ID: 1151560840

View in Genome Browser
Species Human (GRCh38)
Location 17:74868778-74868800
Sequence GGTTAAATCCTCAGGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 142}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151560840 Original CRISPR GGTTAAATCCTCAGGGAGGA GGG (reversed) Intronic
900247801 1:1646613-1646635 ACTTGAATCCTCAGGAAGGAAGG - Intronic
900259028 1:1713767-1713789 ACTTGAATCCTCAGGAAGGAAGG - Intronic
901564985 1:10106558-10106580 GGAGAGATCCTCAGGGAGGAGGG - Exonic
904874977 1:33647255-33647277 GGTGCCATTCTCAGGGAGGAAGG + Intronic
905008798 1:34732711-34732733 GAATAAATTATCAGGGAGGAAGG + Intronic
906222129 1:44089076-44089098 TGTTAAATCTTCAAGAAGGAGGG + Intergenic
908889651 1:68830113-68830135 CCTTAAATCCCCAGAGAGGAAGG - Intergenic
910131456 1:83912177-83912199 GGGTAAATTTTCATGGAGGAAGG + Intronic
912712637 1:111960770-111960792 GCTTAAGTCCTCAGGGATGAGGG + Intronic
914003075 1:143709107-143709129 GGTAAAATCCACAGGAAGAAGGG - Intergenic
914197772 1:145458647-145458669 TGTTATATACTAAGGGAGGAAGG + Intergenic
914476876 1:148031758-148031780 TGTTATATACTAAGGGAGGAAGG + Intergenic
914937116 1:151991489-151991511 AGTTAAATCCTTTGGTAGGATGG + Intronic
916644065 1:166764605-166764627 GTTAAACTCCTCAGGGAGGATGG - Intergenic
917439624 1:175055546-175055568 GGTCGCAGCCTCAGGGAGGATGG + Intergenic
919733166 1:200927509-200927531 GGTTCAATGCTCTGGGAGAAAGG + Intergenic
920249292 1:204612420-204612442 GGTAAAATCATCAAGAAGGAAGG + Intergenic
920370694 1:205477616-205477638 GGTTAACCCCTCAGGGGGAAGGG - Intergenic
920688124 1:208125426-208125448 GGGTAAATTCTGATGGAGGAAGG - Intronic
921658615 1:217771365-217771387 GGGTTAATCCTCAGGGACTATGG - Intronic
924436927 1:244049669-244049691 GGTTAAAACCACAGGGAAGGAGG - Intronic
924499232 1:244620941-244620963 GGCAAAATCCTTAGGGAAGATGG + Intronic
1063603803 10:7505914-7505936 GTTTAAATCCCCAGGAAGAAAGG + Intergenic
1063974039 10:11401397-11401419 GGTTAAACCCTCAGCAGGGATGG + Intergenic
1067710580 10:48648423-48648445 AGTTAAATCCTCAGCCGGGAAGG - Intronic
1069652493 10:70059867-70059889 GGTTACACCCACAGAGAGGATGG + Intronic
1069926904 10:71856872-71856894 GGTACAATCATCAGGGAGGCAGG - Intergenic
1072366702 10:94718705-94718727 GGTTTAATCCTCTGGGATCATGG - Intronic
1075372593 10:121950470-121950492 GGCAAAGTCCTCAGGTAGGAGGG + Intergenic
1080337461 11:31214498-31214520 GGTAAAATCCTCAGTGTGGTAGG + Intronic
1080972849 11:37300209-37300231 GGTTTAGTCCTCTGTGAGGAGGG + Intergenic
1081814245 11:45929661-45929683 GGTGGGGTCCTCAGGGAGGAAGG + Intronic
1083234162 11:61341398-61341420 GGTAAAAGCCCCAGGGGGGAGGG - Intronic
1083421717 11:62556930-62556952 GGCTGAAGCCTCAGGCAGGAGGG - Intergenic
1083638828 11:64134453-64134475 AGTTGAACCCACAGGGAGGAGGG + Intronic
1085923540 11:80987861-80987883 GTATAAATCCTCAGGGATAATGG + Intergenic
