ID: 1151562408

View in Genome Browser
Species Human (GRCh38)
Location 17:74877781-74877803
Sequence CTTTGGCTGAGGATCGAGGA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 1, 2: 1, 3: 12, 4: 138}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151562403_1151562408 -3 Left 1151562403 17:74877761-74877783 CCAGTGTCTTGCACAGGTTCCTT 0: 1
1: 0
2: 0
3: 15
4: 203
Right 1151562408 17:74877781-74877803 CTTTGGCTGAGGATCGAGGAAGG 0: 1
1: 1
2: 1
3: 12
4: 138
1151562401_1151562408 14 Left 1151562401 17:74877744-74877766 CCTGGGGAACTGCTGAGCCAGTG 0: 1
1: 0
2: 3
3: 23
4: 216
Right 1151562408 17:74877781-74877803 CTTTGGCTGAGGATCGAGGAAGG 0: 1
1: 1
2: 1
3: 12
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151562408 Original CRISPR CTTTGGCTGAGGATCGAGGA AGG Exonic
902644989 1:17791711-17791733 ATTTGCCTGTGGAACGAGGAGGG + Intronic
907358083 1:53892806-53892828 CTCTGGCTGAGGTGAGAGGATGG + Intronic
912756615 1:112329623-112329645 CGGTGGCTGAGGATAGGGGAGGG + Intergenic
912939300 1:114030897-114030919 CTTTTCCTGATGATTGAGGACGG - Intergenic
916059353 1:161088188-161088210 CTTTGGCTGGAGATGGAGGTAGG + Intronic
917795999 1:178533251-178533273 CTTTGGCTGAGGCTTGAGGCAGG - Intronic
918209735 1:182340129-182340151 CTTTGGCTGAAGATCACAGAAGG - Intergenic
919725593 1:200880838-200880860 CTTGGGCTGAGGCAGGAGGATGG - Intergenic
920514450 1:206574392-206574414 CTATGGGTGAGGATCGTGAAAGG - Intronic
922361781 1:224829280-224829302 ATTTGGCCCAGGATCTAGGATGG + Intergenic
1063448253 10:6133883-6133905 CTTCGGATGAGGATGGAGGCGGG + Intergenic
1064276812 10:13913897-13913919 CTGTAGCTCAGGATAGAGGACGG + Intronic
1065122453 10:22542928-22542950 CTTGGGCTCAGGGTCCAGGAAGG + Intronic
1068737710 10:60432953-60432975 CTTTGGCTGAGGATGGAAAAAGG - Intronic
1069332663 10:67311460-67311482 CTGTGGCTGGGGATTGAGAAGGG + Intronic
1070144360 10:73763094-73763116 CTTGGGGAGAGGATCGGGGAAGG + Intronic
1071937430 10:90547275-90547297 CTTTGGCTTAATATAGAGGAAGG + Intergenic
1073381705 10:103082757-103082779 TTTTGGATGAGGATGGAGGCAGG + Exonic
1076896092 10:133312982-133313004 CATTTGCTGAGGAACAAGGATGG - Exonic
1077240759 11:1509223-1509245 CTCTGGCTGAGGCCCGAGGCTGG - Intergenic
1079357823 11:19744457-19744479 ACATGGCTGAGGATGGAGGAAGG + Intronic
1081549933 11:44101550-44101572 TTTTGGCAGAGTATTGAGGAAGG + Intronic
1082183795 11:49154370-49154392 CTGTGGCCCAGGTTCGAGGAGGG - Exonic
1083335355 11:61918624-61918646 CGTTGGTGGAGGATGGAGGATGG + Intronic
1086682564 11:89690982-89691004 CTGTGGCCCAGGTTCGAGGAGGG + Intergenic
1090073606 11:123564747-123564769 CTCTTGCTGAGGATGGGGGAGGG + Intronic
1090168953 11:124581404-124581426 CCTTGGCTCTGGATGGAGGAGGG + Intergenic
1092797260 12:12124632-12124654 CTGTGGCTGGGGATGGTGGAGGG + Exonic
1096906847 12:54944076-54944098 CTTTTCCTGAAGATTGAGGATGG + Intergenic
1097143924 12:56926509-56926531 CTGTGGGTGATGATTGAGGAGGG - Intronic
