ID: 1151562801

View in Genome Browser
Species Human (GRCh38)
Location 17:74879630-74879652
Sequence GGTCCCAGGACACCTGGAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 302
Summary {0: 1, 1: 1, 2: 0, 3: 27, 4: 273}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151562801_1151562806 -6 Left 1151562801 17:74879630-74879652 CCCACTCCAGGTGTCCTGGGACC 0: 1
1: 1
2: 0
3: 27
4: 273
Right 1151562806 17:74879647-74879669 GGGACCTCATGCTACCCAGAGGG 0: 1
1: 0
2: 1
3: 8
4: 92
1151562801_1151562812 23 Left 1151562801 17:74879630-74879652 CCCACTCCAGGTGTCCTGGGACC 0: 1
1: 1
2: 0
3: 27
4: 273
Right 1151562812 17:74879676-74879698 TGTCACCCACCTCCCATGTGGGG 0: 1
1: 0
2: 2
3: 15
4: 191
1151562801_1151562811 22 Left 1151562801 17:74879630-74879652 CCCACTCCAGGTGTCCTGGGACC 0: 1
1: 1
2: 0
3: 27
4: 273
Right 1151562811 17:74879675-74879697 GTGTCACCCACCTCCCATGTGGG 0: 1
1: 0
2: 2
3: 11
4: 130
1151562801_1151562814 25 Left 1151562801 17:74879630-74879652 CCCACTCCAGGTGTCCTGGGACC 0: 1
1: 1
2: 0
3: 27
4: 273
Right 1151562814 17:74879678-74879700 TCACCCACCTCCCATGTGGGGGG 0: 1
1: 0
2: 2
3: 21
4: 256
1151562801_1151562805 -7 Left 1151562801 17:74879630-74879652 CCCACTCCAGGTGTCCTGGGACC 0: 1
1: 1
2: 0
3: 27
4: 273
Right 1151562805 17:74879646-74879668 TGGGACCTCATGCTACCCAGAGG 0: 1
1: 0
2: 1
3: 10
4: 115
1151562801_1151562813 24 Left 1151562801 17:74879630-74879652 CCCACTCCAGGTGTCCTGGGACC 0: 1
1: 1
2: 0
3: 27
4: 273
Right 1151562813 17:74879677-74879699 GTCACCCACCTCCCATGTGGGGG 0: 1
1: 1
2: 1
3: 18
4: 129
1151562801_1151562810 21 Left 1151562801 17:74879630-74879652 CCCACTCCAGGTGTCCTGGGACC 0: 1
1: 1
2: 0
3: 27
4: 273
Right 1151562810 17:74879674-74879696 TGTGTCACCCACCTCCCATGTGG 0: 1
1: 1
2: 1
3: 25
4: 181

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151562801 Original CRISPR GGTCCCAGGACACCTGGAGT GGG (reversed) Intronic
900158696 1:1213439-1213461 CGGCCCAGGCCACGTGGAGTCGG - Intronic
900532243 1:3160325-3160347 GGACCCAGCACACCAGGTGTGGG - Intronic
900945215 1:5827433-5827455 GGTTCCATGGCACCTGCAGTTGG - Intergenic
901040615 1:6360805-6360827 GGGCCTAGCACACCTGGACTGGG - Intronic
901530749 1:9851059-9851081 GGCCCCAGGTGACCTGGAGCAGG + Intronic
904488038 1:30840534-30840556 GGGCCCAGGGCACATGAAGTAGG - Intergenic
904732660 1:32606628-32606650 GCTCTCAGGAGACCTGAAGTGGG + Intronic
904821274 1:33246252-33246274 GGTCCCAGCCACCCTGGAGTTGG - Intergenic
906082355 1:43101706-43101728 GCTCACAGGACACCTGCAGGGGG + Intergenic
906572918 1:46860024-46860046 GGTCACAGGAGCCCTGGAATAGG - Intergenic
909491547 1:76232385-76232407 GGACCCAGCAGCCCTGGAGTGGG - Intronic
910624272 1:89289947-89289969 GCTCCCAGGAGAAGTGGAGTAGG - Intergenic
911101893 1:94101892-94101914 GGACCCAGTTCACCTGGAGTGGG + Intronic
912441044 1:109698427-109698449 GGTCCCAGGATAGGTGGAGATGG - Intronic
919336687 1:196244662-196244684 GGTGCCAGGCCAGCTGCAGTAGG + Intronic
919797667 1:201331171-201331193 GGTCCCAGGAGACTTGGACGGGG + Exonic
