ID: 1151554091

View in Genome Browser
Species Human (GRCh38)
Location 17:74837869-74837891
Sequence CTTGCCCCCAGCCCTGGGCC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 889
Summary {0: 1, 1: 1, 2: 7, 3: 97, 4: 783}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151554081_1151554091 4 Left 1151554081 17:74837842-74837864 CCTGGGGGTCCCCCTGACCCTCA 0: 1
1: 0
2: 4
3: 36
4: 284
Right 1151554091 17:74837869-74837891 CTTGCCCCCAGCCCTGGGCCTGG 0: 1
1: 1
2: 7
3: 97
4: 783
1151554086_1151554091 -8 Left 1151554086 17:74837854-74837876 CCTGACCCTCACTGGCTTGCCCC 0: 1
1: 0
2: 1
3: 27
4: 268
Right 1151554091 17:74837869-74837891 CTTGCCCCCAGCCCTGGGCCTGG 0: 1
1: 1
2: 7
3: 97
4: 783
1151554084_1151554091 -6 Left 1151554084 17:74837852-74837874 CCCCTGACCCTCACTGGCTTGCC 0: 1
1: 0
2: 0
3: 23
4: 263
Right 1151554091 17:74837869-74837891 CTTGCCCCCAGCCCTGGGCCTGG 0: 1
1: 1
2: 7
3: 97
4: 783
1151554083_1151554091 -5 Left 1151554083 17:74837851-74837873 CCCCCTGACCCTCACTGGCTTGC 0: 1
1: 0
2: 2
3: 24
4: 232
Right 1151554091 17:74837869-74837891 CTTGCCCCCAGCCCTGGGCCTGG 0: 1
1: 1
2: 7
3: 97
4: 783
1151554085_1151554091 -7 Left 1151554085 17:74837853-74837875 CCCTGACCCTCACTGGCTTGCCC 0: 1
1: 0
2: 1
3: 24
4: 287
Right 1151554091 17:74837869-74837891 CTTGCCCCCAGCCCTGGGCCTGG 0: 1
1: 1
2: 7
3: 97
4: 783
1151554076_1151554091 22 Left 1151554076 17:74837824-74837846 CCTTCTACTGCTTCAGGACCTGG 0: 1
1: 1
2: 2
3: 34
4: 225
Right 1151554091 17:74837869-74837891 CTTGCCCCCAGCCCTGGGCCTGG 0: 1
1: 1
2: 7
3: 97
4: 783

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151554091 Original CRISPR CTTGCCCCCAGCCCTGGGCC TGG Exonic
900120876 1:1048197-1048219 ACTGCCCCCAGCCGTGTGCCCGG + Exonic
900203400 1:1421050-1421072 CCTGCCCCCAGCCGTGTCCCAGG + Intronic
900250260 1:1665219-1665241 GATGCCCACAGCCCTGGGTCAGG + Exonic
900283940 1:1890573-1890595 TCGGCCCCCAGCCTTGGGCCTGG + Intronic
900308021 1:2020257-2020279 CTTGGCCCCACCACGGGGCCTGG + Intronic
900356967 1:2269719-2269741 CCTCCTGCCAGCCCTGGGCCCGG - Intronic
900400396 1:2470668-2470690 CCTGCCCCCAGCCCATAGCCAGG - Intronic
900400454 1:2470872-2470894 CTTGCCCCCAGCCACCGTCCAGG - Intronic
900411041 1:2512816-2512838 CTTGCCCGCAAGCCTGGGGCAGG + Intronic
900431549 1:2605334-2605356 CTTGTCCCCAGGCCTGGCCCGGG + Intronic
900486413 1:2924828-2924850 CTTGGCCCCAGCTTGGGGCCTGG - Intergenic
900557624 1:3288235-3288257 CTTGTCCCAAGTGCTGGGCCTGG - Intronic
900557958 1:3289517-3289539 CAAGCCCCCAGCCCTGGCACAGG - Intronic
900634848 1:3657949-3657971 CCGGGCCCCAGCCCTGGACCTGG + Intronic
900657158 1:3764062-3764084 CTTGCCTCCAGCCCAGGGACAGG - Intronic
900782296 1:4626100-4626122 CCTGCACCCAGCCCTCCGCCTGG - Intergenic
900907073 1:5566895-5566917 GCTGCCCAAAGCCCTGGGCCAGG - Intergenic
900989284 1:6090598-6090620 CTCGCCCCCCACCCTGGACCCGG - Intronic
901047442 1:6405800-6405822 CTAGCGCCCAGCACAGGGCCTGG - Intergenic
901070209 1:6513187-6513209 CCTGGCACCTGCCCTGGGCCAGG - Intronic
901654819 1:10763160-10763182 CTTTCCCACAGCCCAGGCCCCGG + Intronic
902408682 1:16200344-16200366 AAGGCCCCTAGCCCTGGGCCTGG + Intronic
902512257 1:16972780-16972802 TCTGACCCCTGCCCTGGGCCTGG - Exonic
902653712 1:17853323-17853345 CGTTCCCCCAGCCCTGCTCCTGG + Intergenic
902700645 1:18169620-18169642 CCTGCCCCCAGCCCAGGGTAGGG + Intronic
902817870 1:18926402-18926424 ACTTCCCACAGCCCTGGGCCAGG + Intronic
902955503 1:19922170-19922192 CATGCCTCCAGCCCAGGGTCTGG + Intronic
903018427 1:20376984-20377006 CTTGCTCCCAGCCCTGCCCTGGG + Intergenic
903289243 1:22297408-22297430 CCTGCCCACACACCTGGGCCTGG + Intergenic
903373644 1:22852572-22852594 ATTGCCCCCAGCCCCAGGTCTGG - Intronic
903518983 1:23933295-23933317 CCGGCGCCGAGCCCTGGGCCTGG + Intergenic
903828090 1:26159434-26159456 CTTCTCCCCAGCCCTGAGCAGGG - Intronic
903933607 1:26879325-26879347 CTTCCCCAAACCCCTGGGCCCGG + Exonic
904038606 1:27571689-27571711 CTTCACCCAAGCCCTGGGGCTGG + Intronic
904203897 1:28840045-28840067 CTAGCACCCAGCACAGGGCCAGG - Intronic
904328059 1:29740195-29740217 CCTGCCCCTGGCCCTGGGGCTGG + Intergenic
904428887 1:30449174-30449196 CTGCCTGCCAGCCCTGGGCCTGG + Intergenic
904998161 1:34647494-34647516 CTTTACCCCATCCCTGGGCAGGG + Intergenic
905234184 1:36534509-36534531 CTTCCCCCCAGCTTTGGGCCAGG - Intergenic
905323105 1:37131643-37131665 CTTGCCCCCAGTCCTGCCCTAGG + Intergenic
905483294 1:38276313-38276335 CTTGGCACCAGCTCTGTGCCAGG - Intergenic
905485513 1:38293014-38293036 CCAGCCCCCAGCCCAGGGCCTGG + Intergenic
905923279 1:41732951-41732973 CTAGGACCCAGCCCTGGGCCTGG + Intronic
907268796 1:53278319-53278341 CCTACCCCCATCCCGGGGCCAGG - Intronic
907306800 1:53517801-53517823 CTTGCCCCTGCCCCGGGGCCAGG + Intronic
907457573 1:54585343-54585365 CCTGCCCCCAGGCCTGGGTCAGG - Intronic
907540890 1:55214914-55214936 GGTGGCCCCAGCCCCGGGCCCGG - Exonic
907828270 1:58039255-58039277 CTTGCCCCTATACCTGAGCCAGG + Intronic
907927023 1:58964704-58964726 CTAGATCCCAGCCCAGGGCCTGG - Intergenic
908121460 1:60990051-60990073 ATTGCACCCAGCACTGGGCTGGG - Intronic
908261057 1:62339484-62339506 CTTCCCAGCAGCCCTGGGGCTGG - Intergenic
908703938 1:66930438-66930460 GGCGCCCCCGGCCCTGGGCCGGG + Intronic
909647593 1:77934723-77934745 CTTGGCCCCTGCCAGGGGCCAGG + Intronic
912643454 1:111369197-111369219 CTAGCCCTGAGCCCTGGACCTGG - Intergenic
912787454 1:112618869-112618891 CTGGCCCCCCGCCCTGCCCCAGG + Intronic
912808882 1:112778464-112778486 CTAGCACCCAGCACTGTGCCTGG - Intergenic
913283811 1:117209696-117209718 TCTGCCCCCACCCCTGTGCCTGG - Intronic
915102471 1:153510317-153510339 TTTGCCCCCTTCCCTAGGCCTGG - Intergenic
915142519 1:153776238-153776260 CTTGGTCTCATCCCTGGGCCTGG + Intronic
915237179 1:154492499-154492521 CTGGCCCCCACCCCCAGGCCAGG + Intronic
915528334 1:156489611-156489633 TATTCCCCCAGCGCTGGGCCAGG - Intronic
915529387 1:156494596-156494618 CTTGCCCCCACCCCTGCTTCTGG + Intronic
915748474 1:158182901-158182923 CGTGGCCCCAGTCCTGGCCCTGG + Exonic
915755625 1:158256809-158256831 CATGGCCCCAGTCCTGGCCCTGG + Exonic
915915211 1:159936753-159936775 CTTGCACCTGGCCCTGGCCCTGG + Exonic
915972682 1:160365543-160365565 CCTGCCCCCATCCCTGAGTCTGG - Intergenic
916045872 1:160999585-160999607 ACTGCCCCCATCCCAGGGCCTGG - Intronic
916533982 1:165685829-165685851 CTTGCCTCCAGCCCTGGCCCAGG - Intronic
916629960 1:166601634-166601656 GTTCCCCACACCCCTGGGCCAGG - Intergenic
916750946 1:167722253-167722275 CCCGGCCCCAGCCCTGGTCCTGG - Intronic
917480019 1:175403803-175403825 TTTGCCCCCAGCCCTGTGCTAGG - Intronic
919755578 1:201064167-201064189 CTGGCCCCCTGCCCAGGGCCTGG - Intronic
919926904 1:202196199-202196221 CGTGTCCCCTGCCCTGGGCTGGG + Intronic
919973858 1:202598504-202598526 CTTGCCCCCAGCCCTCCTGCGGG + Intronic
920296104 1:204957840-204957862 TTGGCCCCCAGCCCCGGGACAGG - Intronic
920397954 1:205660217-205660239 CTTGTCCCCAGCCTTGGGGCAGG + Intronic
921829060 1:219706718-219706740 CTGGCCCCCAACCCTGTGACAGG - Intronic
922496689 1:226062854-226062876 CTTGCCGTCAGCCCCGAGCCGGG + Intronic
922726626 1:227925855-227925877 CCTGCCCACAGCCCTAGGCGGGG - Intronic
922801224 1:228365600-228365622 CATGCCCCCTGCCCAGGGCTGGG + Intronic
922801230 1:228365606-228365628 ATGCCCCCCAGCCCTGGGCAGGG - Intronic
923069672 1:230550950-230550972 CTTGCCCCCAACCCCGCGACAGG + Intergenic
923678599 1:236100996-236101018 GCTTCCCACAGCCCTGGGCCCGG + Intergenic
1062796882 10:351431-351453 CCTCCCCGCAGCCCTGGTCCTGG - Intronic
1063171635 10:3514895-3514917 CCTGGCCACACCCCTGGGCCAGG - Intergenic
1063363842 10:5478096-5478118 GCTACCCCCTGCCCTGGGCCTGG + Intergenic
1063374462 10:5545812-5545834 TTTGAACCCAGCCCTGGGCAGGG - Intergenic
1064304782 10:14155392-14155414 ATTGCCCCCAGTGCTGGGCTGGG - Intronic
1065389445 10:25167929-25167951 CCTGCCCCCACCCCAGGCCCTGG + Intergenic
1066393597 10:34998305-34998327 AGTTCCTCCAGCCCTGGGCCTGG + Intergenic
1067038932 10:42938417-42938439 CTTGCCCCCAGCCCAGCTCCTGG + Intergenic
1067275508 10:44829570-44829592 TTTGCCCCCAGCCGTGGGGTTGG + Intergenic
