ID: 1151561475

View in Genome Browser
Species Human (GRCh38)
Location 17:74872206-74872228
Sequence TGGGAAGTTCCAGCTTCTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 223
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 206}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151561475_1151561482 20 Left 1151561475 17:74872206-74872228 CCAACAGAAGCTGGAACTTCCCA 0: 1
1: 0
2: 1
3: 15
4: 206
Right 1151561482 17:74872249-74872271 CCTCCTTCTCTTGTTCCTCAAGG 0: 1
1: 0
2: 4
3: 56
4: 521
1151561475_1151561484 26 Left 1151561475 17:74872206-74872228 CCAACAGAAGCTGGAACTTCCCA 0: 1
1: 0
2: 1
3: 15
4: 206
Right 1151561484 17:74872255-74872277 TCTCTTGTTCCTCAAGGCTTTGG 0: 1
1: 0
2: 3
3: 21
4: 252

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151561475 Original CRISPR TGGGAAGTTCCAGCTTCTGT TGG (reversed) Intronic
900974323 1:6007781-6007803 GGGGAGGTTCCAGGTTCTCTTGG - Intronic
905244987 1:36606614-36606636 TGGAAGGTTCCTGGTTCTGTTGG + Intergenic
905352863 1:37359612-37359634 AGAGAAGTCCCAGCTTCTCTAGG + Intergenic
907400005 1:54219301-54219323 TGGGAACTTCCAGCAGCTGGAGG + Intronic
909495533 1:76273523-76273545 TAGGAAGTTCCACCTTTTCTTGG - Intronic
912792910 1:112670715-112670737 AAGGAAGTGCCAGCTTCTCTGGG + Exonic
915601434 1:156925096-156925118 TGGCAGGTCCCAGCTCCTGTGGG + Intronic
916080485 1:161229114-161229136 TCAGAGGTTCCAGCTGCTGTGGG - Exonic
916252600 1:162753534-162753556 TGGGAAGGTGCAGATTATGTAGG + Intronic
916490578 1:165298670-165298692 GGGGAAGTTACACCTTATGTGGG - Intronic
917443921 1:175090907-175090929 TGGGAAGTTCCAGCCTGGGGAGG + Intronic
918290773 1:183105840-183105862 TGGGAGATTACAGCTTCTGCAGG - Intronic
920677218 1:208046518-208046540 AGGGAAGTACCAGCTACTCTAGG + Intronic
921322283 1:213953693-213953715 AGGGTACTTCAAGCTTCTGTAGG - Intergenic
921536369 1:216353508-216353530 TGGGGATTTTCAGCTTTTGTGGG - Intronic
921622804 1:217344583-217344605 AGGGAAAATCCTGCTTCTGTTGG + Intergenic
922042513 1:221910733-221910755 TGAGCAATTCCACCTTCTGTTGG + Intergenic
923777801 1:236995694-236995716 TGGGAAGTTTCAGCTTCTCATGG + Intergenic
923951137 1:238955673-238955695 TGTGAAGTTTTACCTTCTGTGGG + Intergenic
1063815087 10:9762186-9762208 TGGGAAGTTACATGTTCTCTAGG - Intergenic
1064358106 10:14637987-14638009 TATGATGTTCCAGTTTCTGTGGG - Intronic
1066704711 10:38165271-38165293 TGGAAATTTCCAGGTTCTCTAGG + Intergenic
1067390221 10:45856797-45856819 TGGAAATTTCCAGGTTCTCTAGG - Intergenic
1067501249 10:46807074-46807096 TGGAAATTTCCAGGTTCTCTAGG + Intergenic
1067593327 10:47532845-47532867 TGGAAATTTCCAGGTTCTCTAGG - Intronic
1067640439 10:48040955-48040977 TGGAAATTTCCAGGTTCTCTAGG - Intergenic
1067873056 10:49979270-49979292 TGGAAATTTCCAGGTTCTCTAGG + Intergenic