1097188671 12:57209248-57209270 CTTTGGCTCAGTAGGGAGGATGG - Intronic
1097592774 12:61591900-61591922 CTTTTCCTGAAGATTGAGGATGG - Intergenic
1097933109 12:65212571-65212593 AATTGGCTGAGGATTGAGGAGGG + Intronic
1098653461 12:73003034-73003056 CTTTTCCTGATGATTGAGGATGG + Intergenic
1099610040 12:84856999-84857021 CTCTGACTGAGGAAAGAGGAGGG - Intergenic
1101211501 12:102539373-102539395 CTCTGGCTGGGGATGGAGAATGG + Intergenic
1102745623 12:115246527-115246549 CTTTGTCTGGGGAACTAGGATGG - Intergenic
1104426775 12:128684460-128684482 CTTTGGCTGAGGAGACAGGCAGG - Intronic
1107873163 13:44765223-44765245 CATTGGGTAAGGATAGAGGAAGG - Intergenic
1112050221 13:95637976-95637998 TTTTCTCTGAGAATCGAGGAAGG + Intronic
1112299526 13:98217556-98217578 CTTTGCCTGAGGATCAAGTGTGG + Intronic
1112374008 13:98821722-98821744 CTTCGGCTCAGAATCAAGGAAGG + Intronic
1112494316 13:99893592-99893614 CTTTGGATTAGGCTGGAGGATGG - Exonic
1116902973 14:50379230-50379252 CCTTGGCAGAGTATTGAGGAAGG + Intronic
1117619407 14:57569196-57569218 CTCTGGCTGAGAATGGAGAATGG - Intronic
1118313106 14:64707144-64707166 CTTCTGCTGAGGAGGGAGGATGG - Intronic
1119701967 14:76761741-76761763 CCCTGGCTGAGGGTGGAGGAAGG - Intergenic
1122566649 14:102662654-102662676 CTTTGGCTTCGGCTTGAGGAGGG + Intronic
1122882145 14:104694990-104695012 CTTTTTCTGAGGACAGAGGAGGG + Intronic
1124192683 15:27594245-27594267 CTTTCCCTGAGGATGGTGGAAGG + Intergenic
1129888949 15:79058365-79058387 CTTCGGCAGCAGATCGAGGATGG - Exonic
1130989778 15:88869471-88869493 CTTGGGGTGAGGATGGAGGGTGG - Intronic
1131869357 15:96745607-96745629 CTGTGGCTGAGGATCCAGCATGG - Intergenic
1132634332 16:936100-936122 CGTTGGCTGAGGAAGGAGGCTGG + Intronic
1138548095 16:57731262-57731284 CTCTGGCTGAGGCCCCAGGAGGG - Exonic
1138958821 16:62005266-62005288 CTTTTGCTAATGTTCGAGGAAGG - Intronic
1140756396 16:78071401-78071423 CTTTGCCTGAGGAGCCAAGAGGG + Intergenic
1142127046 16:88415375-88415397 GTCTGGCTGAGGTTTGAGGAGGG - Intergenic
1144031453 17:11326774-11326796 CTTAGGCTGAGGATATAGGCAGG + Intronic
1146617562 17:34369168-34369190 CTTTTGCTCAGGACAGAGGATGG + Intergenic
1146725976 17:35156177-35156199 GTTTGGCAGAGGATGGAAGAGGG + Intronic
1149220947 17:54414760-54414782 CCTTTCCTGAGGATTGAGGACGG - Intergenic
1149320106 17:55473577-55473599 CCTTTCCTGAGGATTGAGGACGG - Intergenic
1150580471 17:66469171-66469193 CTCTGGCTGGGGGTAGAGGAGGG - Intronic
1151562408 17:74877781-74877803 CTTTGGCTGAGGATCGAGGAAGG + Exonic
1152320987 17:79608832-79608854 CTTTGGCCGAGGACCGAGGCTGG - Intergenic
1152676247 17:81642701-81642723 CTTTGGCTCAGGGTGCAGGAGGG + Intronic
1154133582 18:11757389-11757411 CTCTGGCTGTGGATGGAGAACGG + Intronic
1156581285 18:38379508-38379530 GTTTGCCTGAGGATGGAGGTCGG + Intergenic
1163130204 19:15267669-15267691 CTTTGGGTGCAGATCGGGGAAGG - Intronic
1165258777 19:34596246-34596268 CTGTGGCTGAGCAGGGAGGATGG + Exonic
