321806 CTGGAGGGGAAGAACAGGAGGGG + Intergenic
1134235141 16:12459414-12459436 CTCTAGGGTCAGAGCTGGAGCGG + Intronic
1138257432 16:55578652-55578674 CTGTAGGATTATAATGGGAGTGG - Intronic
1138833017 16:60398718-60398740 CTGTAGTCTTTGAAATGGAGAGG - Intergenic
1142349522 16:89573702-89573724 CTGGAGGGTTAGATGTGGGGAGG + Intergenic
1142594440 17:1022694-1022716 CTGCAGGGTGAGGGCTGGAGAGG - Intronic
1144052068 17:11505377-11505399 TTGTAGGGATAGACATGGAGTGG + Intronic
1151549796 17:74815660-74815682 CTGTAGGGTTAGAACTGGAGAGG + Intronic
1152259880 17:79261111-79261133 CCGTGGGGTGGGAACTGGAGGGG - Intronic
1155640251 18:28005287-28005309 TTGAAGGGATAGAACTGCAGGGG + Intronic
1155920723 18:31600388-31600410 CAGTAGGGTTGGGACTGGTGGGG + Intergenic
1156032628 18:32730313-32730335 CTGTATGATTAGATCTGAAGAGG - Intronic
1156196123 18:34776080-34776102 CTGTAGGTTTAGAAGGGGAGTGG + Intronic
1156408667 18:36807104-36807126 CTGGAGGGGAGGAACTGGAGGGG + Intronic
1157344582 18:46814141-46814163 ATGCAGGGTTAGAACTTAAGTGG - Intronic
1158561387 18:58516662-58516684 ATCTCGGGTTAGAACTGGTGAGG + Intronic
1158807800 18:60996162-60996184 CTTTAGGGTGAGAAATGGTGTGG - Intergenic
1160744597 19:704668-704690 CTGGAGGTTTAGAGCTGGGGCGG + Intergenic
1165495268 19:36149028-36149050 TGTTAGGCTTAGAACTGGAGAGG + Intronic
1167571696 19:50292725-50292747 CTGTAGCAGTTGAACTGGAGTGG + Intronic
1167618148 19:50547458-50547480 CTGGAAGATTAGATCTGGAGGGG + Intronic
927718564 2:25368255-25368277 CTGTGGGGCTGGGACTGGAGAGG + Intergenic
928815937 2:35294395-35294417 CTGTAGGATAGGAACTGGAGCGG - Intergenic
932084727 2:68747801-68747823 CTGGTGGATTAGATCTGGAGTGG - Intronic
932168794 2:69534596-69534618 CTGAGGAGTTACAACTGGAGTGG - Intronic
932940884 2:76163538-76163560 CTTAAGGGTTATATCTGGAGAGG - Intergenic
934576162 2:95402823-95402845 CTGTAGGGTTAGAGCTCGCGGGG - Exonic
935720604 2:105975824-105975846 CTGAAGGGTTTGACCTGGAGAGG + Intergenic
935739922 2:106138474-106138496 CTGAAGGGTGAGACCTGCAGTGG - Intronic
938834405 2:135085098-135085120 CTGTAGGGGTAAAACTGGAAAGG + Intronic
942228641 2:173838761-173838783 CTGAAGGTTAAGAACTGGACTGG + Intergenic
944403414 2:199354457-199354479 CTTGAGGGTGAGCACTGGAGAGG + Intronic
945614854 2:212054631-212054653 CTCTAGGATTGGCACTGGAGAGG - Intronic
947863790 2:233381739-233381761 CTTTAGAGATAGAATTGGAGAGG + Intronic
1170657995 20:18308085-18308107 CTGTGGGGATAGAATTGGGGAGG + Intronic
1170981771 20:21220922-21220944 CTCTTGGGTTAGGCCTGGAGAGG + Intronic
1173576867 20:44117777-44117799 CTGTGCGGTTAGAATGGGAGAGG - Intronic
1174716722 20:52766712-52766734 CTGTATGCTAAGAACTGGATAGG + Intergenic
1175167096 20:57052057-57052079 ATTTAGGTTTAGAAATGGAGAGG + Intergenic
1178389558 21:32187212-32187234 CTGAAAGGACAGAACTGGAGTGG - Intergenic
1180642884 22:17313577-17313599 CAGTAGCGTTAGAAATGGAAAGG + Intergenic
1180882838 22:19218735-19218757 CTGTGAGGCTATAACTGGAGAGG + Intronic
949185511 3:1187252-1187274 ATGTATGGATAGAACTGGTGTGG - Intronic
949919799 3:8991715-8991737 CTGAAGGGCTAGAAGTGGTGAGG + Intronic
950736008 3:15008696-15008718 CTTTGGGATTAGAACTAGAGAGG + Intronic
952242594 3:31548066-31548088 CTGTTTGGTTGGAACAGGAGTGG + Intronic
952483284 3:33784329-33784351 CTGTAGGTCTAGAACTGAAAGGG + Intergenic
953026023 3:39145407-39145429 CTGTGTGGTTGGGACTGGAGCGG + Intronic
954413593 3:50381963-50381985 GTGTAGGGATAGATCTGGACAGG - Intronic
956798500 3:72736977-72736999 CTGTAGGGTTAGGCCGGGGGTGG + Intergenic
961866706 3:129958694-129958716 CTGTAGGATTGGAACTGAGGTGG + Intergenic
