ID: 1151552944

View in Genome Browser
Species Human (GRCh38)
Location 17:74832349-74832371
Sequence GAGGATATGAAGGCGGGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 149}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151552944_1151552959 25 Left 1151552944 17:74832349-74832371 CCAGCACCCGCCTTCATATCCTC 0: 1
1: 0
2: 0
3: 13
4: 149
Right 1151552959 17:74832397-74832419 TGCCCCCTCCCCAGGTAGCTGGG 0: 1
1: 0
2: 11
3: 68
4: 470
1151552944_1151552950 -5 Left 1151552944 17:74832349-74832371 CCAGCACCCGCCTTCATATCCTC 0: 1
1: 0
2: 0
3: 13
4: 149
Right 1151552950 17:74832367-74832389 TCCTCATGGTGGTGCCGAACTGG 0: 1
1: 0
2: 0
3: 2
4: 53
1151552944_1151552958 24 Left 1151552944 17:74832349-74832371 CCAGCACCCGCCTTCATATCCTC 0: 1
1: 0
2: 0
3: 13
4: 149
Right 1151552958 17:74832396-74832418 CTGCCCCCTCCCCAGGTAGCTGG 0: 1
1: 1
2: 8
3: 91
4: 540
1151552944_1151552953 -1 Left 1151552944 17:74832349-74832371 CCAGCACCCGCCTTCATATCCTC 0: 1
1: 0
2: 0
3: 13
4: 149
Right 1151552953 17:74832371-74832393 CATGGTGGTGCCGAACTGGAGGG 0: 1
1: 0
2: 1
3: 4
4: 80
1151552944_1151552955 17 Left 1151552944 17:74832349-74832371 CCAGCACCCGCCTTCATATCCTC 0: 1
1: 0
2: 0
3: 13
4: 149
Right 1151552955 17:74832389-74832411 GAGGGCCCTGCCCCCTCCCCAGG 0: 1
1: 0
2: 12
3: 120
4: 789
1151552944_1151552952 -2 Left 1151552944 17:74832349-74832371 CCAGCACCCGCCTTCATATCCTC 0: 1
1: 0
2: 0
3: 13
4: 149
Right 1151552952 17:74832370-74832392 TCATGGTGGTGCCGAACTGGAGG 0: 1
1: 0
2: 0
3: 4
4: 79

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151552944 Original CRISPR GAGGATATGAAGGCGGGTGC TGG (reversed) Intronic
900310993 1:2033034-2033056 GAGCAGATGAAGGCGGGGGTGGG + Intergenic
900490968 1:2948993-2949015 GAGGGCAAGAAGGCAGGTGCCGG + Intergenic
901199529 1:7458664-7458686 CAGGTTATGAAGTCAGGTGCCGG - Intronic
905363333 1:37435065-37435087 ATGGATATGAAGGCTGGTGGAGG - Intergenic
905638475 1:39572196-39572218 AAGGGTATGAAAGCGTGTGCTGG + Intronic
905819672 1:40979808-40979830 GAGGATCTGAAGCCGGCCGCAGG + Exonic
906402974 1:45519489-45519511 GATGTTATGAAGGCAGGTGGAGG - Intronic
906747177 1:48230285-48230307 GAGGAAGTGAAGGAAGGTGCTGG - Intronic
911145870 1:94552076-94552098 GAGGATTAGAAAGTGGGTGCTGG - Intergenic
911679824 1:100702507-100702529 GAGAAGGTGAAGGAGGGTGCAGG + Intergenic
914995709 1:152541736-152541758 GAGGAGAGGAAGTTGGGTGCTGG + Intronic
918917562 1:190664386-190664408 AAGGATATGAAGGCAGATGCAGG + Intergenic
919973060 1:202593128-202593150 GAGGATATGAGGGCAGTTCCTGG + Exonic
920106136 1:203555065-203555087 GTGGATGTGATGGCGGGAGCTGG - Intergenic