1168187813 19:54710656-54710678 CTTAGGCTGAGGGTAGAAGATGG + Intergenic
926992065 2:18690583-18690605 CTCTGGCTGAGGATGCAGAATGG - Intergenic
932664554 2:73686382-73686404 CCTTGGCTGAGGCTAGATGAGGG + Intergenic
934925437 2:98379053-98379075 CATTGTCTGAGGCTGGAGGAGGG + Intronic
937114700 2:119397026-119397048 CTTGGGCTGAGTACGGAGGAAGG + Intergenic
937839408 2:126510829-126510851 CTGTGACTGAGGAAAGAGGAAGG - Intergenic
940148083 2:150568666-150568688 ATATGGCAGAGGATTGAGGATGG - Intergenic
940183369 2:150958084-150958106 CTTTTCCTGAAGATTGAGGATGG - Intergenic
940458204 2:153929105-153929127 TTTTGTCTTAGGATCCAGGAGGG - Intronic
940735360 2:157444905-157444927 CTTTGGCTGAGGTTGGGGGCAGG + Intronic
945249740 2:207754740-207754762 GTGTGGCTGAGGCTAGAGGATGG - Exonic
945837407 2:214849311-214849333 CCTTGGCAGAGTATTGAGGAAGG - Intergenic
948046705 2:234951506-234951528 CCTTGGCTGAGGACAGTGGAGGG - Intergenic
1169042827 20:2509634-2509656 CTGAGGCTGAGGCTGGAGGATGG + Intronic
1169369130 20:5015203-5015225 CTTTGGCTGGGGAGGGAGAATGG + Intergenic
1169506053 20:6213029-6213051 CAATGGGTGAGGAGCGAGGAAGG + Intergenic
1172964295 20:38823076-38823098 CTTTGGCTGGAGATCAAAGAGGG + Intronic
1173569286 20:44066348-44066370 CTAGGGCTGAGGATGCAGGAAGG - Intronic
1174308988 20:49635766-49635788 CTTTGGGTGGGGATTGAGGGTGG - Exonic
1175137639 20:56836784-56836806 CTTTTGCAGAGGGTCGAGCATGG + Intergenic
1175623509 20:60470695-60470717 CTTTGGCTCAGGACTCAGGATGG - Intergenic
949655998 3:6220498-6220520 CTTTGGCTTAGAAATGAGGAAGG + Intergenic
957176209 3:76813256-76813278 CTTTGGCTAAAGATCAATGAAGG - Intronic
957904393 3:86538677-86538699 CTTTTTCTGAAGATTGAGGATGG + Intergenic
958879064 3:99648954-99648976 CTTTGGCACAGGATAAAGGAAGG - Intronic
960745938 3:120888687-120888709 CTGTTGCTGAGGATAGATGAGGG + Intergenic
965766139 3:172132169-172132191 CGTTGGTTGAGGATGGAGGAAGG + Intronic
966547875 3:181171273-181171295 GTTTGACTGAGGAACAAGGAGGG + Intergenic
967459406 3:189728079-189728101 CTTTGCCTAAGGATCCAGGATGG + Intronic
967913908 3:194563947-194563969 CTTTGGCTTTGGCTTGAGGAGGG + Intergenic
969451630 4:7277120-7277142 CTTTGGCTGTGTATGGAGGGTGG + Intronic
970529838 4:16970359-16970381 GTTTGCCTGAGGCCCGAGGAGGG + Intergenic
975969354 4:80015088-80015110 CTTTTGCTGAGGTTGTAGGAAGG - Intronic
980268257 4:130548522-130548544 ATTTGGCAGAGAATGGAGGATGG - Intergenic
983519549 4:168693010-168693032 ATTTGGATGAGGAGGGAGGAAGG + Intronic
987265004 5:16244211-16244233 TTTGGGCTGAGGATTGAGAATGG + Intergenic
989188859 5:38650234-38650256 CATTGGATGAGCAACGAGGAAGG + Intergenic
990628043 5:57636313-57636335 CAATGGCTGAGGGTCTAGGATGG + Intergenic
992554011 5:77885621-77885643 CTGTGGCTCAGGACCTAGGAGGG - Intergenic
996118410 5:119644321-119644343 CCTGGGCTGAGGATGGAGGAAGG - Intergenic
996367153 5:122715356-122715378 ATTTGTCTGAGGATCAAGCAAGG + Intergenic
