ID: 1151555299

View in Genome Browser
Species Human (GRCh38)
Location 17:74843442-74843464
Sequence CAGCGTGCTCAAGATGCTGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 100}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151555299_1151555311 21 Left 1151555299 17:74843442-74843464 CCTGCAGCATCTTGAGCACGCTG 0: 1
1: 0
2: 0
3: 7
4: 100
Right 1151555311 17:74843486-74843508 AGGTCCGGGCTGGCCTGCCGCGG 0: 1
1: 0
2: 1
3: 17
4: 200
1151555299_1151555305 1 Left 1151555299 17:74843442-74843464 CCTGCAGCATCTTGAGCACGCTG 0: 1
1: 0
2: 0
3: 7
4: 100
Right 1151555305 17:74843466-74843488 CCTGGGCCGAGCTGGCCGTGAGG 0: 1
1: 0
2: 2
3: 24
4: 227
1151555299_1151555312 24 Left 1151555299 17:74843442-74843464 CCTGCAGCATCTTGAGCACGCTG 0: 1
1: 0
2: 0
3: 7
4: 100
Right 1151555312 17:74843489-74843511 TCCGGGCTGGCCTGCCGCGGTGG 0: 1
1: 0
2: 0
3: 12
4: 230
1151555299_1151555309 11 Left 1151555299 17:74843442-74843464 CCTGCAGCATCTTGAGCACGCTG 0: 1
1: 0
2: 0
3: 7
4: 100
Right 1151555309 17:74843476-74843498 GCTGGCCGTGAGGTCCGGGCTGG 0: 1
1: 0
2: 0
3: 13
4: 228
1151555299_1151555314 25 Left 1151555299 17:74843442-74843464 CCTGCAGCATCTTGAGCACGCTG 0: 1
1: 0
2: 0
3: 7
4: 100
Right 1151555314 17:74843490-74843512 CCGGGCTGGCCTGCCGCGGTGGG 0: 1
1: 1
2: 1
3: 14
4: 193
1151555299_1151555308 7 Left 1151555299 17:74843442-74843464 CCTGCAGCATCTTGAGCACGCTG 0: 1
1: 0
2: 0
3: 7
4: 100
Right 1151555308 17:74843472-74843494 CCGAGCTGGCCGTGAGGTCCGGG 0: 1
1: 0
2: 1
3: 13
4: 395
1151555299_1151555315 29 Left 1151555299 17:74843442-74843464 CCTGCAGCATCTTGAGCACGCTG 0: 1
1: 0
2: 0
3: 7
4: 100
Right 1151555315 17:74843494-74843516 GCTGGCCTGCCGCGGTGGGCTGG 0: 1
1: 0
2: 1
3: 21
4: 255
1151555299_1151555306 6 Left 1151555299 17:74843442-74843464 CCTGCAGCATCTTGAGCACGCTG 0: 1
1: 0
2: 0
3: 7
4: 100
Right 1151555306 17:74843471-74843493 GCCGAGCTGGCCGTGAGGTCCGG 0: 1
1: 0
2: 1
3: 14
4: 177
1151555299_1151555303 -7 Left 1151555299 17:74843442-74843464 CCTGCAGCATCTTGAGCACGCTG 0: 1
1: 0
2: 0
3: 7
4: 100
Right 1151555303 17:74843458-74843480 CACGCTGGCCTGGGCCGAGCTGG 0: 1
1: 0
2: 1
3: 22
4: 252

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151555299 Original CRISPR CAGCGTGCTCAAGATGCTGC AGG (reversed) Exonic
900576345 1:3384304-3384326 AAGCTTGCCCAAGATGCTGCTGG + Intronic
901541818 1:9922835-9922857 CAGCATGCTAAAGGGGCTGCAGG + Intronic
903077778 1:20785943-20785965 CAGCGTGCTCAAAAAGCCCCAGG + Intronic
905452040 1:38063138-38063160 CAGCCTGCCCATGATGCTGAGGG + Intergenic
909778869 1:79517104-79517126 CAGCGTGCACAAGCTGAAGCAGG - Intergenic
915826034 1:159077979-159078001 AAGCATGCTCAAGATGCTCAAGG + Intronic
921152659 1:212414496-212414518 CAGCGTTCTCCGTATGCTGCGGG - Intronic
921840008 1:219818575-219818597 CAGCCTGCTCAGGATCCAGCAGG + Intronic
924897859 1:248361904-248361926 CACTGTGCCCAAGATGCTCCTGG + Exonic
924908982 1:248488828-248488850 CACTGTGCCCAAGATGCTCCTGG + Exonic
924915123 1:248559230-248559252 CACTGTGCCCAAGATGCTCCTGG - Exonic
1062918128 10:1257537-1257559 CAGTGTGATGAAGCTGCTGCAGG + Intronic
1070328162 10:75401176-75401198 CAAGGTGCTGAAGATGCTGACGG - Exonic
1070759536 10:79015137-79015159 CAGCCTGGTCCACATGCTGCAGG - Intergenic
