ID: 1151555843

View in Genome Browser
Species Human (GRCh38)
Location 17:74846345-74846367
Sequence CCCTCCCGGGGGTGCCCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 346
Summary {0: 1, 1: 1, 2: 15, 3: 44, 4: 285}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151555843_1151555858 23 Left 1151555843 17:74846345-74846367 CCTGCTGGGCACCCCCGGGAGGG 0: 1
1: 1
2: 15
3: 44
4: 285
Right 1151555858 17:74846391-74846413 GTTCTCTTGGGTCCTGGATGGGG 0: 1
1: 0
2: 1
3: 17
4: 380
1151555843_1151555859 28 Left 1151555843 17:74846345-74846367 CCTGCTGGGCACCCCCGGGAGGG 0: 1
1: 1
2: 15
3: 44
4: 285
Right 1151555859 17:74846396-74846418 CTTGGGTCCTGGATGGGGTGAGG 0: 1
1: 0
2: 0
3: 39
4: 515
1151555843_1151555854 11 Left 1151555843 17:74846345-74846367 CCTGCTGGGCACCCCCGGGAGGG 0: 1
1: 1
2: 15
3: 44
4: 285
Right 1151555854 17:74846379-74846401 GAGACTTGTCTGGTTCTCTTGGG 0: 1
1: 0
2: 0
3: 13
4: 162
1151555843_1151555853 10 Left 1151555843 17:74846345-74846367 CCTGCTGGGCACCCCCGGGAGGG 0: 1
1: 1
2: 15
3: 44
4: 285
Right 1151555853 17:74846378-74846400 AGAGACTTGTCTGGTTCTCTTGG 0: 1
1: 0
2: 1
3: 17
4: 169
1151555843_1151555856 21 Left 1151555843 17:74846345-74846367 CCTGCTGGGCACCCCCGGGAGGG 0: 1
1: 1
2: 15
3: 44
4: 285
Right 1151555856 17:74846389-74846411 TGGTTCTCTTGGGTCCTGGATGG 0: 1
1: 0
2: 1
3: 21
4: 205
1151555843_1151555852 1 Left 1151555843 17:74846345-74846367 CCTGCTGGGCACCCCCGGGAGGG 0: 1
1: 1
2: 15
3: 44
4: 285
Right 1151555852 17:74846369-74846391 CCAATGGGCAGAGACTTGTCTGG 0: 1
1: 0
2: 0
3: 13
4: 121
1151555843_1151555855 17 Left 1151555843 17:74846345-74846367 CCTGCTGGGCACCCCCGGGAGGG 0: 1
1: 1
2: 15
3: 44
4: 285
Right 1151555855 17:74846385-74846407 TGTCTGGTTCTCTTGGGTCCTGG 0: 1
1: 0
2: 1
3: 18
4: 270
1151555843_1151555857 22 Left 1151555843 17:74846345-74846367 CCTGCTGGGCACCCCCGGGAGGG 0: 1
1: 1
2: 15
3: 44
4: 285
Right 1151555857 17:74846390-74846412 GGTTCTCTTGGGTCCTGGATGGG 0: 1
1: 0
2: 0
3: 13
4: 223

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151555843 Original CRISPR CCCTCCCGGGGGTGCCCAGC AGG (reversed) Intronic