ID: 1151560083

View in Genome Browser
Species Human (GRCh38)
Location 17:74865330-74865352
Sequence GAAGTAGACAGGTCTATGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 136}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151560083 Original CRISPR GAAGTAGACAGGTCTATGGG AGG Intronic
900467408 1:2832605-2832627 GCAGAAGAAAGGTGTATGGGGGG + Intergenic
904260063 1:29283184-29283206 AAAGGAGGCAGGGCTATGGGAGG - Intronic
907660435 1:56387503-56387525 GAAGGAGACAGGCCCAGGGGTGG - Intergenic
912706861 1:111921029-111921051 GAAGAAGACAGGTCTGTGGCTGG + Intronic
914099705 1:144572857-144572879 GAAGTAGAGATGTGTTTGGGGGG - Intergenic
916005753 1:160658571-160658593 GAGCTAGACAGGTCAAAGGGCGG - Intergenic
919744785 1:201001881-201001903 GAAGTAGAGAGGGCTTGGGGTGG + Intronic
919909323 1:202101164-202101186 GAAATAGACAGGTTTAAGGAGGG - Intergenic
921529751 1:216267148-216267170 GAAATAGTCAGGGATATGGGAGG + Intronic
1067297098 10:44980840-44980862 GGAGTTCAAAGGTCTATGGGGGG - Intronic
1070043811 10:72810072-72810094 GAACTAGACATGTCTAAGGTTGG + Intronic
1076087564 10:127648634-127648656 GAAATAGACAGGTTTATCAGAGG - Intergenic
1077921192 11:6642931-6642953 GAAGTGGATAGGTCTCTGGTGGG + Intronic
1078437806 11:11339812-11339834 GAAGTTGACTGGTTCATGGGTGG - Intronic
1081268552 11:41057433-41057455 GAAGCAGACAGGTTCCTGGGTGG + Intronic
1084314578 11:68337700-68337722 GAGGTAGACCTGACTATGGGTGG - Intronic
1087910968 11:103753026-103753048 GAAGCAGAAGGTTCTATGGGTGG + Intergenic
1089252341 11:117174046-117174068 GGAGTAGCCATGCCTATGGGTGG - Intronic
1089680670 11:120117315-120117337 GGAGGAGACAGGACTATGGGTGG - Intronic
1089927214 11:122271223-122271245 GAAGAATTCAGGTCCATGGGTGG - Intergenic
1090045690 11:123330848-123330870 GAAGTTAAGAGGTCTGTGGGAGG - Intergenic
1096062635 12:48714960-48714982 AAAGTAGCCAGGTCTGTTGGTGG - Intronic
1099322049 12:81162651-81162673 GAGGTAGACAGGCTTCTGGGTGG - Intronic
1101833296 12:108276170-108276192 AAAGTTGCCAGCTCTATGGGAGG - Intergenic
1103904204 12:124319174-124319196 GAAGGAGGCAGGTCTAGGGAAGG - Intergenic
1104133915 12:125919588-125919610 GAAGTCTGCAGGTCTCTGGGGGG + Intergenic
1105922975 13:24982616-24982638 GCAGGAGACAGGTGCATGGGCGG - Intergenic
1106404116 13:29458885-29458907 AAAGTTGAGAGGCCTATGGGTGG + Intronic
1107491705 13:40886276-40886298 GCAGGAGACATGTCTATGAGTGG - Intergenic
1109247050 13:59967495-59967517 CAAGTAGACAGGTCTACTTGTGG - Intronic
1114349608 14:21835746-21835768 GAGGCAGACAGGTTTCTGGGTGG - Intergenic
1117924986 14:60769123-60769145 GAAGTAGTCATTTCTATGGGAGG - Intronic
1121890293 14:97583884-97583906 GAAGTAGATGGGTCAACGGGTGG + Intergenic
