ID: 1151553722

View in Genome Browser
Species Human (GRCh38)
Location 17:74836296-74836318
Sequence CACGGCAATGATGGGGAAGT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 157}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151553722_1151553730 17 Left 1151553722 17:74836296-74836318 CCAACTTCCCCATCATTGCCGTG 0: 1
1: 0
2: 0
3: 8
4: 157
Right 1151553730 17:74836336-74836358 GAAGACACTCTTCCACCGCGAGG 0: 1
1: 0
2: 0
3: 1
4: 39
1151553722_1151553731 18 Left 1151553722 17:74836296-74836318 CCAACTTCCCCATCATTGCCGTG 0: 1
1: 0
2: 0
3: 8
4: 157
Right 1151553731 17:74836337-74836359 AAGACACTCTTCCACCGCGAGGG 0: 1
1: 0
2: 0
3: 0
4: 37
1151553722_1151553727 -5 Left 1151553722 17:74836296-74836318 CCAACTTCCCCATCATTGCCGTG 0: 1
1: 0
2: 0
3: 8
4: 157
Right 1151553727 17:74836314-74836336 CCGTGACCCTGCGCAACAACTGG 0: 1
1: 0
2: 0
3: 4
4: 43
1151553722_1151553732 21 Left 1151553722 17:74836296-74836318 CCAACTTCCCCATCATTGCCGTG 0: 1
1: 0
2: 0
3: 8
4: 157
Right 1151553732 17:74836340-74836362 ACACTCTTCCACCGCGAGGGCGG 0: 1
1: 0
2: 0
3: 0
4: 39

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151553722 Original CRISPR CACGGCAATGATGGGGAAGT TGG (reversed) Exonic
901194033 1:7430130-7430152 GATGGCAATGATGGGGATGATGG + Intronic
901807426 1:11747475-11747497 CAAGGCCAGGATGGTGAAGTTGG - Exonic
901870052 1:12133262-12133284 CTCGGCCTTGAAGGGGAAGTGGG - Intronic
906586371 1:46982891-46982913 GACAGCAGTGATGGGGACGTTGG + Intergenic
907245084 1:53103313-53103335 CACGGCACTGCTGGGCAGGTGGG + Intronic
907423677 1:54364784-54364806 CTCAGCAATGATGGTGAACTTGG + Intronic
907645169 1:56235175-56235197 CAGGGGAATCATGGGGAACTAGG + Intergenic
909486076 1:76175544-76175566 CTTGGCCATGATGGGGAACTTGG + Intronic
910461439 1:87451890-87451912 CCAGGCAATGAGGGGGAAGATGG - Intergenic
914318663 1:146538201-146538223 CCAGGCAATGAAGGGGAAGATGG - Intergenic
914407027 1:147385695-147385717 TAGGGCAGTGATGGGGAAGGTGG - Intergenic
914495697 1:148195156-148195178 CCAGGCAATGAAGGGGAAGATGG + Intergenic
915115480 1:153596312-153596334 CCAGGCAAGGATGGAGAAGTAGG - Intergenic
915769051 1:158399113-158399135 CACAGCAATGAGGAGGCAGTTGG + Exonic
918325433 1:183405288-183405310 TAGGGCAAGGATTGGGAAGTGGG + Intronic
1065669433 10:28099224-28099246 CATGTAAATGAGGGGGAAGTGGG + Intronic
1067498039 10:46776172-46776194 CCCGGCCATGATGGGGCAATGGG + Intergenic
1067596607 10:47564242-47564264 CCCGGCCATGATGGGGCAATGGG - Intergenic
1069172270 10:65247262-65247284 CACAGCAATGATGGAGAAGGAGG - Intergenic
1073769528 10:106720362-106720384 CATTTTAATGATGGGGAAGTGGG - Intronic
1077413959 11:2415863-2415885 CAGTGCCATGATGGGGAGGTGGG + Intronic
1077892324 11:6428298-6428320 CATGGCAATGGTGGAGTAGTGGG - Intergenic
1079360144 11:19763862-19763884 CAGGGCAGTGAAGGGGAAGGAGG - Intronic
1079489419 11:20970954-20970976 CATGGCTATGATGGGTAAGAAGG + Intronic
1081619102 11:44608343-44608365 CAGGGCAGCGATGGGGAGGTTGG + Intronic
1081911715 11:46704327-46704349 CAAGGCAAGGATGGGGTACTGGG - Intronic
1083098900 11:60282478-60282500 GTGGGCAATGGTGGGGAAGTGGG + Intronic
1083171601 11:60926727-60926749 CATGGCAATGATGGGGGAGGAGG + Intronic
1083384851 11:62300036-62300058 CACGGCAATGGGAGGGAAGGCGG - Intergenic