996918060 5:128734367-128734389 CTTTTCCTGAAGATTGAGGACGG - Intronic
998084245 5:139303624-139303646 CTTGGGCTGAGGTGGGAGGATGG + Intronic
999446672 5:151645918-151645940 CTTTGACTAAGGAGAGAGGAAGG + Intergenic
999531751 5:152470671-152470693 CTTTGGTTAAAGATGGAGGAAGG + Intergenic
1000574374 5:162958449-162958471 CTTTGGCAGAGTATGGTGGAGGG + Intergenic
1001916835 5:175568967-175568989 CTTGGGATGGGGATTGAGGAAGG + Intergenic
1003777478 6:9385029-9385051 TTTTGGCTTAGGGTTGAGGAGGG - Intergenic
1004375172 6:15084840-15084862 CATTGGGAGAGGATGGAGGATGG + Intergenic
1004462124 6:15847462-15847484 GTGTGGCTGAGGCTAGAGGATGG + Intergenic
1006088185 6:31611850-31611872 CTTTGGCAGAGGATCGAGGAAGG - Intergenic
1006325237 6:33348688-33348710 CTTTTTCTGAAGATTGAGGATGG - Intergenic
1013102391 6:106997992-106998014 CTCTGGCTGACGTTGGAGGATGG - Intergenic
1015970614 6:138739553-138739575 CTTTGGCAGAATATTGAGGAGGG + Intergenic
1019261532 7:84546-84568 CTCTGGGTGAGGAGTGAGGAAGG - Intergenic
1019578745 7:1749862-1749884 CTTTCACTGAGGAGCGAAGATGG + Intergenic
1019764279 7:2838334-2838356 CTTTGGCTGAGGCAGGAGGATGG + Intronic
1019936030 7:4258578-4258600 CTTTGGCTGAGAAACCAGGCTGG + Intronic
1022301741 7:29108182-29108204 CTTGGCCTGAGGATCAAGGTGGG + Intronic
1023382270 7:39621532-39621554 CATAGGCTGAGGATTGAGGATGG - Intergenic
1029311241 7:99667006-99667028 CTTTAGCTGAGGATGAAGAATGG - Exonic
1030379127 7:108791676-108791698 CTTTAGCAGAGCATAGAGGAAGG - Intergenic
1033012789 7:137640329-137640351 CCTTGGCTGAGTATCAAGAAGGG - Intronic
1035118873 7:156548315-156548337 CTTTGGCTGAGACCCCAGGAGGG + Intergenic
1038659380 8:29483500-29483522 TTTTGGCTGAGGAGGGAGGATGG + Intergenic
1039550803 8:38441451-38441473 CTTTTGCTGGGGAGAGAGGAAGG - Intronic
1045765271 8:105660291-105660313 GTTTGGCTGGGGTTCCAGGAAGG - Intronic
1047123926 8:121938938-121938960 ATTTGCCTGAGGTTCAAGGACGG + Intergenic
1047229592 8:122985143-122985165 CTTTGGTTGAGGATAAAGGGAGG - Intergenic
1048244320 8:132776194-132776216 CTTTGTCTTAGGTTCGAAGAGGG - Intronic
1053474941 9:38375877-38375899 TATTGGTTGAGGATGGAGGATGG - Intergenic
1056379323 9:86042855-86042877 CTTTGTCTCAGAATTGAGGATGG - Intronic
1059250279 9:112881988-112882010 CTGTGGCTGAGGGTTGGGGAGGG + Intronic
1061861418 9:133470425-133470447 GGTTGGCTGTGGATCAAGGAAGG + Exonic
1186518900 X:10188156-10188178 CTTTGGCTGAGGCAGGAGGATGG - Intronic
1187066759 X:15847956-15847978 CTGTGGATAAGGAGCGAGGATGG - Intronic
1187889749 X:23923248-23923270 CTTTGGCTGAGGGACCAGAATGG + Intronic
1188972255 X:36632539-36632561 CTTTGCCTGAGGAAAGGGGAGGG - Intergenic
1192314087 X:70038636-70038658 ATTTGGCTCAGGATGGATGAAGG - Exonic
1199073378 X:143503754-143503776 CTTTTCCTGAAGATTGAGGACGG + Intergenic
1199269394 X:145865049-145865071 CCTGGGCTGAGGATCGAGGAAGG + Intergenic
1199704370 X:150411257-150411279 CTTTGGCTGAGGAAGGGGAACGG - Intronic