1091448440 12:558168-558190 GGTGAGCCCCTCAGGGAGGACGG + Intronic
1091491940 12:940184-940206 CGTTAAATCGGGAGGGAGGAAGG + Intronic
1092346006 12:7715064-7715086 GGGAAATTCCTCAGGGTGGAAGG - Intronic
1094435602 12:30417816-30417838 AGCTAAATCCTCAGGGAGGATGG - Intergenic
1096570785 12:52521894-52521916 CTTCAAAGCCTCAGGGAGGAGGG + Intergenic
1097493934 12:60305242-60305264 GGTAAAATCCTAAGGGCAGAGGG - Intergenic
1098143351 12:67473129-67473151 TGTGCAATCTTCAGGGAGGAAGG + Intergenic
1098861209 12:75712312-75712334 AGTTAAATCCTCATAGAGAAAGG - Intergenic
1100714371 12:97290194-97290216 AGTCAAATCCTCAGGGAGTGGGG - Intergenic
1109280339 13:60348700-60348722 GGTTCAATCTTCTGGGAGTAGGG + Intergenic
1109844116 13:67961637-67961659 GGTTAAATGCTCAATGAAGAGGG - Intergenic
1110111471 13:71752073-71752095 GATTAAAACCTCTGAGAGGATGG - Intronic
1112949961 13:104981777-104981799 GGTTAAATTCTCAGGGACCTCGG - Intergenic
1113712943 13:112482336-112482358 GGTCAAGACATCAGGGAGGAAGG - Intergenic
1117642308 14:57812897-57812919 CCTTCAACCCTCAGGGAGGAAGG - Intronic
1117715249 14:58573653-58573675 GGTAAAATTCTCAGGTAGAAGGG - Intergenic
1125022491 15:34999057-34999079 GATTAAGTGGTCAGGGAGGAAGG + Intergenic
1125340133 15:38667509-38667531 TGTTAACTCTCCAGGGAGGATGG - Intergenic
1125430613 15:39589645-39589667 GCTTATAGCCTCAGGGAGAATGG + Intronic
1130579083 15:85118576-85118598 GTTTAAATCCTGAGGGAGGTGGG - Intronic
1131300326 15:91194058-91194080 GGTTCGATGGTCAGGGAGGAGGG + Intronic
1131457916 15:92597639-92597661 CCTTAAATCCTCAGGGAGGTGGG + Intergenic
1131460909 15:92616917-92616939 GAGTAGCTCCTCAGGGAGGAGGG + Intergenic
1131668881 15:94598317-94598339 GGTAGAGTCTTCAGGGAGGAAGG + Intergenic
1132883633 16:2172939-2172961 GGTTTTATCCTCAGGAAGGGAGG + Intronic
1134468355 16:14499017-14499039 TGTTAAATGCCCAGGCAGGATGG - Intronic
1135788450 16:25371795-25371817 AGTCCAGTCCTCAGGGAGGAAGG - Intergenic
1136402923 16:30028326-30028348 GCTTTAATCCTCAGGTAGGTGGG - Intronic
1136630244 16:31485670-31485692 GGTCAGATCCTCAGGGATGAGGG + Intronic
1138066721 16:53949124-53949146 GGTTTAATTCTCAGAAAGGAAGG + Intronic
1140202835 16:72908190-72908212 GTGTCAATCCCCAGGGAGGAGGG - Intronic
1142197701 16:88746336-88746358 GGTTTTATCCTAAGGCAGGATGG + Intronic
1147766203 17:42838054-42838076 GGTCAAATGATCAGGGAAGAGGG - Intronic
1151560840 17:74868778-74868800 GGTTAAATCCTCAGGGAGGAGGG - Intronic
1152087148 17:78227280-78227302 GGTTCCATTCTCAGGGAGGCAGG - Intergenic
1152333961 17:79689712-79689734 GGTTTATTCCTTGGGGAGGAGGG - Intergenic
1158455597 18:57604562-57604584 GGTTAAATGCACAGGAAAGAGGG + Intronic
1159904550 18:74077959-74077981 GGTTAGATCCTATGGGAGGAAGG + Intronic
1164748896 19:30636489-30636511 TGATAAATCCCCAGGAAGGAAGG - Intronic
1165008133 19:32823212-32823234 GGTTCATTCCTCATTGAGGATGG + Intronic
1167693602 19:51001745-51001767 CGTGAAATCTTGAGGGAGGAGGG + Intronic