1075538212 10:123289281-123289303 AAGCTTGCTCCAGATGCTGAGGG - Intergenic
1084064578 11:66696276-66696298 CATCCTGCTCAAGAAGCAGCAGG - Exonic
1085534743 11:77211262-77211284 CAGCATCCCCAAGCTGCTGCGGG + Exonic
1090081323 11:123614800-123614822 GAGCGTGTCCAAGCTGCTGCTGG + Exonic
1096589423 12:52647756-52647778 CCGCGTGATCCAGAGGCTGCAGG - Exonic
1100391548 12:94149273-94149295 CAGCTTGCTGAAGCTGCTCCCGG - Exonic
1101603590 12:106231496-106231518 CATGGTGCTCATGATGCAGCTGG - Intergenic
1103327144 12:120129293-120129315 CAACCTCCTCAAGATGCGGCAGG - Exonic
1106125814 13:26899186-26899208 CAGCGTGCTAAGGAAGCTGTGGG - Intergenic
1107688217 13:42925382-42925404 CTGCGTGCTCATGGTGCTCCTGG - Intronic
1108508405 13:51133984-51134006 GAGCGTGCACAGGATGCTGCAGG - Intergenic
1113812091 13:113149172-113149194 CACCAGGCTCAAGATGCTGGAGG + Exonic
1115193991 14:30776886-30776908 CAGCGTTCTCAACCGGCTGCCGG + Intergenic
1116210137 14:41928095-41928117 CAGTGTGCTGAAGGTGCAGCTGG + Intergenic
1118971784 14:70643059-70643081 CATTTTGCTCAAGATGCTGAAGG - Intronic
1119981563 14:79087343-79087365 CAGCATGTTCAAGAGGCTGAAGG - Intronic
1121518079 14:94567043-94567065 CCGGGTGCCCATGATGCTGCAGG + Exonic
1122931520 14:104934925-104934947 AAGCTTGCTGCAGATGCTGCAGG + Exonic
1129182817 15:73887670-73887692 CAGCATGCTGCAGATGGTGCGGG + Exonic
1132410414 15:101573757-101573779 CAGCGTGCTTGAGACACTGCAGG + Intergenic
1132725985 16:1338576-1338598 CAGCGTGCTCAGGCAGGTGCAGG + Exonic
1133282988 16:4677551-4677573 CAGAGTGCTCATCATGCTCCAGG - Exonic
1138419542 16:56890328-56890350 CAACGTGTCCAAGATGATGCAGG + Exonic
1142235369 16:88920007-88920029 CAGAGTGCTCGGGAAGCTGCTGG - Intronic
1142428022 16:90011102-90011124 CAGGGTCCTCAGGGTGCTGCTGG - Intronic
1143090611 17:4447373-4447395 CAGAATGCTCAAGAAGATGCCGG + Intronic
1145112821 17:20179260-20179282 TAGCTTGCACCAGATGCTGCAGG + Intronic
1145734633 17:27218990-27219012 GAGTGTGCTCAAGAACCTGCAGG - Intergenic
1147951082 17:44108444-44108466 TAGGGTTCTAAAGATGCTGCTGG + Intronic
1149619135 17:58028887-58028909 CAGTTGGCTCAAGATTCTGCAGG - Intergenic
1151555299 17:74843442-74843464 CAGCGTGCTCAAGATGCTGCAGG - Exonic
1163204749 19:15794444-15794466 CAACGTGCTCATGAGCCTGCGGG + Exonic
1165781440 19:38436751-38436773 CAGCGTGCCCATCATGCTTCAGG - Intronic
1166095234 19:40534322-40534344 CAGTCAGCTCAAGAAGCTGCAGG + Exonic
933639209 2:84741316-84741338 CAGCATGATCAAGAAGCTGTGGG + Intronic
934791142 2:97061448-97061470 CAGTGTGCTAATGATCCTGCTGG - Intergenic
934815304 2:97321082-97321104 CAGTGTGCTAATGATCCTGCTGG + Intergenic
934822391 2:97387401-97387423 CAGTGTGCTAATGATCCTGCTGG - Intergenic
936165611 2:110116798-110116820 CAGTCTGCTCAGGATGCTCCAGG + Intergenic
936465953 2:112750280-112750302 CTGTGTGCACAAGATGCTGAAGG - Intronic
1172046437 20:32083996-32084018 CAGAGTGCTGAAGGTGCTTCGGG - Exonic
1181150817 22:20882021-20882043 CAGAGATCTGAAGATGCTGCTGG + Intronic
1183682638 22:39342374-39342396 CGGGGAGCTCAAGATGCTGGTGG + Intergenic
1185327224 22:50232660-50232682 CAGCAAGCTCCAGCTGCTGCCGG - Intronic
949366784 3:3290375-3290397 CAGTGTGCTAAAGATCCTGATGG - Intergenic
949722174 3:7002516-7002538 CAGAGTGCTCAGGATACAGCAGG - Intronic
950456488 3:13095740-13095762 CAGAGGGCTCCAGATGCAGCAGG + Intergenic