1067497855 10:46775200-46775222 CCTCCCCCCAGCCCTGCGGCCGG - Intergenic
1067596795 10:47565214-47565236 CCTCCCCCCAGCCCTGCGGCCGG + Intergenic
1067785317 10:49241577-49241599 CTTGCTCTCAGTCCTGAGCCTGG - Intergenic
1069024007 10:63521241-63521263 CCTGGCCCCAGCCCTGGCCCGGG + Intergenic
1069588908 10:69630138-69630160 GCCGCCCCCAACCCTGGGCCGGG + Intergenic
1069867485 10:71512675-71512697 CTGGCCCCCAGCCCAAGGGCAGG - Intronic
1069960276 10:72075275-72075297 CTTGTCCCCACCCCTGCCCCAGG - Intronic
1070161028 10:73866848-73866870 CTTATGCACAGCCCTGGGCCTGG + Intronic
1070587846 10:77780005-77780027 CTGGCCCCCACCCCAGGGGCAGG - Intergenic
1070679648 10:78439556-78439578 CTTCCCACCAGGCCTGGGTCAGG - Intergenic
1070715803 10:78720124-78720146 CCAGCCCCCAGCCCTGAGCCTGG - Intergenic
1070828386 10:79404190-79404212 CGTGCCTCCAGCCCTGTGCCCGG + Intronic
1072294200 10:93993881-93993903 CGGGGCCCCCGCCCTGGGCCGGG - Intergenic
1072583415 10:96760215-96760237 CTTGCCCCCAACCCTCTGACAGG - Intergenic
1072757471 10:98030553-98030575 CTTGCTCCCAGCCCCGGTCCCGG + Exonic
1073242750 10:102068872-102068894 CTTGGCCCCAACCCTGGACAAGG - Intergenic
1073287639 10:102398314-102398336 TTAGCCCCCAGCCCGGGCCCGGG - Intronic
1073294805 10:102432491-102432513 CCTGCCCCCGGCCCAGGGCTAGG - Intronic
1073614458 10:104978971-104978993 CTTGCTCCCTTCCCTGTGCCTGG + Intronic
1074497310 10:113991430-113991452 CTGGCCACCAGCCCCTGGCCAGG + Intergenic
1075060292 10:119252399-119252421 CCTACCCCCAGCCCTGGGAAAGG - Intronic
1075572492 10:123556306-123556328 GTTGGCACCAGCCCTGGACCAGG - Intergenic
1075779438 10:125007341-125007363 CTGACGCCCATCCCTGGGCCTGG + Intronic
1075914610 10:126156759-126156781 CTTCCACCCTGTCCTGGGCCTGG - Intronic
1076391968 10:130110278-130110300 CCAACACCCAGCCCTGGGCCTGG + Intergenic
1076476732 10:130758811-130758833 CTTGCTCCCAGCTCCTGGCCTGG - Intergenic
1076541756 10:131219414-131219436 CTTGCCCCCAGGCCAGGAGCAGG + Intronic
1076620712 10:131785557-131785579 ATTGGGTCCAGCCCTGGGCCTGG - Intergenic
1077043722 11:535437-535459 CTCGGCCCCGGCCCTGGCCCCGG - Exonic
1077076994 11:706422-706444 CTTGCCCCGCGCCCTCGGCCCGG - Intronic
1077093358 11:789331-789353 CCTGCCTCCAGCCCTGGAGCAGG + Intronic
1077112302 11:867157-867179 CTGGCACCCAGGCCTGGGGCAGG + Intergenic
1077158845 11:1103525-1103547 CTGGCCACCCGCCCTGGGGCAGG - Intergenic
1077183585 11:1226949-1226971 CCCCCCCCCAGCCCTGGCCCAGG - Intronic
1077263782 11:1638577-1638599 CTCGCCCCCGACCCTGGGCTGGG + Intergenic
1077343299 11:2035549-2035571 CTCTGCCCCAGCCCTGGCCCCGG + Intergenic
1077356303 11:2120496-2120518 GTTTCCCCCACCCCTGGACCTGG - Intergenic
1077638464 11:3859763-3859785 CTTGGCCCCAGCCCAGTTCCGGG - Intronic
1079233120 11:18667261-18667283 CTGGCACCGTGCCCTGGGCCTGG + Intergenic
1079446569 11:20562174-20562196 CTTGCCTCCACCACTGAGCCTGG + Intergenic
1080272723 11:30467585-30467607 TTGGCTCCCAGCCCAGGGCCTGG - Intronic
1080687065 11:34524666-34524688 CTTGCCCCAAGCCATCTGCCAGG - Intergenic
1081525328 11:43924323-43924345 CCGTCCCCCAGCCCTGGCCCTGG + Intergenic
1081537311 11:44005208-44005230 CCTGCCCCCAGCCCCCTGCCTGG + Intergenic
1081702238 11:45159159-45159181 CTTGGCCACTGTCCTGGGCCTGG - Intronic
1081873004 11:46391700-46391722 CCCGCCCCCGGCCCTCGGCCCGG - Intergenic
1082025166 11:47566030-47566052 CTCGCCCACCGCCCTGAGCCTGG + Intronic
1083613182 11:64014093-64014115 CTGGCACCCAGCTCGGGGCCCGG + Intronic
1083632629 11:64103718-64103740 CTGGCACCCAGCCCTGAGCAGGG - Exonic
1083882970 11:65557599-65557621 CCTGCCCCCAGCCGTGCCCCCGG + Intronic
1083889722 11:65589763-65589785 CCTGACCCCAGCCCTGCCCCAGG + Exonic
1084068770 11:66720484-66720506 CTTCCCTGCAGCCCAGGGCCTGG - Intronic
1084170836 11:67400336-67400358 CATGCCCCCACCCATGAGCCGGG + Intronic
1084179916 11:67441069-67441091 CTTGGGCCCCACCCTGGGCCAGG - Intronic
1084212196 11:67629458-67629480 CTTGCGCGCACGCCTGGGCCGGG - Intronic
1084357759 11:68651274-68651296 CTTGCCCCCTGGCCTGTTCCAGG + Intergenic
1084441024 11:69173462-69173484 CTTGCCCAGAGGGCTGGGCCAGG - Intergenic
1084470292 11:69355543-69355565 CCGGTCCCCTGCCCTGGGCCAGG + Intronic
1084503925 11:69553587-69553609 CCTGGCTCCAGCCCTTGGCCAGG + Intergenic
1084550761 11:69840437-69840459 TTGGCCCCAAGCCCAGGGCCAGG - Intergenic
1084698909 11:70773056-70773078 CCTGCCCACAGCCCTGGGGATGG - Intronic
1084947783 11:72648184-72648206 CTTGCCCCTATCTTTGGGCCTGG + Intronic
1085109342 11:73873842-73873864 TGTGCCCCCAGCACTAGGCCTGG + Intronic
1085171999 11:74457445-74457467 TCTGGCCCCAGCCCTGGCCCTGG + Exonic
1085296395 11:75434103-75434125 GGTGCCCCCAGTCCTGGGCATGG + Intergenic
1085297481 11:75439233-75439255 CGTGCACCAAGCCCTGTGCCCGG - Intronic
1085417825 11:76330901-76330923 CTTGTTCCCAGCCCTGTCCCAGG - Intergenic
1085479217 11:76807642-76807664 CTTTCTCCCTGCCCTGTGCCGGG + Intergenic
1085531728 11:77195702-77195724 CTGTCCCAGAGCCCTGGGCCAGG + Intronic
1085875092 11:80397131-80397153 CTTGCCCACAGCCCTGCTACTGG - Intergenic
1086337082 11:85811004-85811026 CTGGCCCCCAGCCCTCGGCCTGG + Exonic
1088250538 11:107858092-107858114 CTGGACCCCAGCCCTGGGGGTGG + Intronic
1088589932 11:111394727-111394749 CTTGTGCCCAGCCCTGTGCCTGG + Intronic
1088796519 11:113270344-113270366 CTTGCCCTTGGCCCCGGGCCCGG - Exonic
1089169594 11:116502850-116502872 CTGGCCTCCAGCCATGGGCCAGG + Intergenic
1089418541 11:118313927-118313949 CTTGCCACCCACCCTGGCCCAGG - Intronic
1089543108 11:119202748-119202770 ATTGCCCCCAGGCATGGGTCGGG + Intergenic
1089593566 11:119560473-119560495 CTTGCCCTGAGCCCTGGGGCAGG + Intergenic
1089958068 11:122590800-122590822 CTTGCTCTCAGTCCTAGGCCTGG + Intergenic
1090306169 11:125693098-125693120 CCTGCCCCCTGCCCAGGGCTAGG - Intergenic
1090331521 11:125935992-125936014 CCTGCCCGGAGCCCTAGGCCTGG + Intergenic
1090385614 11:126356118-126356140 CAATCCCCCAGCCCTGCGCCCGG + Intronic
1090978835 11:131698727-131698749 CTTGCTCTCAGCCCAGTGCCAGG + Intronic
1091070854 11:132561523-132561545 CTTGTCCCAGGCCCTGGACCAGG - Intronic
1202826285 11_KI270721v1_random:90738-90760 CTCTGCCCCAGCCCTGGCCCCGG + Intergenic
1091787978 12:3254426-3254448 CTTGCCCCTTCCCCTGGGTCAGG + Intronic
1092289334 12:7149779-7149801 CTTGTCCACATCCCTGGACCTGG - Intronic
1092886687 12:12930487-12930509 GTGGCCTCCAGACCTGGGCCTGG - Intergenic
1092945625 12:13451348-13451370 CTTGGCCCTGGCCCTGGCCCTGG + Intergenic
1093829857 12:23742700-23742722 CCTGCACCCAGCCTTGGGCTAGG - Intronic
1094383748 12:29871513-29871535 CTAGCCCCTAGAACTGGGCCTGG + Intergenic
1095198687 12:39356297-39356319 CTTGCCCCCAGCCCCAGTCATGG + Intronic
1095945952 12:47753515-47753537 CTTCCGCCCAGCCCTGGGCCAGG - Intronic
1095962567 12:47844670-47844692 GTAGCCGCCAGCCCCGGGCCTGG + Exonic
1096589265 12:52646665-52646687 TTTGCCTCCAGCCCTGGCTCTGG + Intronic
1096863925 12:54549993-54550015 CTTCCCCCCATTCCCGGGCCGGG - Intronic
1097014317 12:55974374-55974396 CCAGCCCCCGGCCCTCGGCCTGG - Intronic
1097521463 12:60676014-60676036 CCTGCCCTCAGCCCTGTGTCTGG + Intergenic
1098039287 12:66337787-66337809 CTAGCACCCAGCTCTGGGTCTGG - Intronic
1099973593 12:89524921-89524943 CCGGCCCCCAGCCCCCGGCCCGG - Intronic
1101519822 12:105471230-105471252 CTTGGCCCCAGAACTGTGCCTGG - Intergenic
1102443246 12:112979482-112979504 GGTGTCCCCAGCCCTGGCCCAGG + Intronic
1102491288 12:113291027-113291049 CTTCCCGCCAGCCCTGGGGTCGG + Intronic
1102780683 12:115562064-115562086 CCTGTGTCCAGCCCTGGGCCCGG - Intergenic
1103012025 12:117465181-117465203 CTGTGTCCCAGCCCTGGGCCTGG - Exonic
1103322701 12:120101199-120101221 CAAGCCCCCAGCTCTGTGCCTGG - Intronic
1104853897 12:131893134-131893156 CTGGCCCCCAGTCCAGGGTCGGG + Intergenic
1104949405 12:132432353-132432375 CGTGCTCCCAGCCTGGGGCCAGG - Intergenic
1104990641 12:132622102-132622124 CGTGCCCCCAGCCCTTGCACAGG - Intronic
1105024786 12:132840685-132840707 CCTGCCTCCAGCCCTGGGCTTGG + Intronic
1105210261 13:18253211-18253233 CTGGCCCCCAGCCATGTGCCCGG + Intergenic
1105814053 13:24017085-24017107 ATGGGGCCCAGCCCTGGGCCAGG + Intronic
1105898456 13:24738227-24738249 CTTTCTCCCAGCACTGGGCCTGG - Intergenic