920006106 1:202835004-202835026 GCTCCCAGGGCACCTTGAGTTGG + Intergenic
920192000 1:204199680-204199702 GGGCCCAGGACACCCGGGGCAGG - Intronic
921674649 1:217964790-217964812 GCTCTCAGGAGACCTGAAGTGGG + Intergenic
921766891 1:218983105-218983127 GCTCTCAGGAGACCTGAAGTGGG + Intergenic
923675975 1:236081127-236081149 GGTCTCAGAAAATCTGGAGTGGG + Intergenic
924447341 1:244145520-244145542 GGGGCAGGGACACCTGGAGTGGG - Intergenic
1062964753 10:1598692-1598714 GGCCCCAGGAGAGCTGGCGTGGG + Intronic
1065206330 10:23360954-23360976 GGCACCAGGAAACCTGGATTTGG + Intergenic
1067030242 10:42875018-42875040 GGTGGCCGGACACCTGGAGAAGG + Intergenic
1067100039 10:43328113-43328135 GGTCCCAAGAAGCCTGAAGTCGG - Intergenic
1068130531 10:52889988-52890010 GCTCTCAGGAGACCTGAAGTGGG - Intergenic
1069359695 10:67627349-67627371 GAACCCAGGACAACTAGAGTAGG + Intronic
1070164391 10:73886955-73886977 GCTCCCAGGCCACCTGGAGAAGG - Intergenic
1071726450 10:88202712-88202734 GATCCCAGGACAGCAGGATTCGG + Intergenic
1073845123 10:107545441-107545463 GCTCTCAGGATACCTGAAGTGGG - Intergenic
1075132049 10:119748561-119748583 GCTCTCAGGAGACCTGAAGTGGG + Intronic
1075587644 10:123669104-123669126 GGTCCCAGGGCACTGGGAGCAGG - Intronic
1075725239 10:124607636-124607658 GGCCCCAGGGCACCTGGGGAAGG + Intronic
1077018141 11:406047-406069 GGCCCCCGGACACCTGGGGTGGG + Exonic
1077107213 11:847464-847486 GGTCCCAGAACACCCCGACTGGG + Intronic
1077504537 11:2923991-2924013 GAGCCCAGGTCTCCTGGAGTTGG - Intronic
1079263248 11:18904596-18904618 GGTGCCTGCACACCTGGAATGGG + Intergenic
1079265516 11:18928375-18928397 TGTGCCTGCACACCTGGAGTGGG + Intergenic
1080605863 11:33864533-33864555 GGTCCATGGACATCTGCAGTCGG - Intronic
1081635107 11:44715863-44715885 GGTTCCAGGGCACCTGGGCTTGG - Intergenic
1083982920 11:66188669-66188691 GGTAGCAGGAAACCTGGGGTGGG + Intronic
1085033319 11:73285790-73285812 GGTCCCAGGAGACCTAGTGGTGG - Intronic
1085334182 11:75678597-75678619 GCTCTCAGGAGACCTGCAGTGGG + Intergenic
1085403979 11:76250835-76250857 GCTCTCAGGAGACCTGAAGTAGG - Intergenic
1085530472 11:77189478-77189500 GGTGCCTGGCCTCCTGGAGTGGG + Intronic
1087131418 11:94672308-94672330 GGTCTCAGGAGACATGCAGTGGG - Intergenic
1089507214 11:118971907-118971929 GGTCCCGGGACTGCTGGACTGGG + Exonic
1091224339 11:133948734-133948756 GGTGCCAGGTTACCTGGAGGAGG + Intronic
1091380320 12:53920-53942 GGTCCCAGCTCACAGGGAGTGGG + Intergenic
1092271995 12:7030883-7030905 GCTCTCAGGAGACCTGTAGTGGG + Intronic
1092527067 12:9315809-9315831 GGTCCCAGGACAGCAGGTGCTGG - Intergenic
1092540202 12:9415963-9415985 GGTCCCAGGACAGCAGGTGCTGG + Intergenic
1094512840 12:31106493-31106515 GGTCCCAGGACAGCAGGTGCCGG - Intergenic
1095493522 12:42760903-42760925 GGTCACAGTACTCCTGGGGTGGG + Intergenic
1096355483 12:50937717-50937739 GCTCTCAGGAGACCTGAAGTGGG + Intergenic
1096426713 12:51510083-51510105 GGTACGAGGACAGCTGGAGGAGG + Exonic
1096489902 12:52007579-52007601 GGACCCAGGACACCTGGCCACGG - Intronic