1069683763 10:70303418-70303440 TGGGAAGTTCCAGACTATATTGG + Intronic
1071404790 10:85319433-85319455 TAGAAAGTCCCAGCTGCTGTTGG - Intergenic
1072659939 10:97357509-97357531 TGTAAAGTTCTAGCTTCTGCGGG - Intronic
1072797329 10:98365990-98366012 TGGGAAGTTCCGGCTTCGTCAGG - Intergenic
1075080570 10:119380926-119380948 TGGTAAGTTCCTGCTCCTGAGGG + Exonic
1075083834 10:119400951-119400973 TGGGAAGGTCCACCTGCTCTCGG + Intronic
1076620685 10:131785436-131785458 TGGGCAGTTTCTGCTGCTGTAGG - Intergenic
1078375424 11:10789555-10789577 GGGAAAGTTCCAGATTCTGTAGG - Intergenic
1079426164 11:20343576-20343598 TGGTCAGTTCCCTCTTCTGTAGG - Intergenic
1080574725 11:33587824-33587846 TGGGAAGTCTTAGCTGCTGTTGG + Intronic
1081646550 11:44794277-44794299 TGTGAAGCTCCAGGTTCTTTTGG - Intronic
1083792834 11:64996940-64996962 TGGGAAGTCACAGCTGCTGAGGG - Exonic
1087202339 11:95358655-95358677 TGGGAAGTTTCAGCAGCTGTTGG + Intergenic
1088882426 11:113982404-113982426 TGGGAAATCCCAGTTTCTGCTGG + Intronic
1089254468 11:117187000-117187022 TGGTAAGCTCCAGGTGCTGTGGG + Intronic
1089698071 11:120227905-120227927 TGGGAGGGGCCAGCTTCTGGAGG - Intronic
1090501102 11:127262320-127262342 GGGGAACTTCCAGGATCTGTTGG - Intergenic
1091030599 11:132184183-132184205 GGGAAAGTTCCCTCTTCTGTGGG - Intronic
1094347785 12:29489730-29489752 TGGGAAGTTCCATTTCTTGTAGG + Exonic
1095354855 12:41260352-41260374 TGAGAAGTGCCATCTTTTGTGGG + Intronic
1095601244 12:44015568-44015590 TGGCAAGTTCTAGCTCCTATAGG - Intronic
1097915913 12:65020122-65020144 TGGAAAGGTCCAGCTGCTCTTGG + Intergenic
1098105798 12:67068747-67068769 GGGGAAACTCCAGCTTCTGCAGG - Intergenic
1099103048 12:78466529-78466551 TGGAAAGTGCCAACTTCAGTCGG - Intergenic
1101058274 12:100942978-100943000 TTGTAAGTTCCAGCTGCTTTTGG - Intronic
1104172281 12:126293438-126293460 TGGGAAAAGCCAGGTTCTGTAGG + Intergenic
1104210057 12:126680137-126680159 TGGGACGCTCCAGGTTCTGGAGG - Intergenic
1107277052 13:38689198-38689220 TGAGAAGTTCCTGCTTCTCATGG - Exonic
1109439626 13:62352396-62352418 TGGGAAAATGCAGCTGCTGTTGG - Intergenic
1111200441 13:84928387-84928409 TGGGAAGGTCTCTCTTCTGTAGG - Intergenic
1113616065 13:111681453-111681475 TGGGAAGTCTCTGCTTCTGATGG + Intergenic
1113621533 13:111766346-111766368 TGGGAAGTCTCTGCTTCTGATGG + Intergenic
1114825970 14:26080269-26080291 TGGGAACTTACAGTTTCTGTTGG - Intergenic
1118371096 14:65137725-65137747 TGGCCACTTCCAGCTTATGTGGG + Intergenic
1123777176 15:23591260-23591282 TGGGAAGTAGCAGCTTATCTTGG - Intronic
1125284166 15:38073969-38073991 TGGGATGAACCAGCTTCTTTTGG - Intergenic
1125378418 15:39059487-39059509 TGGGCATATCAAGCTTCTGTGGG + Intergenic
1130910858 15:88269956-88269978 TGGGCAGCTCCAGGTGCTGTGGG - Intergenic
1131594339 15:93781659-93781681 TGGGAAGGACCAGCATCAGTTGG + Intergenic