1125432079 15:39605600-39605622 GAAGTAGAGAGGGCTAGGTGGGG + Intronic
1127525956 15:59792177-59792199 GAGGTAGACAGGTTCCTGGGTGG - Intergenic
1128632023 15:69277752-69277774 CATGTAGACAGGCCTTTGGGTGG - Intergenic
1135516668 16:23141338-23141360 GAAATAGATAGGTGTATGAGAGG - Intronic
1135946611 16:26870469-26870491 GAAGCAGCCAGTTCTATGGCTGG + Intergenic
1136234845 16:28907098-28907120 GAAGTGGACAGATCTCAGGGTGG + Intronic
1145873125 17:28293072-28293094 CAAGTAGCCAGGACTATAGGTGG - Intergenic
1151560083 17:74865330-74865352 GAAGTAGACAGGTCTATGGGAGG + Intronic
1154290281 18:13100811-13100833 GAAGAAGACAGGACAGTGGGTGG + Intronic
1156128959 18:33944651-33944673 GAAGAAAAGAGGTCCATGGGTGG + Intronic
1158371425 18:56810066-56810088 GAAATAGCCAGGTTTATGGCTGG + Intronic
1162633018 19:11943854-11943876 GAAGCTGACTGGTCTATGTGCGG - Intronic
1162705750 19:12553733-12553755 GCAGTGGACAGGTGAATGGGGGG - Intronic
1162972372 19:14188437-14188459 GAAGTATACATGGCTCTGGGGGG - Intronic
1166277346 19:41763198-41763220 GAAGAAGAGAGTTCTGTGGGTGG - Intronic
1166566970 19:43771283-43771305 TCAGTAAACAGGTCTAGGGGTGG - Intronic
925857788 2:8146848-8146870 GAAGAAGACAGTCCCATGGGAGG - Intergenic
926512553 2:13800647-13800669 CAGGTAGACAAGTCTATGGAAGG + Intergenic
927275809 2:21261377-21261399 GAAGTAGCCAGCACTTTGGGAGG - Intergenic
927833902 2:26375765-26375787 GAAGTAAAAAGGTATATGTGTGG + Intronic
928188242 2:29135466-29135488 AAAGAAGACAGGGCTTTGGGAGG - Intronic
930686480 2:54313508-54313530 GAAGTGGAGAAGTCTGTGGGAGG - Intergenic
933223876 2:79723156-79723178 GAACTACGCAGGTCTATAGGGGG - Intronic
933710851 2:85324884-85324906 GGAGGAGCCAGGTCCATGGGAGG - Intronic
934137643 2:89012586-89012608 GTTGTAGACAGGTAAATGGGGGG + Intergenic
934231606 2:90188042-90188064 GTTGTAGACAGGTAAATGGGGGG - Intergenic
934922954 2:98360276-98360298 ACAGGAGGCAGGTCTATGGGAGG + Intronic
935561311 2:104562883-104562905 GAAGTAGAGAGGGTGATGGGGGG - Intergenic
936520036 2:113206072-113206094 GAAGGAGAGAGGTCTGTGGCAGG - Intronic
940329046 2:152454976-152454998 GAAGTAGACATGTCATTGAGAGG + Intronic
946633410 2:221697166-221697188 GAAGAAGCAAGGTGTATGGGAGG + Intergenic
948373201 2:237503826-237503848 GAAGTAGACATCTTTTTGGGGGG - Intronic
1169279978 20:4258765-4258787 GATCTAGAAATGTCTATGGGGGG + Intergenic
1169778808 20:9286299-9286321 GAAGTATGAAGGTTTATGGGTGG - Intronic
1170188490 20:13619127-13619149 GAAGTGGACGGATCTTTGGGAGG - Intronic
1170445437 20:16422454-16422476 CAAGTGGCCAGGGCTATGGGTGG + Intronic
1170530587 20:17287508-17287530 GAAGTAAACAGGTCAAGGAGGGG + Intronic
1174958990 20:55133995-55134017 GAATTATAGAGGTCTTTGGGAGG - Intergenic