954183359 3:48898749-48898771 CAGCCCGCTCAAGAACCTGCTGG - Exonic
954691233 3:52396749-52396771 CAGCCAGCTCAAGATGTTCCTGG + Exonic
955306654 3:57839751-57839773 CAGCCTGCTCAACATGATGGTGG - Intronic
955939693 3:64135758-64135780 CTGGGTGCTCAAGGTGATGCTGG + Intronic
962986467 3:140540710-140540732 AAGTGTGTTCAGGATGCTGCTGG - Intronic
984836993 4:184031664-184031686 CAACGTGCTCGGGATACTGCGGG + Intergenic
988503362 5:31801379-31801401 CACCAGGCTCAAGATGCTGCAGG + Intronic
989592394 5:43123658-43123680 CAGACTGCTGGAGATGCTGCAGG + Intronic
993143215 5:84060405-84060427 GAGCGTTCTGAAGATGCTGGAGG + Exonic
994478320 5:100299368-100299390 CAGCGTGTTCAAGGTGATGTAGG - Intergenic
997210507 5:132074260-132074282 CTGGGTGCTCAAGAGGCTGCTGG + Intronic
998186080 5:139981199-139981221 CAGCTTGCTCAGGCTGGTGCTGG - Intronic
998582232 5:143389189-143389211 CAGAGTGCTCTCCATGCTGCTGG + Intronic
998769087 5:145521352-145521374 CAGCATGCTCAAATTCCTGCAGG + Intronic
999217160 5:149944873-149944895 CAGTGTGTTCCAGATGCTGTGGG + Intergenic
999282023 5:150372279-150372301 CAGAGTGCTCAGGCTGCTGGGGG - Intronic
1000382093 5:160638432-160638454 CTGTGTCCCCAAGATGCTGCAGG - Intronic
1004729044 6:18340011-18340033 CAGAAGGCTCATGATGCTGCAGG + Intergenic
1007763530 6:44148178-44148200 CAGCGTGGGCTGGATGCTGCAGG + Intronic
1007809406 6:44475700-44475722 CAGCTGGCTGGAGATGCTGCTGG - Intergenic
1008507638 6:52246483-52246505 CAGCCTGCTCAAGAACCTGCTGG + Intergenic
1012509641 6:99988446-99988468 CAGTGTGCAAAAGAGGCTGCTGG - Intronic
1016789783 6:148056020-148056042 CAGCGTCCTTAATATGCTGGAGG + Intergenic
1019399393 7:843413-843435 CAGCATGCTGCAGTTGCTGCAGG - Exonic
1020083950 7:5300604-5300626 CAGCGTGCCCATGATCCTGGCGG + Exonic
1021101102 7:16586579-16586601 CTGCGTGGTCAAGATGCTTTCGG + Intergenic
1021640512 7:22731453-22731475 CAGCCTGCTGACGAAGCTGCAGG + Exonic
1022559387 7:31333557-31333579 CAGAGTGCCCAAGCTCCTGCTGG - Intergenic
1024570324 7:50717931-50717953 CAGACTGCTCAACATGCAGCAGG + Intronic
1032780006 7:135157945-135157967 CAGCATGGTCAAGAAGCTGTAGG + Intronic
1033746589 7:144323544-144323566 CCACGTGCCAAAGATGCTGCAGG - Intergenic
1034140029 7:148806777-148806799 CAGGGTTCCCATGATGCTGCTGG + Intergenic
1035284761 7:157799149-157799171 CAGCGTGCTCCTGCTCCTGCTGG - Intronic
1036294843 8:7527447-7527469 CAGAGGGCTCCAGATGCTGCAGG + Intergenic
1036327720 8:7793544-7793566 CAGAGGGCTCCAGATGCTGCAGG - Intergenic
1039416045 8:37394751-37394773 GAGAGCACTCAAGATGCTGCGGG + Intergenic
1042358974 8:67860831-67860853 CAGAGTGCTGAAAATGCTACTGG + Intergenic
1046332894 8:112744898-112744920 CAGTGTGCTCAAGATAAAGCTGG - Intronic
1047791887 8:128211618-128211640 GAGCTTGATCAGGATGCTGCTGG + Intergenic
1049233335 8:141495460-141495482 CACCGGCTTCAAGATGCTGCAGG - Intergenic
1057141012 9:92726825-92726847 CAGCAAGTTAAAGATGCTGCAGG - Intronic
1059010144 9:110449030-110449052 TATTGTCCTCAAGATGCTGCTGG - Intronic
1060868057 9:127015620-127015642 CAGCGTCCCCAAGATGGTCCTGG + Intronic
1060931145 9:127490186-127490208 CAGTGTGCTGAACATGATGCAGG - Intronic
1186730437 X:12403713-12403735 CAGTGTGATCATGGTGCTGCTGG - Intronic
1199622982 X:149715564-149715586 AAGGCTGCTCAAGATGCAGCTGG - Intronic
1200246954 X:154531532-154531554 CAGGGGGCTCGAGATGTTGCTGG + Exonic