920392414 1:205616891-205616913 TAGGATATGAAGGAGGGTACAGG - Intronic
920827543 1:209435785-209435807 CAGGATTTGAAGGCGGATGGTGG - Intergenic
922956119 1:229602149-229602171 GAAATTAGGAAGGCGGGTGCAGG + Intronic
923143366 1:231180499-231180521 CAGTATCTGAAGGGGGGTGCAGG - Intronic
923854685 1:237833361-237833383 GAGCATATGGGGGCGGGGGCGGG - Exonic
924380760 1:243462122-243462144 GAGGGAATGAAGGGGGCTGCAGG + Intronic
1066018843 10:31276365-31276387 CAGGATAAGAAGGCGGAAGCAGG + Intergenic
1066464717 10:35641659-35641681 GGGGGTTTGAAGGCGGCTGCAGG + Exonic
1070035511 10:72718994-72719016 GAGGGTATGAAGGGGGCTCCTGG + Intronic
1071568538 10:86684149-86684171 GAGGAGAAGAAGGGGGCTGCTGG - Intronic
1071893871 10:90042370-90042392 GTTGATATGGAAGCGGGTGCAGG - Intergenic
1073462125 10:103671839-103671861 GAGGAGATGAAGGCAGGGACAGG - Intronic
1076981951 11:209307-209329 GAGGACCGGAAGGTGGGTGCTGG + Exonic
1082079445 11:48000741-48000763 GAGGAAATGAAGGAGGATGATGG - Intronic
1082758192 11:57098914-57098936 GAGTTTATGAAGGCTGGTGGAGG + Intergenic
1083199269 11:61110012-61110034 GAGGCTAGGAAGGATGGTGCAGG + Intronic
1084857621 11:71999088-71999110 GAGGGTGTGATGGTGGGTGCTGG + Exonic
1094426275 12:30320418-30320440 TAGGAGATGAAGGGGAGTGCGGG + Intergenic
1096482431 12:51951632-51951654 GAGGAGAGGGAGGCGGGAGCCGG + Intergenic
1097238850 12:57559660-57559682 GAGGATATGAAGGAGCTTTCAGG - Intronic
1099922247 12:88973190-88973212 GAGAATCAGAAGGCAGGTGCTGG + Intergenic
1101092184 12:101298525-101298547 GAGGAGATGGAGGTGGGTGAGGG + Intronic
1104367221 12:128188814-128188836 GAGAATATGAAGGTGTGTGAGGG + Intergenic
1104489408 12:129181040-129181062 GGGGATATGAAGGTGGTGGCTGG + Intronic
1104894477 12:132155062-132155084 CAGGAAATGAACGCGGCTGCCGG + Intergenic
1107999775 13:45895497-45895519 TAGGATTTGAAGGCTGGTGCAGG + Intergenic
1109692226 13:65909183-65909205 GAGCATATGAAAGTGGGTGTTGG + Intergenic
1113675892 13:112207750-112207772 GAGGAAATGAGAGGGGGTGCGGG + Intergenic
1115282242 14:31677332-31677354 GAGGATGTGAAGGGTGGTGGGGG - Intronic
1120302689 14:82728320-82728342 GAGTTTATGATGGCAGGTGCTGG - Intergenic
1121710029 14:96030801-96030823 GAGGATATGGAGGAGGCTGCCGG + Intergenic
1122031935 14:98918745-98918767 GAGGATAGGAAGGGAGGTGAAGG + Intergenic
1122857552 14:104567182-104567204 GAGGCAAGGAAGCCGGGTGCGGG - Intronic
1123168910 14:106352561-106352583 GAGGATATGGAGGAGGATTCTGG - Intergenic
1124635389 15:31361578-31361600 GAGGAAATGAAGGCTGGGGGAGG + Intronic
1124637051 15:31371953-31371975 GAGGGTGTGAAGGCGGGGCCAGG + Intronic
1126035017 15:44537416-44537438 GAGGACGTCAAGGTGGGTGCGGG + Exonic