1085321197 11:75575060-75575082 CAGGGCAGTGATGGGGCACTGGG - Intergenic
1085417804 11:76330834-76330856 CATGGCAGTGATGGGTAAGCAGG - Intergenic
1086558319 11:88138388-88138410 TACTGAAAAGATGGGGAAGTGGG + Intronic
1091002519 11:131922284-131922306 CACGGCAAGGAAGGGGCAGAGGG - Intronic
1092116491 12:6012416-6012438 CACGCCAGGGATGGGGAAGGTGG + Intronic
1094659090 12:32449157-32449179 TACAGAAATGATGGGGCAGTGGG - Intronic
1097043423 12:56170081-56170103 CACTGTGGTGATGGGGAAGTTGG - Intronic
1098366771 12:69711862-69711884 CAGGGAAATGGTGGGGCAGTAGG + Intergenic
1101246282 12:102886742-102886764 CATGGCAATGATAGAGAAGATGG - Intronic
1102568468 12:113812604-113812626 ATCTGCAATTATGGGGAAGTGGG + Intergenic
1103192958 12:119017961-119017983 CACGTTAGTGATGAGGAAGTTGG - Intronic
1104182221 12:126393249-126393271 CATGTAAATGATGGGGACGTTGG + Intergenic
1104741390 12:131177382-131177404 GACTGCAGTGATGGGGATGTGGG - Intergenic
1114315269 14:21504117-21504139 CACAGCAAGGATAGGGAATTAGG - Intronic
1117772721 14:59151087-59151109 AAAGACAAGGATGGGGAAGTGGG + Intergenic
1118836561 14:69482549-69482571 CACAGCAGTCATGGGGAGGTGGG - Intergenic
1121514487 14:94540369-94540391 CACAGCAATGTTGGGGGTGTTGG + Intergenic
1122384175 14:101332795-101332817 CATGGCAATGATGGTGATGACGG + Intergenic
1122469719 14:101958065-101958087 GAGAGCAATGCTGGGGAAGTGGG - Intergenic
1126877178 15:53056275-53056297 CAGGGCAATGATGGACAACTTGG - Intergenic
1128300219 15:66561998-66562020 CATGGCAAAGAGGGGGAAGCTGG - Intronic
1128819147 15:70636646-70636668 CACGGCAATGAGAGGGGAATGGG - Intergenic
1129408604 15:75336437-75336459 CACGGCAGGGCTGGGGAAGGGGG - Intronic
1129828322 15:78650337-78650359 CACTCCACAGATGGGGAAGTTGG - Intronic
1131411669 15:92212807-92212829 CCCATCAAAGATGGGGAAGTTGG - Intergenic
1132986663 16:2770922-2770944 CACGGCTCTGCTGGGGAAGAAGG - Exonic
1133197436 16:4181508-4181530 TACGGCAATGATGGCCAGGTTGG + Intergenic
1133741311 16:8653766-8653788 CTTGGAAATGATGGGGAAGCAGG - Intergenic
1135811691 16:25592840-25592862 CCTGGCAGTGGTGGGGAAGTGGG + Intergenic
1137351345 16:47716480-47716502 CCCGGCAATGATGGGGAGGGAGG + Intergenic
1139603747 16:68003034-68003056 CACGGAAATCACGGGGAAGATGG - Intronic
1141710073 16:85693503-85693525 CAGGGGAAGGAAGGGGAAGTGGG - Intronic
1142717731 17:1756090-1756112 CACGGCCTTGAAGGGGAAGAAGG + Intergenic
1142836499 17:2591796-2591818 CAAGGCAGGGATGGGGAGGTTGG - Intergenic
1142960065 17:3547100-3547122 CACCTCAAGGATGGGGAAGATGG + Intronic
1146678598 17:34791214-34791236 GACGGTAAGGCTGGGGAAGTGGG - Intergenic
1148144536 17:45354636-45354658 CATGGCACTGATGGAGAGGTGGG + Intergenic
1148383299 17:47216443-47216465 CAAGGAAATGATGGGGAGGAAGG - Intronic
1149683371 17:58520797-58520819 GACAGCAGGGATGGGGAAGTCGG + Exonic
1150555909 17:66253896-66253918 TCAGGCCATGATGGGGAAGTGGG - Intronic
1150940445 17:69687666-69687688 CCCAGCAATGGTGGGGAACTAGG - Intergenic
1151553722 17:74836296-74836318 CACGGCAATGATGGGGAAGTTGG - Exonic
1153165799 18:2261054-2261076 TATGGGAATGATGGGGAAGATGG - Intergenic
1153493635 18:5675416-5675438 CACTGGAATGGTGAGGAAGTCGG - Intergenic
1154194278 18:12254430-12254452 CACGGCAATCAGGGGGACGCGGG - Intronic