1177281409 21:18987175-18987197 CCAGTAGACAGGACTATGGTTGG + Intergenic
1181537584 22:23554514-23554536 CAGGTGGACAGGTCTGTGGGTGG - Intergenic
1182953748 22:34401529-34401551 GAAGTTGGCTGGTCTATAGGGGG + Intergenic
1183274687 22:36886329-36886351 GAGGTAGACAGGACTATGTGTGG - Intergenic
949226315 3:1699821-1699843 GAGGCAGACAGGTCCCTGGGAGG + Intergenic
950557020 3:13702175-13702197 GAAGTAGCCCAGGCTATGGGTGG - Intergenic
952825360 3:37520273-37520295 GCAGGAGACAGGGCTTTGGGAGG + Intronic
955870684 3:63435389-63435411 GAATTAGAAAGGTCCATGGTAGG + Intronic
956545586 3:70398170-70398192 AAATTATACATGTCTATGGGTGG + Intergenic
961503913 3:127357598-127357620 GAAGTAGACAGGAAAATGTGGGG - Intergenic
962785965 3:138768598-138768620 GAGGCAGACAGGTTTCTGGGTGG - Intronic
963011271 3:140772878-140772900 GATGTAGACAGGCCTATTAGAGG - Intergenic
965208892 3:165759151-165759173 GAAGTAGGGCGGGCTATGGGTGG - Intergenic
965634732 3:170769544-170769566 GAAGGAGGCAGGTCTAGGGGAGG + Intronic
965679686 3:171237019-171237041 GAATGAGACAGGACTGTGGGTGG - Intronic
966321607 3:178707089-178707111 GAAGGAGAAAGGCCTAAGGGAGG + Intronic
968650330 4:1757838-1757860 GGAGTCGAGAGGTCTGTGGGTGG - Intergenic
968959774 4:3737560-3737582 GAAGGAGACAGGCCTTTGGGGGG + Intergenic
969189682 4:5507047-5507069 AAATTAGAAAGGTCTATGTGGGG - Intergenic
969352452 4:6605692-6605714 TAAGTAGACAGGTGGGTGGGTGG - Intronic
972008624 4:34145063-34145085 GAAATAGAAAAGTCTTTGGGAGG - Intergenic
976463148 4:85336428-85336450 GAAGTAGACATGTCAATGAGGGG - Intergenic
981099316 4:140812860-140812882 GAAGTAGAGCACTCTATGGGGGG + Intergenic
988663835 5:33303057-33303079 CTAGTAGACAGGGTTATGGGAGG - Intergenic
990021843 5:51137377-51137399 GGAGGAGATAGGTCTATGAGTGG - Intergenic
992367369 5:76106336-76106358 GAAGCAGAGAGGTATGTGGGAGG - Intronic
996165265 5:120214972-120214994 GAAGCAGACAGGGGTATTGGGGG + Intergenic
996227357 5:121016268-121016290 GAAGTAAACATGTCCAGGGGAGG - Intergenic
996372913 5:122772286-122772308 GAAGGAGACAGCTCTAAGAGAGG - Intergenic
997832152 5:137159121-137159143 GAAGAAGAAAGACCTATGGGTGG - Intronic
998063335 5:139136348-139136370 GAGGTAGACAGGGCTAAGGCAGG + Intronic
999466965 5:151816517-151816539 GAAGTAGACAGGTCAAGGAGAGG - Intergenic
1006463817 6:34179160-34179182 GAGGCAGACAGGTTTCTGGGTGG - Intergenic
1006648248 6:35530299-35530321 GGAGTAGCCAGGTGTATGGCTGG - Intergenic
1009996845 6:70905346-70905368 GAAGTATACAGATCTATGCAAGG - Intronic
1012457982 6:99428212-99428234 GAAGTAGAAAATTCTAGGGGAGG + Intergenic
1013448786 6:110258567-110258589 GAGGTAGATAGGTGGATGGGTGG + Intronic
1015053703 6:128874553-128874575 AAAGAAGACAGGTAAATGGGGGG + Intergenic