1135972627 16:27083745-27083767 TGGAAAGAACCAGCTTTTGTTGG - Intergenic
1135973495 16:27089480-27089502 TGGAAAGAACCAGCTTTTGTTGG - Intergenic
1136029207 16:27490469-27490491 AGTAAAGTTCCAGCTGCTGTGGG - Intronic
1136713378 16:32258245-32258267 TGGCAATTTCCAGCATCTGCAGG + Intergenic
1136754533 16:32671186-32671208 TGGCAATTTCCAGCATCTGCAGG - Intergenic
1136813579 16:33199178-33199200 TGGCAATTTCCAGCATCTGCAGG + Intronic
1136820055 16:33309258-33309280 TGGCAATTTCCAGCATCTGCAGG + Intergenic
1136826619 16:33365798-33365820 TGGCAATTTCCAGCATCTGCAGG + Intergenic
1136831685 16:33464569-33464591 TGGCAATTTCCAGCATCTGCAGG + Intergenic
1138267152 16:55667812-55667834 TGGAATGTTCCAGAATCTGTGGG + Intronic
1138736794 16:59260197-59260219 TGGGAAGTTCCTCCTGCTGATGG - Intergenic
1140078200 16:71721702-71721724 TAGGAAGTTACAGCTAATGTCGG - Intronic
1141639491 16:85333155-85333177 TGGGCAGGCCCAGCGTCTGTAGG + Intergenic
1141889364 16:86916448-86916470 TGGGCAGGTCCAGCATCTGCAGG + Intergenic
1142179305 16:88659598-88659620 TTGGCAGTTCCAGCTTCTGCAGG - Intronic
1202992156 16_KI270728v1_random:22153-22175 TGGCAATTTCCAGCATCTGCAGG + Intergenic
1203056680 16_KI270728v1_random:931517-931539 TGGCAATTTCCAGCATCTGCAGG - Intergenic
1143252169 17:5531624-5531646 CGGGATGCCCCAGCTTCTGTAGG + Intronic
1143328283 17:6115957-6115979 TGGGAAGTTTCTGCTTCTCTAGG - Intronic
1146747408 17:35344632-35344654 TGGAATGTTCCAGCCTTTGTTGG - Intergenic
1146815125 17:35936401-35936423 TGGCAGGTTTCAGCTTCTCTTGG - Intronic
1147977107 17:44254325-44254347 GGGGCAGTTCCAGGTTTTGTGGG - Intronic
1148114080 17:45164712-45164734 TGGGAAGTGCCATCCTCTGAGGG - Intronic
1150648180 17:66992870-66992892 AGGGCAGATCCAGATTCTGTTGG - Intronic
1150984615 17:70181791-70181813 TGGGAAGCTGCTGCTTCTGAAGG - Intergenic
1151289727 17:73141007-73141029 GGGGCAGTGCCAGCTTCTGAGGG + Intergenic
1151561475 17:74872206-74872228 TGGGAAGTTCCAGCTTCTGTTGG - Intronic
1153042507 18:827247-827269 TGAGAAGTCCCAGCATCTGTAGG + Intergenic
1160005309 18:75064504-75064526 TGGGAAGGTCCAGCTTCGGTGGG + Exonic
1161830018 19:6596040-6596062 TGGGAAGGTCCAGGTTCTTCAGG - Intronic
1161953733 19:7481684-7481706 TTGGATTTTCCAGCTTCTGGAGG - Intronic
1163935455 19:20438622-20438644 TGGTCAGGTCCATCTTCTGTAGG + Intergenic
1165634566 19:37329803-37329825 TGGGAGGTTCCAGCTTTTCCTGG + Intronic
1167044617 19:47042412-47042434 TGGGAAGTGCCAGACTCTATGGG + Intronic
1167306920 19:48714829-48714851 TCTGAAGTTCCAACTTGTGTGGG + Exonic
1168150627 19:54445955-54445977 TGGGAGGTTGAAGCTGCTGTGGG + Intergenic
925741349 2:7008283-7008305 CGGGAACGTCCAGCTTCTGGTGG + Intronic
926239819 2:11076926-11076948 AAGGAAGTGCCAGCTTCTCTGGG - Intergenic
926464493 2:13170196-13170218 TGAGAAGTTCTATATTCTGTGGG - Intergenic