1105963056 13:25359771-25359793 CTGGCTCCATGCCCTGGGCCTGG + Intergenic
1106125189 13:26895465-26895487 CTTCCCCTCTGCCGTGGGCCGGG + Intergenic
1106157223 13:27170955-27170977 CTTTCCCCCAGCGCGGGGTCGGG + Intronic
1106409315 13:29499952-29499974 CTCCCCGCCAGCCCTAGGCCTGG - Intronic
1106430149 13:29673251-29673273 CTTGCCCCCGACCCTGCGACAGG - Intergenic
1107447908 13:40484601-40484623 CTTGCTCCCATCCCTGGTCTTGG - Intergenic
1107549117 13:41458274-41458296 CCTGCCCGCAGCCCCGGCCCTGG + Exonic
1107969234 13:45625246-45625268 TGTGCCCCCATCTCTGGGCCTGG + Intergenic
1109002112 13:56818378-56818400 CTAGCCCCCCACCCTGGGACAGG - Intergenic
1109294898 13:60518231-60518253 AGTGCTCCCAGCCCTGGCCCTGG + Intronic
1112503028 13:99956760-99956782 CTCTCCCCCAGCCCGCGGCCCGG - Intergenic
1112595774 13:100805734-100805756 GAGGCCCCCAGCTCTGGGCCAGG - Intergenic
1113874403 13:113585162-113585184 CCTGGCCCCAGCCCCGGCCCCGG - Intronic
1113975179 13:114222696-114222718 CCTGGCCCCGGCCCTGGGCAAGG - Intergenic
1114680109 14:24477100-24477122 GGTTCCCCCAGCACTGGGCCTGG + Intergenic
1115644211 14:35356116-35356138 CCTGCCCCCAGCCCTGGTTCTGG - Intergenic
1116973767 14:51094582-51094604 CTTGTCACCGGCCCTGGCCCCGG - Exonic
1117133340 14:52707409-52707431 CTTGTCCCTGGCCCTAGGCCTGG - Intronic
1117829940 14:59740187-59740209 CTTGCACCCAGCACAGTGCCTGG + Intronic
1118309239 14:64680566-64680588 CCAGCCCCCAGCCCTGGAACTGG + Intergenic
1118326677 14:64786103-64786125 CTTGCCCCCACCCCTACCCCAGG + Intronic
1118455847 14:65945333-65945355 ATTGCCCGCAGCCCAGTGCCTGG + Intergenic
1118474631 14:66105198-66105220 CCTGCCACTAGCCCTTGGCCTGG - Intergenic
1119003880 14:70907470-70907492 CCGGCCGCCAGCCCTGGGCCAGG - Exonic
1119174496 14:72559380-72559402 CTTCCCCAAAGCCCCGGGCCAGG + Intronic
1119378801 14:74215629-74215651 CATGCCCCCAGCCATGGTCCTGG + Intergenic
1119426182 14:74535894-74535916 CTTGAGCCCAGCCCTGGCCCTGG + Intronic
1119765475 14:77184987-77185009 CTTGCCAACACCCCTGGGGCTGG + Intronic
1121314336 14:92952154-92952176 CTGGGCACCAGCCCTGGGCACGG + Intronic
1121407163 14:93726098-93726120 CTTGTCCCCTGCCCTGGGCTTGG + Intronic
1121533304 14:94673600-94673622 CTTACCCCAAGCCCTGGGAGGGG + Intergenic
1121607264 14:95250139-95250161 CTGGGCCCCAGAACTGGGCCAGG + Intronic
1121854692 14:97256456-97256478 ATGCCCCCCAGCACTGGGCCAGG - Intergenic
1121908473 14:97768441-97768463 CCTGCCCCAGGCCCTGGCCCAGG - Intergenic
1122204598 14:100142290-100142312 CTGTTCCCCAGCCCAGGGCCAGG - Intronic
1122278919 14:100609974-100609996 CCCTCCCCCAGCCCTGGGGCAGG - Intergenic
1122293493 14:100692339-100692361 CTTGGCCCCAGCCCGGCGCCGGG - Intergenic
1122321375 14:100857966-100857988 TTTGCCACCTTCCCTGGGCCTGG + Intergenic
1122323530 14:100869226-100869248 CCCACCCCCAGCCCTGGCCCAGG - Intergenic
1122323717 14:100870268-100870290 CCCACCCCCAGCCCTGGCCCAGG - Intergenic
1122895249 14:104753475-104753497 ACTGACCCCAGCCCTGGGCGTGG - Intronic
1122903971 14:104793507-104793529 CCAGCGCCCAGCACTGGGCCTGG - Exonic
1122959605 14:105088346-105088368 CCCGCCCCCAGCCCTCCGCCCGG - Intergenic
1123030555 14:105449285-105449307 CCTGCTCCCTGCCCAGGGCCCGG - Intronic
1123062008 14:105598646-105598668 CCTGCACCCAGCTCTGGGCCTGG - Intergenic
1123066553 14:105622140-105622162 CCTGCCCCCAGGCCTGGACATGG + Intergenic
1123086751 14:105720377-105720399 CCTGCACCCAGCTCTGGGCCTGG - Intergenic
1123491529 15:20785463-20785485 CTTGGCCCGAGCCCAGAGCCCGG - Intergenic
1123548033 15:21354557-21354579 CTTGGCCCGAGCCCAGAGCCCGG - Intergenic
1124249347 15:28096939-28096961 CCCGCTCCCAGCCCGGGGCCAGG + Intronic
1124291733 15:28457540-28457562 CTTCCCCCCGGCCCCCGGCCTGG + Intergenic
1124631996 15:31343326-31343348 CTTGCCCCCAGCCGTAAGGCGGG + Intronic
1124675970 15:31686177-31686199 CTTCTCCACAGCCCTGGGCCAGG - Intronic
1125346414 15:38723302-38723324 CTAGCCCCCAGCCATGATCCAGG - Intergenic
1125417296 15:39467093-39467115 CTTGCCTCCTTCCCTGGGCCTGG + Intergenic
1125509833 15:40286926-40286948 CTTCCCCTCACCTCTGGGCCAGG - Intronic
1125517720 15:40332031-40332053 CAGGCCCCCAGCCCTGTGCCTGG + Intronic
1125724833 15:41862870-41862892 CTTTCCCACAGTCCAGGGCCTGG + Exonic
1125950290 15:43746234-43746256 CCTGCCCCCAGCCCAGGACCGGG + Intergenic
1127489633 15:59450145-59450167 CTTGAACCCAGGACTGGGCCTGG - Intronic
1127960608 15:63887737-63887759 CAGGCCTCCAGCCCTGGGCCTGG - Intergenic
1128451270 15:67807155-67807177 CCTGCCCCCAGCCCTGGGGGGGG - Intergenic
1128451604 15:67808994-67809016 CCTGCCCTGAGCACTGGGCCAGG - Intergenic
1128611074 15:69074170-69074192 CCTGCACCCAGCCCTGCTCCGGG - Intergenic
1128699606 15:69794730-69794752 CTTGTCCCCAACCCTTGCCCTGG + Intergenic
1128728451 15:70004992-70005014 CTTTCTCCCTGCCCTGGCCCTGG + Intergenic
1128772436 15:70292301-70292323 CTTTCCCCCTTCACTGGGCCTGG - Intergenic
1129250230 15:74304684-74304706 CCAGCCCCCAGCCCTGGAGCTGG + Intronic
1129518367 15:76170672-76170694 CTTGGCCTCTGCCCAGGGCCTGG + Intronic
1129854220 15:78812154-78812176 CGTGGCCCCAGCCCTGGCTCTGG + Intronic
1131067955 15:89446092-89446114 CCTTCCTCCAGCCCTGGTCCAGG - Intergenic
1131073044 15:89477805-89477827 CTAGCCCCCAGCCCCTTGCCTGG + Intronic
1131367589 15:91853498-91853520 CCAGCCCCAAGGCCTGGGCCTGG - Intergenic
1131827914 15:96334640-96334662 CTGGGCCCCAGCTCTGGGCTAGG - Intronic
1132222724 15:100117002-100117024 CTTCCTTCTAGCCCTGGGCCTGG - Exonic
1132279790 15:100602773-100602795 CCTGCTCCGAGCCCTGGACCGGG + Exonic
1202956363 15_KI270727v1_random:81787-81809 CTTGGCCCGAGCCCAGAGCCCGG - Intergenic
1132588554 16:716491-716513 CTGCCCCCTGGCCCTGGGCCAGG + Intronic
1132688695 16:1172804-1172826 CCAGCCCACAGCCCTGGGCCTGG - Intronic
1132712827 16:1276909-1276931 CTGGCCCCCACCCCTGACCCCGG - Intergenic
1132736590 16:1389045-1389067 CTTGCCCCCTCCCCCGGCCCCGG + Intronic
1132746700 16:1439223-1439245 CTGTCCCCAAGCCCTGAGCCCGG + Intronic
1132989158 16:2784345-2784367 CTTGCGCCCAGCCCTGGCCAGGG + Exonic
1132999634 16:2842385-2842407 TTGGCCCCCATCCCAGGGCCAGG + Intergenic
1133171345 16:3984352-3984374 CTGGCCCCCAGCACAGAGCCAGG - Intronic
1133171440 16:3984787-3984809 CCTGCCCTCAGCCCCGAGCCTGG - Intronic
1133210765 16:4262256-4262278 CTTGGACCCAGCCATGGGCCTGG - Intronic
1134612241 16:15618608-15618630 CTCGCCCACATCCCTGGCCCTGG + Intronic
1134680274 16:16120195-16120217 CCTGCATCCTGCCCTGGGCCAGG - Intronic
1135978030 16:27124015-27124037 GCTGACCCCAGCCCTGGTCCAGG + Intergenic
1136025242 16:27464493-27464515 TTGGCCCCCAGCCTTGGGCCCGG - Exonic
1136139371 16:28278804-28278826 TTTGTCCCCAGCCAGGGGCCTGG + Intergenic
1136143713 16:28303079-28303101 CTTGCCCCCAGACAGGGGGCTGG + Intronic
1136271507 16:29151581-29151603 TTTACCTCCAGCCCTGGGCAAGG + Intergenic
1136498745 16:30659349-30659371 CTTGCCCCAAGGCCACGGCCCGG - Exonic
1136718697 16:32303340-32303362 CCTGGCCCTAGCCCTGGTCCTGG - Intergenic
1136776318 16:32873715-32873737 CTTGCTCCCCGGGCTGGGCCAGG + Intergenic
1136837068 16:33509604-33509626 CCTGGCCCTAGCCCTGGTCCTGG - Intergenic
1136894297 16:33987797-33987819 CTTGCTCCCCGGGCTGGGCCAGG - Intergenic
1136996091 16:35188879-35188901 CCTGCCCCCAGCCCGGCGCATGG - Intergenic
1137592769 16:49703867-49703889 CTTGTGCCCAGCCCAGTGCCCGG + Intronic
1137621074 16:49876840-49876862 CCTGCCGCCAGGCCTGGGCATGG + Intergenic
1137665029 16:50245060-50245082 GTTGCCCCCCGCGGTGGGCCTGG - Intergenic
1138456719 16:57125266-57125288 GCTGTTCCCAGCCCTGGGCCAGG + Intronic
1138583569 16:57956841-57956863 CTTTATCCCAGCCCTGAGCCAGG - Intronic
1138659682 16:58509718-58509740 CTGACCCCAAGCCCTGGGGCGGG - Intronic
1139508095 16:67409635-67409657 CTTGGTCCCATCCATGGGCCTGG - Intronic
1139922069 16:70466869-70466891 CTTCCCCCCACAGCTGGGCCCGG + Exonic
1139956982 16:70697840-70697862 GATGCCCCCAGACATGGGCCTGG + Intronic
1140019574 16:71225255-71225277 CTTGAACCCAAACCTGGGCCTGG + Intronic
1141204023 16:81919474-81919496 CTTGCCCCTAGCCCTGGAGCAGG - Exonic
1141429974 16:83966382-83966404 CTTCCCCCCAGCCCAGTGCAGGG - Intergenic