1129604699 15:77019190-77019212 GAGGAGATGAAGGTGAGTTCAGG + Intronic
1132767770 16:1543185-1543207 GAGGAGGAGAAGGAGGGTGCGGG - Intronic
1132971743 16:2692668-2692690 GAGGGCATGAAGGCTGGGGCCGG - Intronic
1142804446 17:2364062-2364084 GAGGATATGGAGGCGGTCCCTGG + Exonic
1143130820 17:4675937-4675959 AAGGAGATGAAGGTGGGTGTGGG - Intronic
1143297755 17:5883874-5883896 GAGGAGATGGAGGCGGGTTGGGG - Intronic
1147341761 17:39756530-39756552 GAGGGGAAGAAGGAGGGTGCAGG + Intergenic
1148389231 17:47258276-47258298 GTGGAAATGAAGGTGGGAGCAGG + Intronic
1149556024 17:57574138-57574160 GAGGATATGAGGGGTGGGGCTGG - Intronic
1149855364 17:60078402-60078424 GAGGGAGTGAAGGAGGGTGCGGG + Intronic
1151552944 17:74832349-74832371 GAGGATATGAAGGCGGGTGCTGG - Intronic
1152587638 17:81196136-81196158 GAGGACAGGACGGCGGATGCAGG - Intronic
1155437337 18:25826985-25827007 GAGGAAATGAAGCAAGGTGCTGG + Intergenic
1156914927 18:42454458-42454480 CAGGATATGAACAAGGGTGCTGG + Intergenic
1158495289 18:57949714-57949736 GAGGAAAGAAAGGCGGGTGGGGG + Intergenic
1158961006 18:62587763-62587785 GAAGCTAAGAAGACGGGTGCTGG + Intergenic
1161398837 19:4058868-4058890 GAGGGAAGGAAGGCGGGTGGAGG - Intronic
1164596536 19:29534011-29534033 GAGGATATCAACCAGGGTGCTGG + Intronic
1165501932 19:36196386-36196408 GAGGAGATGAAGAAGGGTACTGG + Intronic
926018219 2:9473425-9473447 GAGGAGATGGAGGTGGTTGCAGG - Intergenic
929556116 2:42926725-42926747 GAGGAGGTGAAGGTGGGAGCGGG - Intergenic
932417826 2:71584363-71584385 GAGGAGGGGAAGGAGGGTGCTGG - Intronic
934061328 2:88296920-88296942 GAGGACATGGAGGCTGCTGCTGG - Intergenic
937463605 2:122110405-122110427 GAGGATGTGAAGGCAGGTGGAGG + Intergenic
946255449 2:218438516-218438538 GAGGATATGAAGGCTGAGGCTGG - Intronic
947712525 2:232324181-232324203 GAGGCCATGAAGGCAGCTGCTGG - Intronic
947719919 2:232363996-232364018 GAGGCCATGAAGGCAGCTGCTGG - Intergenic
947731490 2:232433861-232433883 GAGGCCATGAAGGCAGCTGCTGG - Intergenic
1170356026 20:15492329-15492351 GAGGATGTGATGGCAGGTACTGG - Intronic
1171345270 20:24461290-24461312 GCGAGTATGAAGGCGGGTGTGGG - Intergenic
1174340096 20:49890119-49890141 GAGGAGATCGAGGCAGGTGCTGG - Exonic
1175400883 20:58699267-58699289 GAGGATTTGGAGGTGGGTGGGGG + Exonic
1176051208 20:63120650-63120672 GAGGTCAGGAAGGGGGGTGCAGG - Intergenic
1176093397 20:63328846-63328868 GAGGATAAGAGGGCGGGAGTGGG - Intronic
1177947868 21:27494948-27494970 GAGCATTTGCAGGTGGGTGCAGG + Intergenic
1178407579 21:32337217-32337239 GAGGGTATGAGGGCAGGTGGTGG - Intronic
1181064132 22:20297716-20297738 GAGGAGAGGAAGGAGGGTGTGGG + Intergenic