927243595 2:20939322-20939344 TGGGAAGTTCTACTTTCTATTGG - Intergenic
928347609 2:30515868-30515890 TGGGAGTTGCCAGCTTCTGCTGG - Intronic
929920559 2:46168400-46168422 TGTCAAGTTCCAGCTCCTCTAGG - Intronic
932448430 2:71794734-71794756 TGGGAAGGCCCAGCTTCTGCTGG - Intergenic
933454171 2:82500204-82500226 TGGGAAGTTGAGGCTTCAGTGGG + Intergenic
933760097 2:85666967-85666989 TGGGAAGTCCCAGCTCCTCCTGG - Intronic
939623744 2:144451182-144451204 TGGGAACTAACAGCTTCTATAGG - Intronic
940237747 2:151529156-151529178 GGGGATTTACCAGCTTCTGTAGG - Intronic
940721299 2:157285335-157285357 GGGGCAGGTCCAGATTCTGTGGG + Intronic
940762898 2:157757333-157757355 TGGGAAATTTCAGCTTTTTTTGG - Intronic
941065536 2:160898674-160898696 GGGTAAATTTCAGCTTCTGTTGG + Intergenic
942507886 2:176662910-176662932 TGAGAACATCCAGCTGCTGTTGG - Intergenic
943794138 2:191970526-191970548 TGGGCTGTTCCAGCTTTTGGTGG - Intronic
945437800 2:209839405-209839427 TGGGGAGTTTAAGCTTCTTTCGG - Exonic
947123852 2:226846416-226846438 TGAAAACTTCCAGCTTTTGTAGG + Intronic
947530272 2:230904754-230904776 TGGGAAGTCCTATTTTCTGTGGG + Intergenic
948831696 2:240601446-240601468 TGGGAGGTTCCAGATGCAGTTGG + Intronic
1169980700 20:11380418-11380440 TGGTCAGTTCCCTCTTCTGTAGG - Intergenic
1170569525 20:17625055-17625077 TGGGAAGCTGCAGCCTCTGCAGG + Intronic
1173248530 20:41352366-41352388 TGGGAAGGTCCAGCCCCTGCTGG - Intronic
1175595963 20:60233098-60233120 TGGGCAATGTCAGCTTCTGTAGG + Intergenic
1175802116 20:61806823-61806845 TGGGAAGTGTCAGCATCTGGGGG + Intronic
1175961036 20:62636462-62636484 TGGGCACTCCCAGCGTCTGTGGG - Intergenic
1177423961 21:20898515-20898537 TCTGTTGTTCCAGCTTCTGTTGG - Intergenic
1179520187 21:41938495-41938517 TGGGAAGATGCAGGTTCTGGAGG - Intronic
1181505223 22:23351520-23351542 TGGGAAGTGTTATCTTCTGTTGG + Intergenic
1181710541 22:24683861-24683883 TGGGAAGTGTTATCTTCTGTTGG + Intergenic
1182242899 22:28931389-28931411 TGGGAGATTCTAGCTTCTTTGGG - Intronic
1183371253 22:37433705-37433727 TCGGCAGATCCCGCTTCTGTTGG - Intergenic
1184785159 22:46668125-46668147 TGAGAAGTTCCAGCTGGTGCTGG + Exonic
1185158879 22:49210697-49210719 AGGGGAGTTCCTGCTTCTCTGGG + Intergenic
952429717 3:33211269-33211291 TAGAAAGGTCCATCTTCTGTAGG - Intronic
953047237 3:39304820-39304842 TGGGATGCTCCAGCTTCTTTGGG + Intergenic
954866234 3:53732302-53732324 AGGGCAGTCCCAGCTTCTGCTGG + Intronic
958853385 3:99355533-99355555 TTGGAAGTACCAGGCTCTGTTGG - Intergenic
959336516 3:105072248-105072270 AAGGAACTTCCAGCTTTTGTTGG - Intergenic
960140081 3:114143082-114143104 GGGGAAGTGTCAGCTTCTGGGGG - Intronic
960339208 3:116455148-116455170 TGGTAAGTTCCAACGTCTGAAGG + Intronic
960721539 3:120628863-120628885 TGGGAATATCCATCTTCTGAGGG + Intronic