1141488109 16:84354436-84354458 GTTGCCTGCAGACCTGGGCCAGG + Intergenic
1141546987 16:84776756-84776778 CTCGCCCCGGGACCTGGGCCTGG + Intronic
1141570659 16:84931732-84931754 CTTGCCCACAGCCCTGGCCACGG + Intergenic
1141613716 16:85198372-85198394 CTAGGCCCCAGCTGTGGGCCAGG + Intergenic
1141648096 16:85378104-85378126 CCTGCCCCGAGCCCTGGCACCGG - Intergenic
1141674473 16:85510373-85510395 CTTCCCCGCAGCCCAGGACCAGG + Intergenic
1141801371 16:86311604-86311626 CTACCCCAGAGCCCTGGGCCTGG - Intergenic
1141952186 16:87346243-87346265 TTTGCCCGCAGGCCGGGGCCAGG + Intronic
1142167079 16:88597829-88597851 TTTGCTTCCAGCCCTGGCCCAGG - Intronic
1142206302 16:88784796-88784818 CTCGCCCGCAGCCCTCGCCCCGG + Intronic
1142223254 16:88865479-88865501 CTGGCGCCCGGCCATGGGCCAGG - Intronic
1142240383 16:88941934-88941956 CTCGCCCCCAGCGCGGCGCCTGG + Intronic
1203007734 16_KI270728v1_random:214431-214453 CCTGGCCCTAGCCCTGGTCCTGG + Intergenic
1203078733 16_KI270728v1_random:1135824-1135846 CTTGCTCCCCGGGCTGGGCCAGG + Intergenic
1203123753 16_KI270728v1_random:1559386-1559408 CCTGGCCCTAGCCCTGGTCCTGG + Intergenic
1203124061 16_KI270728v1_random:1560566-1560588 CATGGCCCTAGCCCTGGCCCTGG + Intergenic
1203147245 16_KI270728v1_random:1809883-1809905 CCTGGCCCTAGCCCTGGTCCTGG - Intergenic
1142689830 17:1598826-1598848 CTTGCCCTCAGGCCTGGACAGGG + Intronic
1142741739 17:1935507-1935529 CTTGCCCCAGGCCCTTGGCAAGG + Exonic
1142807840 17:2380718-2380740 CTAGGCCCCAGCCCCGGGCAGGG - Exonic
1142808854 17:2386031-2386053 CCAGTCCCCAGCCCTGGGCTTGG - Exonic
1143174796 17:4949692-4949714 CTTGCCCCTAGCCCAGGCTCCGG - Intronic
1143176653 17:4959486-4959508 CCTGCCCCCTGCCCTGCCCCAGG + Exonic
1143204810 17:5134157-5134179 CTGGTTCCAAGCCCTGGGCCAGG + Intronic
1143371953 17:6445802-6445824 CTTTCCCTCAGCTCTAGGCCTGG - Intronic
1143579510 17:7817448-7817470 CCTGCCCCCAGCCCTGGTCTCGG - Intronic
1144495067 17:15740829-15740851 CATGCTCCCTCCCCTGGGCCAGG - Intronic
1144875857 17:18396835-18396857 CTGGTTCCAAGCCCTGGGCCAGG + Intergenic
1145012700 17:19378717-19378739 CGGGCCCCCGGCTCTGGGCCCGG + Intronic
1145156372 17:20547585-20547607 CTGGTTCCAAGCCCTGGGCCAGG - Intergenic
1145203924 17:20970496-20970518 ATTGCCCAGAGCCCTGGGGCCGG + Intergenic
1145767258 17:27467305-27467327 GTAGCCCCAAACCCTGGGCCAGG + Intronic
1145998033 17:29115590-29115612 CTTGCTGCCATCCCTGGGGCGGG - Intronic
1146012774 17:29208864-29208886 CTTGCCCCCCACCCTGCGACAGG - Intergenic
1146058019 17:29590624-29590646 CTGGCCCCCAGGTCTGGCCCTGG - Intronic
1146075612 17:29725741-29725763 CTTGCCCCCAGCCCTCCGACAGG - Intronic
1146183143 17:30709708-30709730 CTTCCCCCCAGCCCCGGCTCCGG + Intergenic
1146318316 17:31826444-31826466 GTTGGCTCCAGCCCTGGGTCCGG - Intergenic
1146619956 17:34389476-34389498 CTTACCCCCACCCCTCAGCCAGG - Intergenic
1146722056 17:35130565-35130587 CTTGGCCCCAGCCCAGGGGTGGG - Exonic
1147042455 17:37729225-37729247 CTTGTCCCAAGCCCAGGGACTGG - Intronic
1147135394 17:38431282-38431304 CTAGCCCATAGCACTGGGCCAGG + Intronic
1147164582 17:38586535-38586557 CTTACCCCCACCCCTGGGGAAGG - Intronic
1147249283 17:39143594-39143616 CTCAGCCCCAGGCCTGGGCCTGG - Intronic
1147256560 17:39185356-39185378 CCTGCTCCCAGCCCTGATCCAGG - Intronic
1147400976 17:40179767-40179789 CTTGCTCTCAGCCCTCGGCAGGG + Intronic
1147401185 17:40180907-40180929 CTTGCAGCCAGCCCTGGGGTGGG - Intronic
1148046514 17:44748269-44748291 TGTGCCCTCAGCCCTGGCCCAGG + Intronic
1148341978 17:46878663-46878685 CTTACGCCCAGCACTGAGCCTGG - Intronic
1148460996 17:47838905-47838927 CATCCCACCAGCCCTTGGCCTGG + Exonic
1148558108 17:48590649-48590671 CTGGGCCCTAGCCCTGGGCCAGG + Intronic
1148615765 17:48998440-48998462 CTTGCCTCCCGCCCAGGGCCTGG + Intronic
1148731593 17:49840006-49840028 CAAGGCCCCAGCCCTGGCCCCGG - Intronic
1148945604 17:51259904-51259926 CCTGCCCCCAGCCCGGGGAGGGG - Exonic
1149452594 17:56761393-56761415 CATGTACCAAGCCCTGGGCCAGG - Intergenic
1149845976 17:60009516-60009538 CTTGGCTCTGGCCCTGGGCCCGG + Intergenic
1150008728 17:61486173-61486195 GTTGCCCCCAGCCCTCTGCCTGG - Intergenic
1150084325 17:62266096-62266118 CTTGGCTCTGGCCCTGGGCCCGG + Intergenic
1150392301 17:64797070-64797092 CCTGTCCACAGCCCTGGGCAGGG - Intergenic
1150725524 17:67648612-67648634 TTTGTCCCCAGCTTTGGGCCTGG - Intronic
1151347581 17:73511587-73511609 GGAGCCCCCAGCCCAGGGCCTGG - Intronic
1151384420 17:73746474-73746496 GGTGCCCCCTGCCCTGGGCATGG - Intergenic
1151517447 17:74605602-74605624 CTGGCCTCCAGCCCAGGGCATGG - Intergenic
1151554091 17:74837869-74837891 CTTGCCCCCAGCCCTGGGCCTGG + Exonic
1152020960 17:77780021-77780043 CTCTCCCCCAGCCCCGGGACAGG + Intergenic
1152073434 17:78145252-78145274 CCTGGCCCCAGCCCTGGCCTCGG + Intergenic
1152096890 17:78277852-78277874 CCTGCCCCGTGCCCTGAGCCCGG + Intergenic
1152229390 17:79106901-79106923 CTCTCCCCCATCCCTGGGCTGGG + Intronic
1152419674 17:80185663-80185685 CTTTCCCCCAGCCCAGGGTCGGG + Intronic
1152592179 17:81219051-81219073 CTTGCCCCAAAGACTGGGCCTGG + Intronic
1152623785 17:81379284-81379306 TCTGCCCCCTGCCCCGGGCCTGG - Intergenic
1152633997 17:81423075-81423097 TTCACCCCCTGCCCTGGGCCTGG + Intronic
1152640066 17:81445582-81445604 CCTGCCAGCAGCCCCGGGCCTGG + Exonic
1152741405 17:82020029-82020051 CTTGTCCCCTGCCCTGGGAGAGG - Intronic
1153314601 18:3709727-3709749 ATTTCCCCCAGCCCTGCACCCGG + Intronic
1154940717 18:21111081-21111103 GTTGCCCCCGGCCCGGGGTCTGG - Exonic
1155932147 18:31719300-31719322 CTTGCCCCCTGCTCTGGGAATGG - Intergenic
1156539639 18:37897084-37897106 CTAGCCCAAAGCCCTGGTCCTGG + Intergenic
1156798241 18:41075192-41075214 CTTCCTCCCAGCCCCGGGCTTGG - Intergenic
1156830638 18:41486810-41486832 CTTGCATGCTGCCCTGGGCCTGG - Intergenic
1157282608 18:46356018-46356040 GTGGCCCTCAGCCCTCGGCCAGG + Intronic
1157464192 18:47930517-47930539 CCCGCCCCCAGGCCCGGGCCCGG + Exonic
1157544680 18:48539449-48539471 CTTCCCCCCATCCCTGCTCCTGG + Intronic
1157601258 18:48894449-48894471 CTTGGCCCCTGCCCTGGGGCTGG + Intergenic
1158391532 18:57049065-57049087 CCGGCCCCCAGCCCTGCGGCTGG - Intergenic
1158442966 18:57493595-57493617 CTTCCCACCAGCCCTGGACATGG - Intergenic
1158617869 18:59004616-59004638 GTTGCCAGCAGCCCTAGGCCAGG - Intergenic
1159342644 18:67155891-67155913 TGTGCCCCCAGCCCTGGGCCCGG - Intergenic
1160344752 18:78123785-78123807 TTCGGCCCCAGCCCTGGGCGGGG - Intergenic
1160479665 18:79227233-79227255 CTTTGCTCCAGCCCTGGGCTTGG + Intronic
1160657453 19:280868-280890 CTTGACCCCAGCACTGTGCTGGG + Intergenic
1160715715 19:575683-575705 CTGGCCCTGAGCCCTGGGCAAGG + Intronic
1160834355 19:1117567-1117589 CCTGCCGCCAGCCCTGGGCAAGG + Intronic
1160835690 19:1123499-1123521 GCTGCACCCAGCCCTGGGACAGG - Intronic
1160939429 19:1613449-1613471 CCTGCCCCCAGCCCTGCCCTGGG - Intronic
1160981873 19:1819942-1819964 CTGGCCCCCAGCGCTGTGCCCGG - Exonic
1160982003 19:1820471-1820493 CTTGCCTCCAGCCATGGGCACGG - Intronic
1161004848 19:1930024-1930046 AGTGCCCCCAGGCCTGGGTCCGG - Intergenic
1161081018 19:2310192-2310214 CCTCCCTCCAGCCCTTGGCCTGG - Intronic
1161563318 19:4985746-4985768 ACTGCCCCCAGCGTTGGGCCAGG + Intronic
1161668150 19:5589499-5589521 CTTGTCTCCAGCCCTGGCCCAGG - Intronic
1161950137 19:7463331-7463353 CTTGTCCCCACCTCTGTGCCTGG + Intronic
1161962535 19:7530510-7530532 CATGCACCCAGCCCTGAGCTCGG + Intronic
1161976993 19:7612542-7612564 CTTCTCGCCAGACCTGGGCCCGG + Exonic
1162050376 19:8029016-8029038 TTTCCCCCCACCCCTAGGCCTGG - Intronic
1162523020 19:11193126-11193148 CTGACCCCCAGCCCCAGGCCTGG - Exonic
1162923863 19:13919819-13919841 CTTCCCCCCAATCCAGGGCCTGG + Exonic
1162975651 19:14206066-14206088 CTTCCCCCCAGCCCCGGCTCCGG - Exonic
1163284578 19:16338450-16338472 CTTGCCCCTGGCCATGGCCCTGG + Intergenic
1163347036 19:16749842-16749864 CTTGCCCCCTGCCCAGGTTCTGG + Exonic
1163577014 19:18116948-18116970 CTGGGCCCCAGCATTGGGCCTGG + Intronic
1163796833 19:19342699-19342721 CCCGCCCCCAGCCCTGGCCCGGG - Intronic
1165075734 19:33278987-33279009 CCTGCCTCCTGCCCTGGGCTGGG - Intergenic
1165079347 19:33298687-33298709 CGTGCCCCGAGGCCTGGGGCAGG - Intergenic