927854672 2:26520526-26520548 AGTTTCATCCTCAGGGAGGTGGG - Intronic
928410831 2:31052623-31052645 GGACATATCCTCAGGGAGGTGGG + Intronic
928821749 2:35369949-35369971 GGTTAAATACCCTGGGTGGATGG + Intergenic
929871745 2:45765014-45765036 GGCCAAAGCCACAGGGAGGAAGG - Intronic
931633037 2:64318237-64318259 GGATAACTCCCCAGGGACGAAGG + Intergenic
932319748 2:70812925-70812947 TGTAAAATCCCCAGGGAAGATGG - Intronic
932664184 2:73683590-73683612 GGTTACATCCTTAGGGAGCTGGG + Intergenic
935115219 2:100129585-100129607 GGTTAATTCCTCAGGCTGGTGGG - Intronic
935538941 2:104326539-104326561 GGTTAAACCCCCAGGCTGGATGG - Intergenic
938144546 2:128822577-128822599 GGGTGCATCCTCAGGGAAGAGGG - Intergenic
939765225 2:146240013-146240035 GGTTAGACCTTCAGGGAGAAAGG - Intergenic
940145201 2:150538482-150538504 GGTTAAATACTCATAGAGGATGG + Intronic
940885300 2:158984709-158984731 GGGGAAAGCTTCAGGGAGGAGGG + Intronic
941766055 2:169297723-169297745 GTTTACATAATCAGGGAGGAGGG + Intronic
942045700 2:172098059-172098081 GGTTCAAACCCCAGGTAGGAAGG + Intergenic
942702647 2:178731114-178731136 GGTTAAATTTTCAGGGACTAAGG - Exonic
944869664 2:203897198-203897220 GGATAAATTCTCAGGTAGGATGG + Intergenic
947068733 2:226261678-226261700 GTGTAAATCATCAGGGAGAAAGG - Intergenic
947668803 2:231924121-231924143 GGTTAAAACCTCGGGCAGGTGGG + Intronic
1169901073 20:10552104-10552126 GGCTGAATCCTCTGGGTGGAGGG + Intronic
1170585795 20:17732947-17732969 GGTGAAGTGCTCAGGGAAGAAGG + Intronic
1171849999 20:30301270-30301292 GCTTATCTCCTCATGGAGGATGG + Intergenic
1175457386 20:59125667-59125689 GGGGAAAAGCTCAGGGAGGAAGG + Intergenic
1177004052 21:15648808-15648830 GGATGAATTCTCAGGAAGGATGG - Intergenic
1181186003 22:21104221-21104243 GGTAAAAACCTCATGGAGAATGG - Intergenic
949841556 3:8325833-8325855 GGTCAAATTGTCAGGGTGGATGG + Intergenic
951699170 3:25477650-25477672 AGTTAAACCCTAAGGGAGAAGGG - Intronic
953852808 3:46478972-46478994 GGATAAATGCTCTGTGAGGATGG - Intronic
954855607 3:53641405-53641427 GTTCATATCCTCAAGGAGGATGG - Intronic
957261861 3:77912144-77912166 GGTTTATTCCTAAGGAAGGAGGG + Intergenic
958690629 3:97461112-97461134 GGCAAAAACTTCAGGGAGGATGG + Intronic
959692084 3:109208880-109208902 GGTTGAAAACTAAGGGAGGATGG - Intergenic
961198172 3:125021319-125021341 GGTCTAATCCTCACAGAGGAAGG + Intronic
964320314 3:155488798-155488820 GGTTAAATCCTCAGAGAAATAGG + Exonic
966845815 3:184128905-184128927 GCTTGAATCCAGAGGGAGGATGG - Intergenic
968024282 3:195426200-195426222 GATTAAAGCCTCAGGGAGAAAGG - Intronic
970560848 4:17280721-17280743 GTTTAAGGCCTCTGGGAGGAGGG - Intergenic
971768147 4:30860826-30860848 GGTTTAAGGCTCAAGGAGGAAGG + Intronic
982211125 4:153037355-153037377 GGTTATTACCTCTGGGAGGAGGG - Intergenic
985746746 5:1652361-1652383 AGATAAATTCTCAGGGAGAATGG + Intergenic
988657787 5:33231298-33231320 GGCTAAAGCCTCAGGGGGAAAGG + Intergenic