1155433256 18:25784185-25784207 CACAGCAATAATGGGAAGGTGGG + Intergenic
1156012048 18:32507190-32507212 CACGGAATTGATAGGGAAGGAGG + Intergenic
1156202946 18:34855005-34855027 GACCACAATGATGGTGAAGTGGG - Intronic
1157851364 18:51054961-51054983 CACAGGAATGTTGGGAAAGTTGG - Exonic
1158512857 18:58106893-58106915 CAGGAGAATGATGAGGAAGTGGG + Intronic
1159836387 18:73341887-73341909 CAATGCAATGATGGAGAAATTGG - Intergenic
1159886367 18:73911529-73911551 CACGGAAATGTTGGGGAGGCCGG + Intergenic
1160160831 18:76468841-76468863 CAAGGAACTGATGGGGAAGATGG - Intronic
1162551329 19:11359984-11360006 CATGGTAATGGTGGGGAGGTGGG + Intronic
1167622443 19:50567485-50567507 CACGCCAGTGATGGGGAGGGGGG - Intronic
927713532 2:25340024-25340046 CACGGCAGTGAGGGGCAAGTTGG + Intronic
932621105 2:73265395-73265417 CACAGCACTGAGGGGGAAGAGGG - Exonic
932814801 2:74853139-74853161 CAAGGCAGGGATGGGCAAGTTGG + Intronic
934680030 2:96277008-96277030 CACGTCAGTGATGGGGCAGTGGG + Intronic
935159351 2:100515858-100515880 CCAGGCAAAGGTGGGGAAGTGGG + Intergenic
941663722 2:168222299-168222321 CAGAGCAATGATGGGGACATTGG - Intronic
948120226 2:235524025-235524047 CACTGGAAGGATGGGGAAGCCGG - Intronic
948575061 2:238944439-238944461 CATGGCAATGAGTGGCAAGTTGG + Intergenic
948826118 2:240574136-240574158 CATGGCCACGATGGGGAAGGAGG - Exonic
1172192328 20:33069424-33069446 CAAGGCAAGGATGGGGCAGAAGG - Intronic
1173544266 20:43881167-43881189 AAAGGCAATGATGGGAAGGTGGG + Intergenic
1176045898 20:63092444-63092466 CATTGGGATGATGGGGAAGTGGG - Intergenic
1177554819 21:22675596-22675618 CACGGGTGTGATAGGGAAGTGGG - Intergenic
1180567909 22:16690902-16690924 CACGCCAGGGATGGGGAAGGTGG + Intergenic
1182013805 22:27022400-27022422 CAAGGCATTGCTGGTGAAGTTGG + Intergenic
1183342855 22:37291539-37291561 CTGGGCAAACATGGGGAAGTGGG + Intronic
1185319826 22:50195398-50195420 CACTGCAAGGCTGGAGAAGTGGG - Intronic
950128759 3:10527640-10527662 CAGGGCAGTGGTGGGGAGGTAGG - Intronic
953040139 3:39249090-39249112 CATGGCCATGATGGCTAAGTTGG - Intergenic
954688116 3:52381609-52381631 CAAGGCGAGGATGGGGAAGGCGG - Intronic
956900857 3:73714438-73714460 CAAGGTACTGATGGGGAAATAGG + Intergenic
959746648 3:109783180-109783202 TACAGCAATGATGGGGTTGTTGG + Intergenic
960028715 3:113036414-113036436 CACAGTAGTGATGGGGAAATTGG + Intergenic
960183904 3:114615425-114615447 CAAGGCAAAGAAGGGCAAGTTGG + Intronic
961472181 3:127122427-127122449 CAGGGCACTGATGGGAAAGGAGG + Intergenic
961865658 3:129951847-129951869 CACTGTAAGCATGGGGAAGTAGG - Intergenic
964420232 3:156494615-156494637 CAAGGCAATGAAGGCCAAGTAGG + Intronic
965099974 3:164283946-164283968 CACGGCCACGAAGGGGACGTTGG + Intergenic
965738503 3:171848081-171848103 CAAGACAATGACAGGGAAGTTGG - Intronic
968935726 4:3609179-3609201 CACGGCACTGACAGGGAAGAGGG + Intergenic
969057159 4:4409198-4409220 CACCGCCGTGATGGGGCAGTGGG + Intronic
971963489 4:33520045-33520067 CACTGCAATGCTCAGGAAGTAGG + Intergenic
975314035 4:72931669-72931691 AAAGGCAATGATGGGGATGCTGG - Intergenic
976800168 4:88981601-88981623 CAAGGCAATGATGAGGATGTTGG + Intronic
978905745 4:114003526-114003548 CATGTCAATGATGGGGCAGGTGG + Intergenic
979741109 4:124152278-124152300 CATGGCAACATTGGGGAAGTCGG + Intergenic