1165092528 19:33394539-33394561 CTTGGCCCCAGCCTCTGGCCCGG + Intronic
1165158063 19:33799869-33799891 CTTGCCCTCATCCATGTGCCTGG + Intronic
1165162209 19:33823481-33823503 CCTGCCCCCTGCCCTGGGCCTGG + Intergenic
1165164716 19:33843921-33843943 TTACCCCCCAGCCCTGGCCCTGG - Intergenic
1165357681 19:35313742-35313764 CCTGCCCCCACACCTGGCCCTGG + Exonic
1165939137 19:39406684-39406706 CTTCCGCCCGGCCCTGGGCCAGG - Intergenic
1166255199 19:41599371-41599393 CCCGCCCCCACCCCTGGCCCTGG + Intronic
1166345296 19:42161830-42161852 CTTCCCCCCAGCCCCCGCCCTGG + Intronic
1166667455 19:44689569-44689591 CTGCAGCCCAGCCCTGGGCCAGG + Intergenic
1166751687 19:45166873-45166895 CTTGGCTCCAGCCCTGGAGCGGG + Intronic
1166852103 19:45765971-45765993 CCTGCCGCCAGCCCCCGGCCTGG - Exonic
1166871508 19:45873660-45873682 CTTTCCCCCAACTCTGGTCCAGG + Exonic
1166944843 19:46390398-46390420 TCTGCCCCTAGCCCAGGGCCTGG - Exonic
1167213347 19:48147892-48147914 CTAGCTCCCAGCACTGGGGCTGG - Intronic
1167232961 19:48297007-48297029 CCTGCCTCCAGCACTGGCCCGGG - Exonic
1167695478 19:51013256-51013278 CCAGCACCCAGCACTGGGCCTGG + Exonic
1167736160 19:51295789-51295811 TTTGTCCCCAGCCCGCGGCCTGG - Intergenic
1167877847 19:52429097-52429119 CCTGCCCTCGGCCCCGGGCCCGG + Intergenic
1168315534 19:55483284-55483306 CTGGCCCCAAGCTCGGGGCCTGG - Exonic
1168503174 19:56910538-56910560 CGACCACCCAGCCCTGGGCCAGG - Intergenic
925190088 2:1875618-1875640 CTGTCCCCAAGCACTGGGCCAGG + Intronic
925345539 2:3169581-3169603 CCTGCCGCCAGCCCTGGCCGAGG - Intergenic
925401252 2:3575047-3575069 CCTCGTCCCAGCCCTGGGCCTGG - Intergenic
926109610 2:10173558-10173580 CTTCCCACCACCCCTGGGCAGGG + Intronic
926126682 2:10276649-10276671 CCTCCACCCACCCCTGGGCCAGG + Intergenic
926151264 2:10426919-10426941 CATGCCCCAGGCCCGGGGCCCGG - Exonic
926892262 2:17648931-17648953 CCTGCCACCAGCCCTCGTCCTGG - Intronic
927131790 2:20066361-20066383 CCAGCACCCAGCCCTGGACCTGG + Intergenic
927157553 2:20230010-20230032 CCGGCACTCAGCCCTGGGCCTGG - Intergenic
927198640 2:20565190-20565212 CTAGCCCCCAGCTCAGTGCCCGG + Intronic
927496439 2:23554698-23554720 GCAGCCCTCAGCCCTGGGCCCGG - Intronic
927520002 2:23692955-23692977 CCTGACCCCAGCCCAGGCCCAGG + Intronic
927679417 2:25130131-25130153 CTTGGCCCCAGCCTTCAGCCTGG + Intronic
927694171 2:25229262-25229284 CCTGACCCCAGCACAGGGCCTGG + Exonic
927974406 2:27327121-27327143 TTTCCCCCCAGTTCTGGGCCTGG - Intronic
928125582 2:28613304-28613326 AGTGCTCACAGCCCTGGGCCCGG + Intronic
928305565 2:30167641-30167663 CTGGCCCACAGCTCTGTGCCTGG - Intergenic
929441934 2:41971558-41971580 CTTGCTCCCTGCCCTGGGCATGG - Intergenic
929460448 2:42099205-42099227 CTTGCCCCCAGCCTTGGGCCAGG + Intergenic
929760455 2:44802095-44802117 CTATCCCCCAGGACTGGGCCCGG - Intergenic
929765904 2:44843882-44843904 CTTGTGCCCAGCCCCGTGCCAGG - Intergenic
930415550 2:51086342-51086364 CTGGCGCCACGCCCTGGGCCTGG + Intergenic
931495726 2:62804956-62804978 CTTCACCCCAGCCCTGGTCCTGG + Intronic
934112835 2:88758265-88758287 AGTTCCCCCAGCCCTGGGACTGG - Intergenic
934762474 2:96864242-96864264 CCTGTACCCAGCCCTCGGCCTGG - Exonic
934765461 2:96877855-96877877 CTAGCCCCCAGACCTGGGAGGGG - Intronic
934951146 2:98576549-98576571 GATGCCCACAGTCCTGGGCCAGG - Intronic
934983464 2:98867048-98867070 CTTCCCCTCAGCCGTGGGCAGGG + Intronic
935721819 2:105986234-105986256 CTGGCACCATGCCCTGGGCCTGG - Intergenic
936091083 2:109501799-109501821 CCTGGCCCCCACCCTGGGCCAGG - Intronic
936428271 2:112437049-112437071 CCTGGCCCCTGCCTTGGGCCAGG - Intergenic
937100610 2:119265187-119265209 CTGGCTGCCTGCCCTGGGCCAGG + Exonic
937104793 2:119300297-119300319 CTCGGCCCCTGCCCTAGGCCAGG + Intergenic
937349952 2:121154522-121154544 CGTGTCCCCAGCCCAGGGCCAGG + Intergenic
937973729 2:127568404-127568426 CTTGCCCACAGCCCTGGGGGAGG - Intronic
938067753 2:128291307-128291329 CTTGCCCACTGCCCTTGCCCTGG + Intronic
938069379 2:128300419-128300441 CCTGCCCCCAGCCCTGCACCTGG + Intronic
938074645 2:128325240-128325262 CTAGCCCCCAGCCCCCAGCCCGG + Intergenic
938118509 2:128618105-128618127 CTTGCCCCCAACCCTGAGAGAGG - Intergenic
938772531 2:134512625-134512647 CTTGCCCCCAGAACAGTGCCTGG - Intronic
939820266 2:146948583-146948605 CTGACCCCCAGCCCCAGGCCAGG + Intergenic
941693724 2:168528382-168528404 CTTCCTCCCAGCCCTAGGGCTGG + Intronic
941933528 2:170965540-170965562 GTTTCCCCCAGTGCTGGGCCAGG + Intronic
942278243 2:174337652-174337674 CTCGCGCCCAGCCCGGGCCCTGG - Exonic
942419615 2:175794740-175794762 CTTCCCCCCAGGCCTGTGGCAGG + Intergenic
942519969 2:176793243-176793265 CTTGTGCCCAGCCCTGGGAGAGG - Intergenic
944956122 2:204811436-204811458 CTTGCCCCAAACTCTGTGCCAGG - Intronic
946135620 2:217644565-217644587 CAGGCTCCCAGCCCTGGCCCTGG + Intronic
946422335 2:219571756-219571778 CCTGCCCCCGGCCCTAGCCCCGG + Intronic
947733353 2:232442774-232442796 CCTGTCCCTGGCCCTGGGCCGGG - Intergenic
947740531 2:232482821-232482843 CTGACCCCCAGCTCTGGGCCAGG + Intronic
947767459 2:232646857-232646879 CTTGGGCCAAGCCCTGGGCTGGG - Intronic
947791596 2:232872125-232872147 TTTGACCCCACCCCTGGGCTGGG + Intronic
947813033 2:233016090-233016112 CATTCCCTCAGCCCTGGGCCTGG - Intergenic
947836471 2:233179551-233179573 TTTGCCCCCACCTCCGGGCCCGG + Intronic
947877538 2:233477667-233477689 CCTGCCACCAGCCCTGTGCCAGG + Intronic
947936531 2:234009480-234009502 CTTGGCCCCAGCCTGGGCCCTGG + Intronic
948115601 2:235493095-235493117 CCTGCCCCCAGCCATCGGCGTGG - Intergenic
948343759 2:237278232-237278254 CCGGCGCCGAGCCCTGGGCCTGG + Intergenic
948465145 2:238148630-238148652 CCAGCCCCCAACCCCGGGCCTGG - Intronic
948757654 2:240168761-240168783 CTTGCCCTCAGCCCAGGGGTTGG + Intergenic
948767130 2:240228269-240228291 AGTGCCTCCAGCCCAGGGCCAGG + Intergenic
948785957 2:240353111-240353133 CTGGCCTCCAGCTCTGGGTCTGG + Intergenic
948883097 2:240870296-240870318 CTTTGTGCCAGCCCTGGGCCAGG + Intronic
949030793 2:241796358-241796380 GTTGACTCCAGACCTGGGCCAGG + Intronic
1168821434 20:776024-776046 CTTTCCCCGAGCTCTGGGCGGGG - Intergenic
1168892747 20:1305568-1305590 CTGTCCCACAGACCTGGGCCTGG - Exonic
1169191755 20:3662484-3662506 CCTGCTCCCAGCCCTGGGGGGGG - Intronic
1169268178 20:4180370-4180392 CTGTCCCCCAGCCCTGGGCTAGG - Intronic
1170648706 20:18219712-18219734 CTTGACCCCAGCCCTGGACAGGG + Intergenic
1171291406 20:23984901-23984923 CTGGCCCCCAGCCATGTGCCTGG + Intergenic
1171402318 20:24882790-24882812 CCAGCCCCCAGCCCTGTGGCAGG + Intergenic
1171880464 20:30614664-30614686 CTGGCTCCAAGCCCTGGTCCAGG - Intergenic
1172009456 20:31837945-31837967 GTTGAGCCCAGCTCTGGGCCTGG + Intergenic
1172063056 20:32200144-32200166 CTTGCACCGAGCACTGTGCCTGG + Intronic
1172120962 20:32598513-32598535 CTGACACCCAGCACTGGGCCTGG + Intronic
1172272053 20:33660254-33660276 CATACCGCCAGCCATGGGCCTGG + Exonic
1172596582 20:36154666-36154688 GGTGCCCACAGCCCCGGGCCTGG - Intronic
1172621015 20:36318661-36318683 ACTGCACCCAGCCCTGGCCCAGG + Intronic
1172623400 20:36334081-36334103 CTGGTGCCCAGCCCTGTGCCTGG - Intronic
1173317857 20:41961247-41961269 TTTGCACCCAGCTCTGTGCCAGG + Intergenic
1173596346 20:44260962-44260984 ACTGCCTCCAGCCCTTGGCCAGG - Intronic
1173622513 20:44447709-44447731 CTAGCACCCAGCACTGTGCCTGG - Intergenic
1173737942 20:45374967-45374989 CTGGGGCCCAGCTCTGGGCCTGG + Intronic
1174139959 20:48405855-48405877 CCTGTCCCCAGCCCTGTGCATGG - Intergenic
1174164098 20:48572398-48572420 CTTCCCACCCGCTCTGGGCCGGG - Intergenic
1174168041 20:48598819-48598841 CCTGGCCCCGGCCCTGGCCCTGG + Intergenic
1174282181 20:49447251-49447273 CCTGTACCCAGCCCTGGGACTGG - Intronic
1174340608 20:49892803-49892825 CTTGCCCCCTGGCTGGGGCCAGG - Intergenic
1174354105 20:49987099-49987121 CTGAGCCCCAGCCCAGGGCCTGG - Intronic
1175074363 20:56360422-56360444 CTTGTCCCCAGCTCAGGCCCTGG + Intronic
1175144451 20:56885117-56885139 TCTGCCCACAGGCCTGGGCCCGG - Intergenic
1175219577 20:57409144-57409166 GCTGCCCCCCGCCCTCGGCCAGG - Exonic
1175280642 20:57801823-57801845 TGTGCGCCCAGCCCAGGGCCAGG - Intergenic