1181404388 22:22672431-22672453 GAGGAGATGGAGCAGGGTGCAGG + Intergenic
1181411042 22:22719957-22719979 GAGGAGATGGAGCAGGGTGCAGG + Intergenic
1181412984 22:22737994-22738016 GAGGAGATGGAGGATGGTGCAGG + Intronic
1181497157 22:23293856-23293878 GGGGAAATGGAGGAGGGTGCGGG - Intronic
1182795381 22:32987956-32987978 GAGGATAAGATGTGGGGTGCAGG + Intronic
1182795437 22:32988403-32988425 GAGGATAAGATGTGGGGTGCAGG + Intronic
1183349576 22:37327416-37327438 GATGAAATGAAGGGGGGAGCAGG - Intergenic
1184691410 22:46119072-46119094 AAGGATTTGAAGGCAGATGCTGG + Intergenic
950114881 3:10444356-10444378 GAGGATGTGGAGGCAGGGGCAGG - Intronic
952257089 3:31705014-31705036 GAGGAAATTAAGGCTGGTGCAGG + Intronic
952377030 3:32776421-32776443 GGGGATATGAAGGCAGCTGCTGG + Intergenic
953624581 3:44560327-44560349 GAGGAGATTAAGGAGGGTCCAGG + Intronic
959806123 3:110555924-110555946 GAGGTTATGAAGGGTGGTGAAGG - Intergenic
961354425 3:126327011-126327033 TAGGAAATGAAGATGGGTGCAGG + Intergenic
961490336 3:127252909-127252931 GGAGATATGTAGGAGGGTGCAGG + Intergenic
961559487 3:127718777-127718799 AAAGATATGAAGGAGGATGCAGG - Intronic
963120381 3:141771455-141771477 GAGGGTAAGAAGGTGGGAGCAGG + Intergenic
963120396 3:141771540-141771562 GAGGGTAAGAAGGTGGGAGCAGG + Intergenic
964622815 3:158732985-158733007 GAGGAGGTGAAGGTGGATGCCGG + Intronic
968766072 4:2469742-2469764 GAGGATCTGAGTACGGGTGCGGG + Intronic
969248394 4:5951329-5951351 GAGGGAATGAAGGGGGGTGGTGG + Intronic
969452678 4:7283805-7283827 GAGGAGATGGAGGAGGGGGCAGG + Intronic
969680423 4:8640168-8640190 GAGGACATCAAGCTGGGTGCAGG - Intergenic
971481343 4:27117514-27117536 GAGAATAGGAAGGTGGGTGGGGG - Intergenic
977292719 4:95181044-95181066 TAGCATTTGAATGCGGGTGCTGG - Intronic
978532122 4:109726082-109726104 GAGGATATGAGCACTGGTGCTGG - Intronic
986273513 5:6254022-6254044 GAGGATATGAAAGCCAGGGCAGG - Intergenic
987335437 5:16894465-16894487 GAGGAAATGAAGGCCCGTGGAGG - Intronic
991003635 5:61806929-61806951 GAGGATGTGAAGCAGGGAGCTGG - Intergenic
993331169 5:86602090-86602112 GAGGATGTGAGGGCGGGAGAGGG + Intergenic
998385806 5:141756547-141756569 GAGGAGGTGAAGGAGGGGGCTGG - Intergenic
1000481892 5:161786717-161786739 GCGGATGTGATGGCGGGAGCAGG + Intergenic
1001995445 5:176153767-176153789 GAGGACATGAAGGCGGGTCTGGG + Intergenic
1003536790 6:6982307-6982329 GAGGGTATGCAGGCTGGGGCAGG + Intergenic
1003911826 6:10750140-10750162 GAGAATAAGAAGTCTGGTGCAGG - Intronic
1004502647 6:16222839-16222861 GCTGATTTGAAGGCGGGTGAAGG - Intergenic
1006249424 6:32768731-32768753 GAGGATGGGAAGGAGGGTGAAGG - Intergenic
1006613729 6:35311224-35311246 GAGGATAAGAGGGAGGGTACAGG - Intronic