960773154 3:121217030-121217052 TGGGAAGTGCCAGCTTGGTTGGG - Intronic
961472025 3:127121380-127121402 TGAGACTGTCCAGCTTCTGTGGG + Intergenic
963624080 3:147648875-147648897 TAACAACTTCCAGCTTCTGTGGG + Intergenic
964535870 3:157720518-157720540 TAGGAAGTTTCTCCTTCTGTAGG + Intergenic
965664568 3:171079076-171079098 TGGGCCTTTCCAGGTTCTGTTGG + Intronic
967507729 3:190271885-190271907 TGGACATTTCCAACTTCTGTGGG - Intergenic
968871387 4:3244464-3244486 TGGGATGTGCCAGCTGCTTTGGG - Intronic
974045243 4:56892917-56892939 GGGGTGGTTCCAGCATCTGTTGG + Intergenic
976223237 4:82774992-82775014 TGGCATGTTCCAGATTCTCTAGG + Intronic
979596426 4:122539939-122539961 TGTGAATATCCAGCTTTTGTAGG - Intergenic
982318634 4:154057414-154057436 TGGCAAGTACCACCTCCTGTGGG + Intergenic
982383100 4:154770795-154770817 TGGGACATTCCAGCATCTGCAGG - Intergenic
983113702 4:163785382-163785404 TGTGAACTACCAGCTTCTTTAGG - Intronic
985227323 4:187775878-187775900 TGGGAAGTTCCAGGGTCCTTTGG + Intergenic
985639459 5:1056912-1056934 TGGGTAGTTCAGGCTGCTGTCGG - Intronic
986176885 5:5360066-5360088 GGGGAAGATCCAGGTTTTGTGGG - Intergenic
987078757 5:14407461-14407483 TGAGAAAGTCCAGCTTCTCTGGG + Intronic
987381917 5:17293453-17293475 TGTTAAATTGCAGCTTCTGTAGG + Intergenic
991503570 5:67301703-67301725 TGGACAGTTCCAGATTCTGGGGG + Intergenic
993311105 5:86333064-86333086 TGGCAAGTTTCATCTTATGTTGG + Intergenic
993761711 5:91803322-91803344 TGTGCAGTTGCAGCATCTGTGGG + Intergenic
995273367 5:110248787-110248809 TGTCAAGTTCCACCTTCTCTAGG + Intergenic
999142046 5:149368687-149368709 TGGGATGATCCATCTTCAGTGGG - Exonic
999500066 5:152137971-152137993 TTGGAAGTTCTAGCTCCTGTTGG + Intergenic
999779122 5:154835069-154835091 TGGCCTTTTCCAGCTTCTGTGGG + Intronic
1002633248 5:180594641-180594663 TGGGAAGGCCCAGCCTCTGGAGG - Intergenic
1004066811 6:12254413-12254435 GGGGAAGTTCAAGGTTCTATTGG - Intergenic
1004160034 6:13204915-13204937 TGGGAAGTTCCAGCTTTGAAAGG + Intronic
1004191827 6:13470870-13470892 TGCTAAGTTCCAGCTTGTGGGGG - Intronic
1004264221 6:14134834-14134856 TGGAAAATGCCTGCTTCTGTGGG + Intronic
1006065863 6:31462334-31462356 TGGAAAGTTCCAGTATCTGAGGG + Intergenic
1008886540 6:56437254-56437276 TGGGAAGGTCTTGCTTCTTTCGG - Intergenic
1013754219 6:113441880-113441902 TGGGAAGCACCAGCTTTTGTAGG + Intergenic
1013959515 6:115882355-115882377 TGGGAATTTATATCTTCTGTGGG - Intergenic
1014674715 6:124349297-124349319 CGGGAAGTTCCCGCCTTTGTAGG - Intronic
1016049897 6:139519826-139519848 TGGTAAGTTGAAGTTTCTGTGGG - Intergenic
1016253533 6:142075984-142076006 TGGGCTGTTTCATCTTCTGTTGG - Exonic
1016964564 6:149706750-149706772 TTGCCACTTCCAGCTTCTGTTGG - Intronic
1019783557 7:2959111-2959133 TGGGAAATTACAGCGTGTGTGGG - Intronic
1021597350 7:22331366-22331388 TAGAAAGATCGAGCTTCTGTGGG - Intronic