1175743523 20:61437000-61437022 CTAGCACCCAGCGCAGGGCCTGG + Intronic
1175876893 20:62234540-62234562 CTTGCTGCCTGCCCGGGGCCAGG - Intronic
1175957888 20:62620964-62620986 CTTCCCCCCACCCCCAGGCCTGG - Intergenic
1176040101 20:63060755-63060777 CGGGCACCCTGCCCTGGGCCAGG - Intergenic
1176069315 20:63217801-63217823 CCAGCTCCCATCCCTGGGCCAGG + Intergenic
1176088557 20:63308998-63309020 CTGGCCACCATCCCTGTGCCTGG + Intronic
1176125004 20:63471419-63471441 GGGACCCCCAGCCCTGGGCCTGG - Intronic
1176181841 20:63753125-63753147 CTTGCCTCCTGCCTTTGGCCTGG - Intronic
1176240373 20:64073106-64073128 CTTCTCCCCAGCCCTGAGTCTGG + Intergenic
1177518268 21:22183087-22183109 CTTGCCCCCACCCCCCGGACAGG - Intergenic
1178921730 21:36743306-36743328 CCTGGCCCCAGCCCTTGGGCAGG - Intronic
1179265172 21:39796633-39796655 CTGGGCCCCAGCTCTGGGCCTGG - Intronic
1179370946 21:40805587-40805609 CTTGCCACCATCCTTAGGCCTGG - Intronic
1179522406 21:41953837-41953859 CTTGCGCCCAGCCCGGGCCGCGG - Exonic
1179641120 21:42747710-42747732 CTGGCCCCCAGCACTGTGCCAGG + Intronic
1179783856 21:43719020-43719042 CTTCCTCCCAGCCCGGGGGCGGG + Intergenic
1179906910 21:44427304-44427326 CTTGCCCCCTGGCCTCGGGCAGG + Intronic
1179991365 21:44949763-44949785 CCTGCACCCAGCCCTTGGGCAGG + Intronic
1180160400 21:45996611-45996633 CCTGGCCCCAGCCATGAGCCTGG - Intronic
1180765992 22:18346192-18346214 CTGGCCCCCAGCCATGTGCCTGG - Intergenic
1180848174 22:18995608-18995630 AGTGCTCACAGCCCTGGGCCTGG - Intergenic
1180984033 22:19893584-19893606 CCTGTGCCCAGGCCTGGGCCGGG - Intronic
1181050054 22:20234191-20234213 CCTGGCCCCACCTCTGGGCCTGG - Intergenic
1181397378 22:22631905-22631927 CCTGACCCCTGCCCTGGGCCTGG - Intergenic
1181400550 22:22648034-22648056 CTGGCCCCCAGCCATGTGCCTGG - Intergenic
1181500128 22:23311280-23311302 CCTGACCCCTGCCCTGGGCCTGG - Intronic
1181648843 22:24247853-24247875 CTGGCCCCCAGCCACGTGCCTGG + Intergenic
1181702532 22:24629132-24629154 CTGGCCCCCAGCCATGTGCCTGG - Intergenic
1181747568 22:24966435-24966457 CTTGCCCAGTGCCCTGGGCAGGG + Intronic
1182049985 22:27305280-27305302 CTTCCCCCCAGCCCTGACTCCGG + Intergenic
1182098966 22:27644802-27644824 CATGCCCCCAGCCCCCTGCCTGG + Intergenic
1182123147 22:27799698-27799720 CATGCCCGCAGCTCTGGGCATGG + Exonic
1182280923 22:29217280-29217302 AGAGCCCCCAGCCCTTGGCCTGG - Intronic
1182309057 22:29391848-29391870 CCAGCACCCAGCCCAGGGCCTGG - Intronic
1182459176 22:30472043-30472065 TTTGCCCCCACTCCTGGGCGTGG + Exonic
1182472713 22:30558456-30558478 CCCTCCCCCAGGCCTGGGCCAGG + Intronic
1183212118 22:36457652-36457674 CCTGCACCAGGCCCTGGGCCTGG + Intergenic
1183232716 22:36592993-36593015 CTTGCCCCCATCCTTGGGGCGGG + Intronic
1183366162 22:37408178-37408200 CATGTCCCCAGTCCTGGGCCCGG + Intronic
1183484417 22:38081668-38081690 CTCGCCCGCAGGCCTGGGCCTGG - Exonic
1183728855 22:39605774-39605796 CTTTCCCCCAGCTCTCTGCCTGG - Intronic
1183951335 22:41354732-41354754 CTGGCCCCCAACCCTGTCCCGGG + Intronic
1184038183 22:41928410-41928432 GTTCCCTCCAGCCCTGGCCCTGG - Intergenic
1184095586 22:42314598-42314620 CTAGCCCTCAGCCCTTGGCTTGG - Intronic
1184177004 22:42794221-42794243 CTGGCCGCCATCCCTGGGCCAGG + Intergenic
1184246573 22:43238743-43238765 GTTCAGCCCAGCCCTGGGCCCGG + Intronic
1184276347 22:43411605-43411627 CCCGCCCCCAGCCCCGGACCGGG - Intronic
1184345196 22:43908852-43908874 CTTGGCCACAGCTCTGGGCAGGG + Intergenic
1184406839 22:44305260-44305282 CTAGAGCCCAGCCCAGGGCCTGG - Intronic
1184517688 22:44972859-44972881 CTTGGCACCAGGCCTGTGCCAGG - Intronic
1184661384 22:45967141-45967163 GAGGCCCCCAGCCCTGCGCCAGG + Intronic
1184921987 22:47612498-47612520 GTAGCCCCCAGCCCTGGAGCTGG - Intergenic
1185006149 22:48278039-48278061 CGGGCCCCCTGCCCGGGGCCGGG + Intergenic
1185013689 22:48331399-48331421 CTGGCAGACAGCCCTGGGCCTGG - Intergenic
1185019429 22:48365560-48365582 CCAGCCTCCAGCCCTGGGCAAGG + Intergenic
1185096444 22:48808555-48808577 CTTTCCCACCCCCCTGGGCCTGG - Intronic
1185130088 22:49033974-49033996 GATGCCCCCAGCCCTGCTCCAGG + Intergenic
1185213578 22:49585962-49585984 GGTGACCCCATCCCTGGGCCGGG + Intronic
1185259610 22:49854089-49854111 CCTGGCCCCGGCCCTGGCCCCGG - Intronic
1185275524 22:49948880-49948902 CTGTCCCCCAGCCCTGGCCAGGG + Intergenic
1185342429 22:50297585-50297607 CTTGCCCTCAACACTGAGCCAGG + Intronic
1185365013 22:50433400-50433422 CATGCCCCCAGCCCTCCTCCAGG - Intronic
1185365287 22:50434206-50434228 CATGCCCCCAGCCCTCCTCCAGG - Intronic
949328101 3:2889901-2889923 CTGGCTCCCAGCCCTGTGCAGGG + Intronic
949355777 3:3179406-3179428 GTTGCCCCGAGCCGTGAGCCAGG - Intronic
949535850 3:4995671-4995693 CCTGCCCCCAGCTCTATGCCAGG + Intergenic
949988020 3:9554424-9554446 CCTGCCCCCAGCTCAGCGCCTGG + Intergenic
950109057 3:10407012-10407034 CCTGCCCCCAGACCTGACCCTGG + Intronic
950177165 3:10882929-10882951 CTGGCACCCAGCCTAGGGCCTGG + Intronic
950451513 3:13068138-13068160 ATTGGCCCCAGCCCCGGGGCAGG - Intronic
950638851 3:14335019-14335041 ACTGCACCCAGCCCTGGGCTTGG - Intergenic
950651400 3:14409587-14409609 CTTGGCCCTGGCCCTGTGCCTGG - Intronic
950968877 3:17166802-17166824 CTTGGCCTCGGCCCTGGCCCTGG + Exonic
952436480 3:33277314-33277336 CTCGCCCCCGGCCCTGGAACTGG - Intronic
953735263 3:45488728-45488750 CTTAGCCCAAACCCTGGGCCTGG + Exonic
953769751 3:45771135-45771157 CTTTGCCCCAGCCCTTGCCCAGG + Intronic
954430979 3:50470728-50470750 GCTGCCCCCAGGTCTGGGCCTGG + Intronic
954612854 3:51955452-51955474 CTTGCACCCCTCCATGGGCCTGG + Exonic
954642988 3:52113268-52113290 CTGGGACCCTGCCCTGGGCCTGG + Intronic
954838721 3:53493923-53493945 CTTCTCCCCTGCCCTGCGCCTGG - Intergenic
955326887 3:58015507-58015529 CTAGCACCCAGCACAGGGCCTGG - Intronic
955522538 3:59788670-59788692 CCTGCACCCAGCCCAGGGCCTGG + Intronic
955911391 3:63863331-63863353 CAGGCCCCCAGCCCTAAGCCCGG + Intronic
955972097 3:64445743-64445765 CTTGTCCCCAGCCTAGGGGCAGG + Intergenic
956642631 3:71429179-71429201 GTTGCCCCCACCCATGGGCGAGG - Intronic
956653935 3:71531161-71531183 ATTGCACTGAGCCCTGGGCCCGG - Intronic
958803324 3:98781321-98781343 CTAGCCCCCAACCCTGCGACAGG - Intronic
960881836 3:122353370-122353392 CCTGCCCACAGCCCTGGGCACGG - Intergenic
960989596 3:123301899-123301921 CTTGCCACCAGCCCAGGGGTGGG + Intronic
961463323 3:127066858-127066880 CCTGCTCCCAGCCCTGTCCCTGG - Intergenic
961646674 3:128396474-128396496 CCTACCCCAAGCCCTGTGCCAGG + Intronic
961653577 3:128429419-128429441 CCTGCCCCCATCCCGGGCCCTGG + Intergenic
961809300 3:129512807-129512829 TGTGCCCCAAGCCCTGGGCCAGG + Intronic
962116622 3:132516346-132516368 CTTGGCACCAGCTCTGTGCCAGG - Intronic
962257722 3:133883881-133883903 GTTTCCCCCAACCCTGGGGCAGG - Intronic
962405330 3:135095289-135095311 CTTGCACCCAACCCCGTGCCTGG + Intronic
964801916 3:160566078-160566100 CTGGCCCCCAGACCCGGCCCTGG - Intergenic
966244212 3:177788310-177788332 CTTGGCACCAGGTCTGGGCCAGG - Intergenic
966868934 3:184277508-184277530 CTTGTGCCCAGCACAGGGCCTGG + Intronic
967113909 3:186319408-186319430 CTTGTCCCCAGCGCTGGTCTAGG - Intronic
967308768 3:188086173-188086195 CTTGCTCCAAGACCTTGGCCAGG - Intergenic
968135381 3:196216601-196216623 CTTGCCCCCCACCCCGGCCCAGG + Exonic
968450800 4:675086-675108 GTGGTCCCCAGGCCTGGGCCGGG - Intronic
968501146 4:950658-950680 CTTACCCCAAACCCAGGGCCTGG + Intronic
968604799 4:1529799-1529821 CTCTGCCCCAGCCCTGGGCTCGG - Intergenic
968607599 4:1542847-1542869 CTGGCCCCCAGGCCTGTGCCCGG - Intergenic
968622683 4:1610848-1610870 CCTGCCCCCAACCCGGGCCCCGG + Intergenic
968810149 4:2796078-2796100 CTGGCCCTCAGCCACGGGCCAGG + Intronic
968909376 4:3469710-3469732 CTTGGTCTCAGCCCTGGGCCTGG + Intronic
969116691 4:4874630-4874652 CTTTCACCCAGCCCTGATCCAGG + Intergenic
969232570 4:5841828-5841850 CTGGGCCCATGCCCTGGGCCTGG - Intronic
969351967 4:6603330-6603352 CCTGGGCCCAGCCCTGGGCTGGG + Intronic
969365803 4:6693704-6693726 CTTTCCCCCAGCCAAGGCCCAGG - Exonic
969377321 4:6771516-6771538 CGGGCACCCAGCCCAGGGCCTGG - Intergenic
969463646 4:7342313-7342335 GTTGCCCCGGGCCCTGTGCCTGG + Intronic
969464030 4:7344198-7344220 CATGCCCCCAGTGCAGGGCCTGG + Intronic