965090512 3:164156674-164156696 TTGTATGGTTAGAAGTGGAAAGG + Intergenic
969608208 4:8212692-8212714 CTGCAGGGTCAGGTCTGGAGGGG - Exonic
972817369 4:42658252-42658274 CTGAAGGGAGAGAGCTGGAGAGG + Intergenic
976084003 4:81388731-81388753 TTCTAGGGCTAGAAATGGAGTGG - Intergenic
985217989 4:187673279-187673301 CTATAGGGTAAGAGGTGGAGAGG + Intergenic
990955007 5:61332248-61332270 CTGTCGGGTTAGAAGCGGCGCGG + Intergenic
999373638 5:151071470-151071492 CTGAAATGTTAGAACTGGAAGGG - Intronic
1001659455 5:173379822-173379844 GTGTGGGGTTAGGACTTGAGGGG + Intergenic
1002186578 5:177457504-177457526 CTGTGGCGTTAGAAAGGGAGAGG + Intronic
1003498765 6:6687114-6687136 CTGGAGGGTGAGGACTGGAGTGG - Intergenic
1003498787 6:6687187-6687209 CAGGAGGGTGAGGACTGGAGTGG - Intergenic
1003498801 6:6687224-6687246 CTGGAGGGTGAGGCCTGGAGTGG - Intergenic
1004551942 6:16656272-16656294 CTGTTGGGCAAGAACTGAAGTGG + Intronic
1005077755 6:21925306-21925328 CTGCAGTGATAGAAATGGAGTGG + Intergenic
1005314144 6:24588023-24588045 CAGTATGGCTGGAACTGGAGTGG - Intronic
1008355965 6:50553585-50553607 GTTTAGGGTTAGTACAGGAGGGG - Intergenic
1010807163 6:80250834-80250856 ATGTGGGGTTAGGACTAGAGAGG - Intronic
1010987293 6:82439528-82439550 CGGGAGGATGAGAACTGGAGCGG + Intergenic
1016459718 6:144269729-144269751 TTTTATGGTTAGAATTGGAGAGG - Intergenic
1018326918 6:162680482-162680504 CTGTGGGGTTAAAATTGCAGTGG - Intronic
1019024237 6:168943745-168943767 CTGAGGGGTGAGAGCTGGAGTGG + Intergenic
1021142457 7:17044480-17044502 TTGCAGGGATAAAACTGGAGAGG - Intergenic
1021861503 7:24910565-24910587 CTGAAGGGTTAGCACAGCAGTGG - Intronic
1027965611 7:85002140-85002162 CTGTGGGGACAGAACTAGAGGGG - Intronic
1031598099 7:123670877-123670899 CTGTAGCCTTAGTACTCGAGAGG - Intergenic
1032644417 7:133806636-133806658 CCGTAAGGTTAGAACTCCAGAGG - Intronic
1034004811 7:147459544-147459566 CAGTAAGGTTAGAAATGAAGAGG + Intronic
1034039085 7:147857954-147857976 CTGTGTAGTTAGAACTGGAAAGG - Intronic
1035665544 8:1377195-1377217 CTGTAGGGTTAGGGCAGCAGAGG + Intergenic
1035684964 8:1517286-1517308 CTGAAGAGTTAGACCTGGAGTGG + Intronic
1035988061 8:4456591-4456613 CTGTAGGGATAGAAGAGTAGAGG + Intronic
1036786988 8:11694394-11694416 CTGTAAGGTCAGAGCTGGCGTGG + Intronic
1038201187 8:25414302-25414324 CTGTAGGATTGGAAAGGGAGTGG + Exonic
1039189539 8:34957117-34957139 AAGTGGGGTTAGGACTGGAGTGG + Intergenic
1041327270 8:56681739-56681761 CTTTGGGGTAAGGACTGGAGGGG - Intergenic
1042303137 8:67307588-67307610 GTGCAGGGGTAGAGCTGGAGGGG + Intronic
1042596227 8:70450919-70450941 CTTTAAGGTTAGAACTGGCTGGG + Intergenic
1043119067 8:76299766-76299788 CTCTAGGATAAGGACTGGAGAGG - Intergenic
1045530006 8:102975633-102975655 CTGTAGGGTTAGAAATGAGTAGG + Intronic
1046026332 8:108728506-108728528 ATGTTGGGTTGGAATTGGAGAGG - Intronic
1046986016 8:120390065-120390087 CTATAGGGTTGGAACGGCAGAGG + Intronic
1047034733 8:120924858-120924880 CTGTAGGGGTAGAAGTTAAGTGG + Intergenic
1048324183 8:133426332-133426354 CTGTTAGGTTAAAACTGGTGGGG + Intergenic
1051134117 9:13898911-13898933 CAGGAGAGTTAGAACAGGAGAGG + Intergenic
1051217470 9:14814005-14814027 GTGTCGGGATAAAACTGGAGTGG - Intronic
1051414727 9:16827123-16827145 CTGTAAAGTTACATCTGGAGAGG + Intronic
1051828667 9:21251263-21251285 CTGTAGTGTGAGAACTTGATGGG + Intergenic
1060034720 9:120244683-120244705 CTGTTGGGAGGGAACTGGAGGGG - Intergenic
1187830357 X:23374818-23374840 ATGTAGTGTTAAAACTGGAAGGG + Intronic
1189180907 X:39003752-39003774 CTGAAGGGTTGTGACTGGAGGGG + Intergenic
1193981505 X:88186707-88186729 CTGTAGGGTTAGAATAGCAGAGG - Intergenic