1023659915 7:42460748-42460770 TGGGAAGTCTCTCCTTCTGTGGG + Intergenic
1024628113 7:51225737-51225759 TGGGAGCTTCCAGCTGATGTGGG - Intronic
1024683057 7:51714102-51714124 TGAAAAGTCCCAGGTTCTGTGGG - Intergenic
1024965092 7:55017754-55017776 AGGGAAGTTCCAGGTTGTGCGGG + Intergenic
1025700673 7:63816857-63816879 TGGCCTCTTCCAGCTTCTGTGGG + Intergenic
1026840953 7:73669658-73669680 TGGGAAGTGCCAGGCTCTGATGG + Intronic
1028213715 7:88106351-88106373 TGAGAGTTACCAGCTTCTGTGGG + Intronic
1029112790 7:98222279-98222301 GGGGAAGTCCCAGCTTCTGGGGG + Intronic
1029736316 7:102467791-102467813 TGGGCAGCTCCAGCTTCTGGGGG - Exonic
1032709345 7:134448623-134448645 TAGGAAGTTACAGCTTATCTGGG - Intronic
1032920024 7:136534678-136534700 TGGGCAGGTCCCCCTTCTGTAGG - Intergenic
1033534425 7:142298888-142298910 TGGGAAGTCTCTGCTCCTGTTGG - Intergenic
1036660653 8:10706313-10706335 GGTGAATTTCCAGATTCTGTTGG - Intronic
1037050770 8:14370906-14370928 TGTGAAATTCCACATTCTGTGGG - Intronic
1038354987 8:26820731-26820753 TGGGAAAATGCAGCTTCTATAGG + Intronic
1038832118 8:31073282-31073304 TGAGAAGTCGTAGCTTCTGTAGG + Intronic
1039004286 8:33016606-33016628 TGGCCAGTTCGAGCTTCTCTGGG - Intergenic
1043348642 8:79331236-79331258 AGAGAAGTTCCAGCTTATGAGGG - Intergenic
1044670753 8:94678250-94678272 TGGTAAATGGCAGCTTCTGTAGG - Exonic
1049284994 8:141769844-141769866 TGGGAAGTGCTGGCTTCTGGGGG + Intergenic
1051243056 9:15080526-15080548 TGGGCTGTTCCTGCTTCTCTTGG + Intergenic
1052369350 9:27646072-27646094 TGGTAAGGTCCCTCTTCTGTAGG - Intergenic
1056129466 9:83569463-83569485 TGGCAAGTCCCCGTTTCTGTGGG - Intergenic
1056999827 9:91497375-91497397 CTGGAATTTCCAGCTCCTGTGGG + Intergenic
1057082299 9:92181884-92181906 TTGGCTGTTCCAGCTTCTGGCGG + Intergenic
1057204223 9:93161312-93161334 TGTGAGGTTCCAGCTTCTGCAGG - Intergenic
1060014123 9:120071583-120071605 TGGGAAGGTCAAGCATCTCTGGG + Intergenic
1060500512 9:124150139-124150161 TGGGAAGTGGCAGGCTCTGTAGG + Intergenic
1186710850 X:12194840-12194862 TGGGAAGTTCCATTTCATGTTGG - Intronic
1187597086 X:20784937-20784959 TGGAAGTTTCCAGCTTCTGTAGG - Intergenic
1188386087 X:29560522-29560544 TGGGAAGCTCTAAATTCTGTAGG + Intronic
1189568964 X:42274657-42274679 TGGGAAGTACAAGCTTTTCTAGG + Intergenic
1191169769 X:57431516-57431538 TGTAAAGTTCTAGCTTCTCTGGG - Intronic
1192087168 X:68111870-68111892 TCAGAAGTTCCAGCATCTCTCGG + Exonic
1193974055 X:88095802-88095824 AAGGAAGTGCCAGCTTCTCTGGG - Intergenic
1196496422 X:116329222-116329244 TGGGAATTTTCAGCTTCAGGTGG - Intergenic
1196783145 X:119400231-119400253 GGGGAAGCTGCAGCCTCTGTCGG - Intronic
1197049453 X:122041955-122041977 TGGTAAGGTCCCTCTTCTGTAGG + Intergenic
1202059270 Y:20868857-20868879 TGAAAATTTCCAGCTTCTCTAGG + Intergenic