969586885 4:8099067-8099089 GTGGGCCTCAGCCCTGGGCCAGG + Intronic
969587902 4:8105019-8105041 CGTGTCTGCAGCCCTGGGCCAGG - Intronic
969617458 4:8262044-8262066 CCTGCCCGCAGGCCTGGCCCTGG - Intergenic
969660089 4:8522327-8522349 CTTTGCCCCAGCTCTGGGCGTGG + Intergenic
969681396 4:8645292-8645314 CTGGCTGCCAGCCCTGGGGCAGG + Intergenic
970608977 4:17708310-17708332 CTTGCCCATAGCCCTGGGCCTGG + Intronic
971327172 4:25654225-25654247 TCTGCCTCCAGCCCTGGGCAAGG - Intergenic
972316798 4:37934361-37934383 CTTGACCCTAACCCTGTGCCTGG - Intronic
972390329 4:38607427-38607449 CTTCCACACAGCCCTGGACCTGG + Intergenic
974877763 4:67718302-67718324 CCTGCTCCCAGCCCCTGGCCAGG - Intergenic
975212409 4:71716611-71716633 CTTGCCCCCAACCCTCCGACAGG + Intergenic
975485798 4:74933286-74933308 CTTGCCGCCCGCCCCGGGCTGGG + Exonic
976267082 4:83194789-83194811 CTGGCGCCGTGCCCTGGGCCTGG + Intergenic
976522272 4:86042316-86042338 CTTGCCCCCAACCCTCTGACAGG - Intronic
977789251 4:101079198-101079220 CTGGACACCAGGCCTGGGCCAGG + Intronic
978643617 4:110901550-110901572 CTGGCACCAAGCACTGGGCCTGG + Intergenic
979180967 4:117726610-117726632 CTTGCCCCCCACCCTGCGACAGG - Intergenic
981108028 4:140903602-140903624 CTGCCCCCCAGCCCTTTGCCCGG + Intronic
981225495 4:142289534-142289556 CCAGCCCCCAGCCCTTGGACAGG + Intronic
981529333 4:145736491-145736513 GTTGCGCCCAGCCATGGACCAGG - Intronic
981963561 4:150573136-150573158 ATTGCCCTCAGCACTGAGCCAGG + Intronic
982421805 4:155208074-155208096 CTGCGCCCCAGCCCTGGGCGAGG + Intergenic
983560977 4:169100991-169101013 ATTGCCTCCAGCCATGGGGCTGG - Intronic
984713217 4:182903330-182903352 CCTGCCCCCAGCCCAGCCCCAGG + Intronic
985129658 4:186726762-186726784 CTCGCCCCCCGCCCCGGGCGCGG + Intergenic
985251362 4:188027700-188027722 CATGCCCAGAGCCCTGAGCCAGG + Intergenic
985577126 5:678666-678688 CTTCCCAGGAGCCCTGGGCCTGG + Intronic
985592045 5:770719-770741 CTTCCCAGGAGCCCTGGGCCTGG + Intergenic
985649916 5:1102656-1102678 CTTGTCCCCTGCCCCAGGCCCGG - Intronic
985866779 5:2520084-2520106 TCTGCCCCCAACTCTGGGCCTGG - Intergenic
986132899 5:4947102-4947124 CTTTCTCCCAGGCCTTGGCCAGG - Intergenic
987085216 5:14461583-14461605 TCAGCCCCCAGGCCTGGGCCAGG + Intronic
988446486 5:31291601-31291623 CGTGCCCCCCGCACTGTGCCAGG + Intronic
989229866 5:39074039-39074061 CTGGCCCCCAGCCCCGGACCCGG + Intronic
990879187 5:60520741-60520763 CTGGCCCACGGCCCTGGCCCAGG + Intronic
991675718 5:69088144-69088166 CCGGCGCCCCGCCCTGGGCCTGG - Intergenic
992028016 5:72690522-72690544 CTCCCCCACAGCCCTGGACCAGG - Intergenic
992553644 5:77882960-77882982 CATGCCCCAAGAGCTGGGCCAGG + Intergenic
992627763 5:78649587-78649609 TTTGCTCCCAGCCCTGGGGGCGG - Intronic
993635933 5:90343687-90343709 CTGGCGCCACGCCCTGGGCCTGG + Intergenic
995831604 5:116361197-116361219 GGTGCTCCCAGCGCTGGGCCTGG + Intronic
996805830 5:127452878-127452900 CTTCCCCCCAGCTATGGGCTTGG + Intronic
997250550 5:132385694-132385716 CTTGCTCTCAGCCCTGTGCTGGG + Intronic
997423643 5:133788119-133788141 CCAGCGCCCAGCCCAGGGCCTGG + Intergenic
998251756 5:140558225-140558247 TTAGCCCCCAGCCCTGTCCCAGG + Exonic
998372270 5:141669709-141669731 CTTGCCCACAGCACTAGTCCAGG + Exonic
998462409 5:142319579-142319601 CTTCCTCACAGACCTGGGCCAGG - Intronic
998691352 5:144592250-144592272 CTTGAACTCAGCTCTGGGCCAGG - Intergenic
999777648 5:154823724-154823746 CTGCCACCCAGCTCTGGGCCTGG + Intronic
1000373163 5:160556401-160556423 GTTGGCCCCAGGCCAGGGCCAGG + Intergenic
1001303093 5:170552273-170552295 CCAGCTCCCAGCCCTGTGCCTGG - Intronic
1001399263 5:171437131-171437153 CCAGGCCCCAGCCTTGGGCCTGG + Intronic
1001453282 5:171842458-171842480 CTTGGCTCCTGCCCTGGGCTAGG + Intergenic
1001490938 5:172154619-172154641 CTTGGCCACAGCAGTGGGCCTGG + Intronic
1001816830 5:174676320-174676342 CATGTCCCCAGTCCTGGGCTGGG + Intergenic
1002466428 5:179411093-179411115 CTTCCCCCCAGCCCTGCGCCTGG + Intergenic
1006080145 6:31560393-31560415 CTGGCCCCCAGCCCTGGTGGGGG + Intergenic
1006253555 6:32811344-32811366 CTTTGTCCCAGCCCTGAGCCAGG + Intergenic
1006361598 6:33590178-33590200 CTGGTCCCCTGCCCTGGCCCAGG + Intergenic
1006380632 6:33695179-33695201 CTGGCCTCTGGCCCTGGGCCTGG + Intronic
1007092227 6:39191401-39191423 TGAGGCCCCAGCCCTGGGCCCGG + Exonic
1007257453 6:40538779-40538801 CTTCCCCCCAGCCCCAGTCCTGG - Intronic
1007380928 6:41489683-41489705 CTGGCCCCCAGCCCAGCCCCAGG + Intergenic
1007633067 6:43283438-43283460 CCGGCCCCCAGCCCTGCCCCAGG - Exonic
1008598495 6:53065855-53065877 CCGACCCCCAGCCCTAGGCCCGG - Intronic
1008621702 6:53277455-53277477 CTTGCCCCAGGTGCTGGGCCTGG - Intronic
1009160954 6:60281809-60281831 CTTACACCCTGCACTGGGCCAGG + Intergenic
1009333466 6:62455432-62455454 CTTGGCCTCATCCTTGGGCCTGG - Intergenic
1012563347 6:100615162-100615184 CGTGCCACCACACCTGGGCCAGG + Intronic
1013048056 6:106507452-106507474 CTTTCCCACAGGCCTGGGCAGGG - Intergenic
1013793466 6:113859607-113859629 CCCGCCCCCAGCCCTGGACCGGG - Intronic
1014693240 6:124587615-124587637 CTGGCCCCAGGCCCAGGGCCAGG + Intronic
1015101534 6:129487237-129487259 GCTTGCCCCAGCCCTGGGCCAGG + Intronic
1015836704 6:137427898-137427920 CTTGCCCACAGCAATTGGCCAGG - Intergenic
1016021955 6:139245372-139245394 CTCGTACCCAGCCCAGGGCCTGG - Intronic
1016031520 6:139343463-139343485 CTTGCCCCCAGTTCTGGCCAAGG - Intergenic
1016733712 6:147453272-147453294 CTGGCGCCAAACCCTGGGCCTGG - Intergenic
1016995953 6:149962693-149962715 CCTGCCCCCAGCCCTGTACATGG + Intergenic
1017002630 6:150006474-150006496 CTTGTCCCCAGCCCTATGCATGG - Intergenic
1017012229 6:150070477-150070499 CCTGCCCCCAGCCCTGTACATGG - Intergenic
1017992913 6:159506028-159506050 AGTGGGCCCAGCCCTGGGCCTGG + Intergenic
1018383725 6:163284271-163284293 TTTGCTGCCAGCCCGGGGCCAGG + Intronic
1018528748 6:164741343-164741365 CTTTCCCCTAGCCCTGAGCTTGG + Intergenic
1019052615 6:169194765-169194787 CTAGCCCTCAGCCCTAGGGCAGG + Intergenic
1019392685 7:797995-798017 CGTGCTCCCAGCCCTGCCCCGGG - Intergenic
1019459937 7:1152434-1152456 CTGGCGTCCATCCCTGGGCCAGG - Intronic
1019473923 7:1235192-1235214 CTTTCCGCAAACCCTGGGCCAGG - Intronic
1019498491 7:1352535-1352557 CATGCCCCCAGTACAGGGCCAGG + Intergenic
1019554001 7:1619705-1619727 GTCGCCCCCAGGCCTGGACCGGG + Intergenic
1019602878 7:1894045-1894067 CACGCCCCCAGCTCAGGGCCTGG - Intronic
1019671419 7:2281844-2281866 GATGCCCTCACCCCTGGGCCTGG + Intronic
1019855192 7:3598618-3598640 CTTGTCCCCATCCCTGGCCCTGG + Intronic
1020137389 7:5594591-5594613 CGGGACCCGAGCCCTGGGCCCGG - Intronic
1022644242 7:32215926-32215948 CTTTGCCACAGCCCTGGGTCTGG + Intronic
1022697999 7:32728668-32728690 CCGGCCCCCAGCCCTGGTCCCGG - Intergenic
1023872887 7:44272242-44272264 CTGGCCCCCAGACCTTGGGCCGG - Intronic
1023881810 7:44325175-44325197 CGAGCCCCCGGCCCCGGGCCTGG - Intronic
1023990694 7:45126525-45126547 CATTTCCCCAGCACTGGGCCTGG - Intergenic
1024030617 7:45456755-45456777 CTTGCCCCTGGCCCTTGGCTTGG + Intergenic
1024533197 7:50409907-50409929 CTGGCCGCAGGCCCTGGGCCTGG + Intergenic
1024952648 7:54880578-54880600 CTGGCGCCGTGCCCTGGGCCTGG - Intergenic
1024971449 7:55075114-55075136 CGTGGCCCCTGCCCTGGCCCTGG - Intronic
1025994072 7:66517251-66517273 CGTGACCCCAGCTCTGTGCCTGG + Intergenic
1026297560 7:69068255-69068277 CTTCCCCCAAGCCCTGTGCAAGG - Intergenic
1026312295 7:69197010-69197032 CTTGCCACCAGCCATGGGAGGGG - Intergenic
1026802914 7:73411103-73411125 CCAGCCCCCAGCCTTGGGCTAGG - Intergenic
1026819866 7:73539894-73539916 CCAGCCCCCAACGCTGGGCCAGG - Exonic
1026837182 7:73647126-73647148 CCTGCCCCCACCTCTGGGCTGGG - Intergenic
1026903096 7:74047784-74047806 TGTGCTTCCAGCCCTGGGCCAGG + Intronic
1026985682 7:74553951-74553973 CGTGACCCCAGCTCTGTGCCTGG + Intronic
1026994331 7:74606029-74606051 CTTCCTCCCAGCTCTGGGCATGG - Intergenic
1026994387 7:74606230-74606252 CTCAGCCCCTGCCCTGGGCCGGG + Intergenic
1028391304 7:90320895-90320917 TGTGCCCCCAGCCCTGGGTCAGG + Intergenic
1029283430 7:99450904-99450926 CCTGCCCCCACCCTTGGCCCTGG - Intronic