1021312325 7:19109967-19109989 AAAGTAGAGAGCTATATGGGTGG + Intronic
1022307468 7:29160792-29160814 GAGGTAGACTGGTCTCAGGGTGG - Intronic
1026294350 7:69038126-69038148 GACGTAGACAGCAGTATGGGTGG + Intergenic
1028046863 7:86130999-86131021 CCAGTAGACAGGACTATGGCTGG - Intergenic
1028341888 7:89732546-89732568 GAAGTAGACATCTTTGTGGGGGG - Intergenic
1030537520 7:110787927-110787949 GAAGAATACAGGTCTATATGAGG + Intronic
1033537878 7:142328747-142328769 GAAGTACACAGATGTCTGGGAGG - Intergenic
1033540241 7:142349625-142349647 GAAGTACACAGATGTTTGGGAGG - Intergenic
1033551395 7:142451409-142451431 GAAGTACACAGATGTCTGGGAGG - Intergenic
1033553661 7:142469974-142469996 GAAGTACACAGATGTCTGGGAGG - Intergenic
1035225352 7:157429540-157429562 GAATTAGACAGGGCAAGGGGAGG + Intergenic
1036451142 8:8868786-8868808 GAAGTAGCGATGACTATGGGTGG - Intronic
1037219367 8:16499146-16499168 GAGGTAGACAGGGAGATGGGAGG - Intronic
1038548634 8:28445956-28445978 GAAGTAGAAAGGAATAAGGGTGG - Intronic
1039594904 8:38783264-38783286 GAAGAAAACAGATCAATGGGTGG + Intronic
1040576081 8:48652513-48652535 GAAGTATACAGGGCTATGATGGG - Intergenic
1044015512 8:87045467-87045489 AGAGTACACAGGTCTTTGGGAGG + Intronic
1048736408 8:137506913-137506935 GAAGTAAAGAGTTCTATAGGAGG + Intergenic
1049599435 8:143500178-143500200 GAAGCAGATAGTTCTGTGGGTGG - Intronic
1050606415 9:7305911-7305933 GTAGGAGACAAGTCTATGGGAGG + Intergenic
1050653855 9:7802451-7802473 GAAGTAGAGAGGGCAATGGTTGG + Intronic
1051111674 9:13645565-13645587 GAAATAGGTAGGTCTCTGGGTGG - Intergenic
1056774764 9:89503136-89503158 GAAGGAGACAGGACTCTTGGTGG + Intergenic
1057491455 9:95523072-95523094 GGTGTAGACAGGTCTCTGAGAGG - Intergenic
1057559782 9:96118102-96118124 GAAGAAGACAAGTGGATGGGGGG + Intergenic
1057727528 9:97578723-97578745 GATGTAGACAGGTCGAATGGGGG + Intronic
1062112199 9:134788293-134788315 TAAGTAGACAGGTCGATGAATGG + Intronic
1062135998 9:134928876-134928898 GGAGGAGCCAGGTCTCTGGGTGG - Intergenic
1186458849 X:9732361-9732383 GAAACATACAGGACTATGGGTGG + Intronic
1187573468 X:20529731-20529753 GAATTAGAGATGTCTGTGGGTGG + Intergenic
1188434867 X:30148509-30148531 GAGGCAGACAGGCCTCTGGGCGG + Intergenic
1189017185 X:37296520-37296542 GAAGAAGACAGGAATATGAGGGG - Intergenic
1193380115 X:80808744-80808766 GAGCTAGACAAGTATATGGGGGG + Intronic
1194744860 X:97617275-97617297 GAAGTAGACAGCTTCAGGGGAGG - Intergenic
1195804026 X:108742768-108742790 GTAGTAGCCAGGACAATGGGTGG - Intergenic
1197162700 X:123341951-123341973 GAAGTAGATAGGACTAAGAGTGG + Intronic
1199071420 X:143479926-143479948 GCAGTAGACAGGTGTGTGTGTGG - Intergenic