989491197 5:42057341-42057363 GGTAAACTCCTCTGGGAGGTAGG - Intergenic
990155806 5:52876053-52876075 GTGAAAATCCTCAAGGAGGAAGG - Intronic
994524694 5:100889325-100889347 GGTTAAATCATCAGGCTAGATGG + Intronic
998175047 5:139896554-139896576 GACTAAATACCCAGGGAGGAAGG - Intronic
1000917852 5:167103680-167103702 GGTTAGATTCACAGGGAGAATGG - Intergenic
1003032926 6:2618357-2618379 GGTTATGTCTTCAGGGAGTAAGG + Intergenic
1003638107 6:7853132-7853154 GGTCAAGACCTCAGGGAGAAAGG - Intronic
1004972641 6:20929049-20929071 GGTTAAAACTGCAGGGAGGCGGG - Intronic
1006425076 6:33958668-33958690 GGCCAAGTCCTCAGGGAAGAAGG + Intergenic
1008263443 6:49394787-49394809 GGGTAAATCCTAAGGCATGAAGG + Intergenic
1011253213 6:85394717-85394739 TGTTAAATCCTTAGGAAAGAAGG + Intergenic
1013661231 6:112299036-112299058 GGCTGATTCCTCAGGGTGGAAGG + Intergenic
1018592003 6:165436450-165436472 GGTTAAATGAACAAGGAGGAAGG + Intronic
1018920740 6:168170835-168170857 GGTAAAATCCACAGGAAGCATGG - Intergenic
1019794722 7:3041263-3041285 GCTGAAAATCTCAGGGAGGAAGG - Intronic
1019920157 7:4158172-4158194 GTTGAAATCCTCAGGGAGAAAGG - Intronic
1020762731 7:12288702-12288724 AGTTTAATCCCCAGGCAGGAAGG - Intergenic
1023046639 7:36215696-36215718 GGTTAGATCCTTGGGGAGTAAGG + Intronic
1024268369 7:47623778-47623800 GGTTATAACCTCAGAGAGGATGG - Intergenic
1029862191 7:103584237-103584259 GGCTAAATCCTCAACTAGGAAGG + Intronic
1030205584 7:106949580-106949602 GACTTCATCCTCAGGGAGGATGG + Intergenic
1030909826 7:115233416-115233438 GCTTCAGTCCTCAGGGAGGAAGG - Intergenic
1032995912 7:137446387-137446409 GGTGAAATACTGAGTGAGGATGG - Intronic
1037891604 8:22626699-22626721 GCTCACATCCTCAGGAAGGAGGG + Intronic
1039418814 8:37418825-37418847 GGTTAATTCCTTAATGAGGATGG + Intergenic
1042986791 8:74593636-74593658 TGCTAAATACTCAAGGAGGAAGG + Intergenic
1043726353 8:83616341-83616363 AGTTAAACCCTCAGAGATGAAGG - Intergenic
1045713605 8:105015482-105015504 GGTAAAATCCTCAAGGAGAAAGG - Intronic
1050503576 9:6324056-6324078 GGTTAATACGTAAGGGAGGAAGG - Intergenic
1051974973 9:22938238-22938260 GGCTAAATACTCATGAAGGAGGG + Intergenic
1055114521 9:72592515-72592537 GGGTAAATTCTGAAGGAGGAGGG - Intronic
1056299373 9:85226098-85226120 GACTAAAGCCTCAGGGAGTAGGG - Intergenic
1057151034 9:92796334-92796356 GGGTAAATCCTTACGAAGGAGGG + Intergenic
1057171153 9:92963975-92963997 GTGTAGATCTTCAGGGAGGAGGG - Intronic
1057423542 9:94930519-94930541 AGTGAAATCCTCAGGGAGAGAGG + Intronic
1059819422 9:117955845-117955867 GGTTAAATGCTCTGTGATGAGGG + Intergenic
1187867989 X:23741497-23741519 GGTTATTTCCTCAGAGTGGAGGG - Intronic
1188752637 X:33923007-33923029 GGTCATATTCTAAGGGAGGAGGG - Intergenic
1190864147 X:54370528-54370550 GGTTATATACTCAGGCAGGAGGG - Intergenic
1192018127 X:67354255-67354277 GGTGAAAGCCACAGGGAGGCTGG - Intergenic
1193997537 X:88384792-88384814 GGTTAAATCTCCAGGGGAGAGGG - Intergenic