1029646567 7:101860564-101860586 CTAGCCCCAGGCCCTGGGACAGG - Intronic
1032018155 7:128392688-128392710 CTGGCCCCCACCCCAGGGGCAGG - Exonic
1033097308 7:138442520-138442542 CTGGCCCCCACCCCAGGGGCAGG + Intergenic
1034161309 7:148995931-148995953 CCTGCCCCTAGTCATGGGCCCGG - Intergenic
1034273014 7:149812354-149812376 CCAGCCCCCACCCCAGGGCCTGG + Intergenic
1034436061 7:151063230-151063252 CCCGGCCCGAGCCCTGGGCCAGG - Intronic
1034446002 7:151114726-151114748 CGTGCCCCTCGCCATGGGCCTGG + Intronic
1034451256 7:151138419-151138441 CTGGGCCCCACCCCTTGGCCTGG - Intronic
1034535113 7:151721380-151721402 CCTGGCCCCGGCCCTGGCCCTGG - Intronic
1034535120 7:151721392-151721414 CTCGGCCCCGGCCCTGGCCCCGG - Intronic
1034553198 7:151833965-151833987 CCTGGCCCCCGCCATGGGCCGGG - Intronic
1035022268 7:155806718-155806740 CTCTTCCCCAGCCCAGGGCCCGG - Intronic
1035321435 7:158032129-158032151 CCTGCCCCCACGCCTGGCCCTGG + Intronic
1035397876 7:158546906-158546928 CTGTCCCCCAGCCCTGCCCCAGG - Intronic
1035705356 8:1670536-1670558 CCTGCACCCAGCACTGTGCCTGG + Intronic
1035784791 8:2252065-2252087 CCTGCACCAAGCCCAGGGCCGGG - Intergenic
1035808016 8:2469656-2469678 CCTGCACCAAGCCCAGGGCCGGG + Intergenic
1036212260 8:6852134-6852156 CTTGCCCCCAGCCTTCGTCTAGG + Intergenic
1036215654 8:6877747-6877769 ATTGTCCCCAGCCCTGGGGATGG + Intronic
1036692088 8:10950388-10950410 CTCTCCCCCAGCCCTGGCACAGG - Intronic
1036702094 8:11019589-11019611 CTGGGGCCCAGACCTGGGCCTGG - Intronic
1037910059 8:22739035-22739057 CTGGCCCCCTGCCAGGGGCCTGG - Intronic
1038062710 8:23930276-23930298 CCTGACCCCAGCCCAGGGCCAGG + Intergenic
1038410660 8:27356297-27356319 TTTGCCCTCAGCTCTGGCCCAGG - Intronic
1038423774 8:27451571-27451593 CTTGCCCACCGCCCAGGGCAGGG + Intronic
1039467565 8:37795520-37795542 CCTGTCCCCAGCCCTGGTTCCGG + Intronic
1039546394 8:38414104-38414126 CTTGCCCCAAGGCCTGGCTCAGG + Intronic
1040276220 8:46015400-46015422 CTTCCCAGCAGCCCTGTGCCTGG - Intergenic
1041201497 8:55454620-55454642 CTAGCCCCCAGCCAGGGGCACGG + Intronic
1041451715 8:58013053-58013075 CTTCCCCCCAGACCTGGGAGGGG + Intronic
1041492806 8:58453319-58453341 CTGGCGCCACGCCCTGGGCCTGG + Intergenic
1043443376 8:80296720-80296742 CTTTCCCCCAACCCTGTGACAGG - Intergenic
1047275564 8:123402397-123402419 CTGGCCCCCACCCCAGGGGCAGG + Intronic
1047306317 8:123655750-123655772 CTAGCACCCAGCACAGGGCCTGG + Intergenic
1047424376 8:124731836-124731858 CTGTCCCCCAGGCCTAGGCCAGG - Intergenic
1047615192 8:126557677-126557699 CCTGTCCCCAGCCCTTCGCCTGG + Intronic
1047634456 8:126744835-126744857 CCTGACCCCAGCCCTGGCCAAGG + Intergenic
1048991243 8:139761493-139761515 CCTGCTCCCAGCCCTGGTGCTGG + Intronic
1049006773 8:139860668-139860690 CATGGACCCAGCTCTGGGCCAGG - Intronic
1049181627 8:141225953-141225975 CCAGCCCCCAGCCCTAGGTCAGG + Intronic
1049198937 8:141330540-141330562 CCTGCCGGCAGCCCTGGGCAGGG - Intergenic
1049371153 8:142268041-142268063 GTTGCCCTCAGATCTGGGCCTGG - Intronic
1049377996 8:142298177-142298199 CTTTCCTCCCGCCCTGGCCCAGG + Intronic
1049386151 8:142344070-142344092 CATGGCCCCAGCCCTGGTTCCGG - Exonic
1049471011 8:142775030-142775052 CTTGCCCACAGTCCTGACCCTGG + Intronic
1049494060 8:142921519-142921541 CTTGCACCCAGCATAGGGCCTGG - Intergenic
1049525214 8:143121946-143121968 CATGCCCCAGGCCCTGTGCCAGG - Intergenic
1049553214 8:143270198-143270220 GTTGCCCCCATTCCTGGGCCAGG - Intronic
1049593257 8:143472084-143472106 CTTGCTCCCACCCCTGCCCCTGG - Intronic
1049645359 8:143733585-143733607 CTTGCGCCCACACCTGGGCCGGG - Intronic
1049663371 8:143830489-143830511 CCTGCCTCCACCCCTGGGCTGGG + Intergenic
1049711039 8:144063461-144063483 CTTGCACCCACCTCAGGGCCTGG + Intronic
1049790879 8:144472283-144472305 CTTCTCCCCACCCCTGGCCCAGG + Intronic
1050377073 9:4984833-4984855 CTAGGCGCCAGCGCTGGGCCCGG - Intergenic
1050462861 9:5892054-5892076 GTTAGCCACAGCCCTGGGCCAGG + Intronic
1050528321 9:6565005-6565027 CTCAGCCCCGGCCCTGGGCCTGG - Intronic
1052358549 9:27529563-27529585 TTTACCTCCAGCCCAGGGCCCGG + Exonic
1052855933 9:33406636-33406658 CCTACCCCCACCCCTGCGCCTGG - Intergenic
1052916033 9:33925007-33925029 CTTCCCCCAAGTCCTGGGCCAGG - Intronic
1053174095 9:35909913-35909935 CCTGCCCCCAGCACAGGGCCAGG + Intergenic
1056569302 9:87802061-87802083 GATGCCACTAGCCCTGGGCCAGG - Intergenic
1056687605 9:88779293-88779315 GCTCCCTCCAGCCCTGGGCCTGG + Intergenic
1056814508 9:89791795-89791817 CCTGCTCCCTTCCCTGGGCCTGG - Intergenic
1057179965 9:93024484-93024506 CCAGCCCCGGGCCCTGGGCCAGG + Intronic
1057229130 9:93308345-93308367 CTGGCCCCAGGCCCTGAGCCAGG + Exonic
1057500876 9:95595927-95595949 CTTGGCCCCAGGCCAGGCCCAGG - Intergenic
1057742691 9:97726011-97726033 CTAGCCCCCAGCCCCTGACCAGG - Intergenic
1057829753 9:98397377-98397399 CTGGCCCCTAGCCCAGAGCCTGG - Intronic
1057856319 9:98603595-98603617 TTTGCCTCCCACCCTGGGCCTGG + Intronic
1058718409 9:107742064-107742086 CTTGCCCACAGCACTATGCCAGG - Intergenic
1059325940 9:113504042-113504064 CTTCCCACCAGCCCCGGGCCTGG - Intronic
1059544719 9:115164747-115164769 TTTGTCACCAGCACTGGGCCTGG - Intronic
1060199633 9:121645121-121645143 CTCAGCCCCAGGCCTGGGCCAGG + Intronic
1060209280 9:121700035-121700057 TGTGCCCCCAGCTCAGGGCCTGG - Intronic
1060231313 9:121827448-121827470 CTCGACCCCAGCTCTGGGACTGG + Intronic
1060278944 9:122203027-122203049 CTTGTGCCCAGCCCTGTGCTAGG - Exonic
1060658430 9:125388526-125388548 GTTGCGCCCAGCCCAGGGCCTGG - Intergenic
1060827190 9:126693946-126693968 TTTGTCCCTAGCCCTGGGACAGG - Intronic
1060876756 9:127089462-127089484 TTTGCACCCAGCCCTGGGCTAGG - Intronic
1060917333 9:127398853-127398875 ACTGCCCCCAGCCATGGGCTTGG + Intronic
1060984677 9:127813302-127813324 AGTGCCCCCAGCCCAGAGCCCGG + Exonic
1060986700 9:127824205-127824227 CTTGCCCCCCTGCCTGGGCTAGG + Intronic
1061192097 9:129087975-129087997 CTTGCCCCCAGCACACAGCCTGG - Intronic
1061225856 9:129280697-129280719 CCTGCCCACAGCCCCTGGCCAGG + Intergenic
1061502912 9:131013935-131013957 TTGGCCCCCAGCACTGGCCCAGG - Intronic
1061798259 9:133100933-133100955 CTGTACCCCAGCCCTGGGTCAGG - Intronic
1061828941 9:133278293-133278315 CTAGCCCCCAGCCCTGAACATGG - Intergenic
1061953291 9:133948461-133948483 CTTGCCCCCAGGTCAGGGGCAGG + Intronic
1061975707 9:134067348-134067370 CTTGCCCCCCGCCCCGGCCGCGG + Intronic
1062024363 9:134333436-134333458 ATCACCCCCAGCCCTGGCCCCGG - Intronic
1062066056 9:134526977-134526999 CATGCCTCCAGCACAGGGCCTGG - Intergenic
1062107665 9:134764498-134764520 CTCTGCCCCAGCCCTGGGCATGG + Intronic
1062247649 9:135577542-135577564 CTTTCCATCAGCCCAGGGCCTGG - Intergenic
1062277053 9:135736182-135736204 CTAGCCCCCAGCCCTGGTGTGGG - Intronic
1062286188 9:135773539-135773561 CTTGGCCCCAAACCTAGGCCAGG - Intronic
1062376512 9:136264189-136264211 CTTGCACAGAGCCCAGGGCCGGG + Intergenic
1062388828 9:136326120-136326142 CTTTGCCACAGCCCTGGGCCTGG - Intergenic
1062399933 9:136367872-136367894 CTTGCCCTGGGCCCTCGGCCCGG + Intronic
1062619030 9:137411312-137411334 CTGCCCCCGAGCCCTGGGCATGG + Intronic
1185544059 X:927279-927301 CTGACTCCCAGCTCTGGGCCTGG + Intergenic
1187393838 X:18903563-18903585 CTTGCCCTCAGGCCTGGGCATGG - Intronic
1190070043 X:47272176-47272198 TGTGTCCCCAGCCCAGGGCCTGG - Intergenic
1190783955 X:53625797-53625819 CCTGGCCCCGGCCCTGGCCCTGG - Intronic
1190881521 X:54495580-54495602 CAAGCCCCCAGCCCGGGCCCGGG + Exonic
1192175212 X:68880933-68880955 CTTGTCACCAGCCCTGGGAAGGG - Intergenic
1192180313 X:68912110-68912132 CCGGGCCCCAGCCCTGGCCCAGG + Intergenic
1192229786 X:69256919-69256941 CTAGCCCCCAGCCCTGTCCCGGG - Intergenic
1192305166 X:69951501-69951523 CTAGTGCCTAGCCCTGGGCCTGG - Intronic
1194385127 X:93243090-93243112 CTTGCCCCAGGGCCTTGGCCTGG - Intergenic
1195111643 X:101656707-101656729 CTTGCCCCCATTCCGGGACCTGG + Exonic
1195615923 X:106911748-106911770 CATGTCCCCAGTCCTGTGCCAGG - Intronic
1195667005 X:107440761-107440783 CATGGGCCCAGCACTGGGCCAGG + Intergenic
1200142107 X:153907532-153907554 CTGCCCCTCAGCCCTGGCCCAGG - Exonic
1200157395 X:153984525-153984547 CAGGCCCCAAGCCCTGGGTCGGG - Intergenic