1007608349 6:43132295-43132317 GAGGATATGCAGAGGGCTGCAGG + Intronic
1019060705 6:169255389-169255411 GAGGATATGCGAGCGGGTGTGGG + Intergenic
1019410370 7:904115-904137 GAGGACGGGAAGGTGGGTGCTGG - Exonic
1019523113 7:1469339-1469361 GAGGGTGGGCAGGCGGGTGCAGG + Intergenic
1019635639 7:2074262-2074284 GAGAATCTCACGGCGGGTGCAGG + Intronic
1020895459 7:13933540-13933562 GAGGAAAGGAAGCAGGGTGCAGG + Intronic
1020937583 7:14486543-14486565 GAGGATATAAAGCAGGGTTCAGG - Intronic
1022221614 7:28319584-28319606 GAGGTGATGAAGGTGGATGCAGG + Intronic
1023959297 7:44913165-44913187 GCTGATCTGAAGGCGGGGGCTGG - Intergenic
1026143980 7:67729686-67729708 GAGCAGATGAAGGTGGATGCAGG + Intergenic
1026838078 7:73651396-73651418 GAAGATAGGAAGTAGGGTGCAGG + Intergenic
1027715334 7:81662335-81662357 AAGATTATGAAGGTGGGTGCGGG + Intergenic
1028461761 7:91102112-91102134 AAGGATACCAATGCGGGTGCTGG - Intronic
1029980620 7:104875323-104875345 GAGGATTTGGAGGTGGGTGCAGG - Intronic
1030744055 7:113143863-113143885 GATGATCTAAAGGAGGGTGCAGG + Intergenic
1035422840 7:158743476-158743498 GGGGATGGGGAGGCGGGTGCTGG - Intronic
1037358228 8:18045639-18045661 AAGGATAGGAAGAAGGGTGCTGG + Intergenic
1038109416 8:24479108-24479130 GAGAATGTGAAGGGAGGTGCTGG - Intronic
1041710185 8:60887326-60887348 GAGGATATGCAGCCAGGTGAGGG + Intergenic
1042368439 8:67963243-67963265 GAGGATGTGATGGCAGGTGATGG + Intronic
1042958370 8:74276320-74276342 GAGGCTGTGAAGGCAGGAGCAGG + Intronic
1044061193 8:87638038-87638060 CAGGATATGAAGGAGGCTACTGG - Intergenic
1045638690 8:104223414-104223436 GAGGAGATGGAGGCGGTGGCGGG - Intronic
1049689178 8:143951275-143951297 AAGGATCTGAAGGGGGGTGCTGG + Intronic
1049973425 9:841034-841056 GAGCAAATGAAGACAGGTGCAGG + Intergenic
1056900242 9:90592395-90592417 GAAGGGATGAAGGAGGGTGCTGG - Intergenic
1058006203 9:99918034-99918056 GTGGATGTGATGGCTGGTGCTGG - Intronic
1059651954 9:116323216-116323238 GGGGATTTGGAGGCGGGTGCTGG + Intronic
1060252009 9:121994232-121994254 GGGGTTATGAAGGCAGGAGCGGG + Intronic
1060283520 9:122228973-122228995 GAGGAGAAGAAGGAGGGGGCGGG - Intronic
1061287383 9:129631808-129631830 GAGGAAGTGGAGTCGGGTGCGGG - Intronic
1185461889 X:336883-336905 GCGGTTATGAAGGCGGCAGCTGG + Intronic
1186796413 X:13050796-13050818 AAAGATATGAAGGCGGGGGCTGG + Intergenic
1190427192 X:50345005-50345027 GAGGAGAGGAAGGCAGGAGCTGG - Intronic
1192428097 X:71095184-71095206 GAGGATAGGGGTGCGGGTGCAGG + Intergenic
1192428124 X:71095357-71095379 GGGGGGATGAAGGCGGGTGGAGG + Intergenic
1197817519 X:130513411-130513433 GACGATATGAAGACTGTTGCGGG - Intergenic