980258290 4:130411883-130411905 AAAGGCACTGATGGGCAAGTTGG + Intergenic
983187217 4:164713825-164713847 CACAGCAATGTTGGGGAGGGTGG - Intergenic
985352781 4:189083970-189083992 CAAGGGAGCGATGGGGAAGTTGG - Intergenic
986100986 5:4611277-4611299 CACTGCAGTGATGCAGAAGTGGG + Intergenic
990138100 5:52671311-52671333 CACAGGAAGGATGGGGAATTGGG - Intergenic
992570800 5:78054957-78054979 CAGGGAAAGGATGGGGAAATGGG + Intronic
994377446 5:99030940-99030962 CACTGCACTGGTGTGGAAGTAGG - Intergenic
997814603 5:137004007-137004029 CAGGGCAATGGTGGAGTAGTGGG - Intronic
1000532748 5:162444372-162444394 CACAGTAATGATACGGAAGTGGG + Intergenic
1001759438 5:174195065-174195087 CACGGCAGTGATGAGCATGTGGG - Intronic
1002908225 6:1468210-1468232 AAAGGCAAAGAGGGGGAAGTAGG + Intergenic
1003336816 6:5181327-5181349 CAGGGCAATGAGGGGAAAGTAGG - Intronic
1004774441 6:18827041-18827063 CTCTGCAATGATGACGAAGTGGG - Intergenic
1007180763 6:39927586-39927608 CTCTGCAATGTTGGGGAAGCTGG + Exonic
1010636321 6:78262978-78263000 CACAGCAAAGATAAGGAAGTCGG + Intergenic
1011823062 6:91275150-91275172 CAGTGCAATGATGGGGGTGTGGG + Intergenic
1014565279 6:122941348-122941370 CACGGCAATCATGCAGAAGAAGG - Intergenic
1018336750 6:162799604-162799626 CAGTGCGATGATGGGAAAGTGGG + Intronic
1024118262 7:46212996-46213018 GAGGGGAATGCTGGGGAAGTTGG + Intergenic
1026258630 7:68734845-68734867 CATTGCAATGAAGGGGAAGTCGG - Intergenic
1026290279 7:68999890-68999912 CCCAGCCATGATGGGGAAATTGG + Intergenic
1026513484 7:71046938-71046960 GAAGGCAAAGATGGGGAAATGGG + Intergenic
1029964780 7:104728050-104728072 CATGGCAATGCTTGGGATGTGGG + Intronic
1031434569 7:121716330-121716352 CACAGCATTGGTGAGGAAGTAGG - Intergenic
1035044551 7:155955043-155955065 CCCTGCTGTGATGGGGAAGTTGG - Intergenic
1042982376 8:74544799-74544821 CACAGCATTGATGGAGATGTTGG + Intergenic
1047112724 8:121808959-121808981 CACGGCACTGGTGGGAATGTAGG - Intergenic
1051186736 9:14468371-14468393 CAGGGCAGTGAAGGGGAAGGGGG + Intergenic
1052742630 9:32408231-32408253 TACAGCAATGATGGGAAAGCTGG - Intronic
1053281438 9:36822497-36822519 CTCAGCATTGCTGGGGAAGTTGG + Intergenic
1056110224 9:83388008-83388030 CAGGGCAGTGGTGGGGATGTGGG - Intronic
1057403351 9:94744040-94744062 CAAGGCAATGGTGGGGAGGGAGG + Intronic
1059781638 9:117534925-117534947 CAAGGTAATAATGGAGAAGTAGG + Intergenic
1060112804 9:120918889-120918911 CACAGCCATGAGGGGGAGGTTGG + Intronic
1060454316 9:123776832-123776854 CATGAAAATGAGGGGGAAGTAGG + Intronic
1061077981 9:128353343-128353365 CTGGACAATGAGGGGGAAGTGGG - Intronic
1061169148 9:128941902-128941924 CAAGGCTATGTTGGGGCAGTAGG - Exonic
1061292826 9:129661698-129661720 CAGGGCAAGGATGGTGAACTCGG - Intergenic
1061444814 9:130631849-130631871 CAGGGCACTGAGGGGGCAGTCGG - Intronic
1062038445 9:134393057-134393079 CCCGGGAATCATGGGGAAGCGGG + Intronic
1185789976 X:2921872-2921894 CACGGAGATGATGGAGAAATGGG - Intronic
1187793966 X:22980908-22980930 CAAGGAAATGAAGGGGAAATTGG - Intergenic
1188287029 X:28339762-28339784 CAAGGCAATGATGTGGAGTTTGG + Intergenic
1188811641 X:34658747-34658769 CACGGTAATGATTGAGAGGTGGG - Intergenic
1191797357 X:65035055-65035077 CACGTCGATGGTGGTGAAGTTGG + Intergenic
1195480518 X:105339452-105339474 CAGGGAGATGATGGAGAAGTTGG + Intronic