1097360756 12:58655941-58655963 GCTCTCAGGAGACCTGAAGTGGG + Intronic
1099049724 12:77768002-77768024 GCTCTCAGGAGACCTGAAGTGGG + Intergenic
1099557615 12:84129039-84129061 GTTCTCAGGAGACCCGGAGTGGG - Intergenic
1101779196 12:107820737-107820759 GGCCCCAGGACACCAGGTGGGGG - Intergenic
1103900707 12:124302443-124302465 GATCCCAGGAGACCCCGAGTGGG - Intronic
1103915755 12:124374803-124374825 GCTCCCAGGATGCCTGGAGTGGG + Intronic
1106253472 13:28001615-28001637 GCTCTCAGGAGACCTGAAGTGGG + Intergenic
1107867142 13:44713979-44714001 AGTCCCAGGACAGATGGAGGAGG + Intergenic
1109687835 13:65844165-65844187 GTTCTCAGGAGACCTGCAGTGGG - Intergenic
1110439097 13:75507753-75507775 GCTCCCAGGAGACCTAAAGTGGG + Intergenic
1111243775 13:85508604-85508626 GCTCTCAGGAGACCTGAAGTGGG - Intergenic
1111576802 13:90164904-90164926 GGTCACAGGACACCTTTTGTTGG + Intergenic
1112476672 13:99737475-99737497 GAACCCAGCACACCTGGAGTTGG - Intronic
1112565030 13:100545416-100545438 CGTCCCAGGGCCCCTGGAGGAGG + Intronic
1113388522 13:109873510-109873532 GCTCCTGGGACACCTGGAGTGGG + Intergenic
1113503124 13:110793854-110793876 GCTCTTAGGAGACCTGGAGTGGG - Intergenic
1113770453 13:112904801-112904823 GGCCCCAGGTCACCTGGAGACGG - Intronic
1114455271 14:22849726-22849748 GGTGCCAGGAGCCCTGGAGAAGG - Intergenic
1116617312 14:47155158-47155180 GGTCTCAGGAGACCTGAAGTGGG - Intronic
1116961696 14:50973723-50973745 GCTCTCAGGAGACCTGAAGTGGG - Intergenic
1117697864 14:58384589-58384611 GTTCCCTGGAAACTTGGAGTGGG + Intergenic
1118590943 14:67400522-67400544 TGCCCCAGGACCCCTGCAGTTGG - Intronic
1119388846 14:74276555-74276577 GCTGCCAGGACAGCTAGAGTGGG + Intergenic
1119854883 14:77892070-77892092 GGGCACACCACACCTGGAGTTGG - Intronic
1120592352 14:86390853-86390875 GCTCTCAGGAGACCTGAAGTGGG - Intergenic
1121599448 14:95192073-95192095 TGTCCCAGGAGACCTGGCCTAGG - Intronic
1122320426 14:100852099-100852121 GGGGCCAGGCCATCTGGAGTGGG + Intergenic
1122386039 14:101348967-101348989 GCTCCCAGGAGACCTAAAGTGGG + Intergenic
1122967457 14:105137999-105138021 GGTCTTGGGACAGCTGGAGTTGG + Intergenic
1123120408 14:105913788-105913810 ATTCCCAGGACAGCTGGAGCTGG - Intergenic
1202904495 14_GL000194v1_random:60370-60392 GTTCCCAGGCCACCTGCAATAGG - Intergenic
1124621166 15:31274895-31274917 GCTCCCAGAACAGCTGGAGAAGG + Intergenic
1129739766 15:77984629-77984651 AGACCCAGGACACCTGGGGGTGG - Intronic
1130251778 15:82304567-82304589 GGTCCCAGGTCTCCTGCAGGAGG + Intergenic
1130321779 15:82848192-82848214 GGGCCCAGGGCACCTGGGTTCGG + Intronic
1131625844 15:94119628-94119650 GGACCAAGGACACCAGGAGCTGG - Intergenic
1131999196 15:98162682-98162704 GCTCTCAGGAGACCTGGAGTGGG + Intergenic
1132284161 15:100648171-100648193 GGTCCTAGGACACTTTGAGTTGG + Intronic
1132319019 15:100911261-100911283 CGTCCCCGGCCACCTGGACTGGG + Intronic
1132669008 16:1095134-1095156 GCACCCTGCACACCTGGAGTCGG + Intronic
1136067386 16:27768222-27768244 GGGCCCTGGACTCCTGGACTTGG + Intronic
1138489281 16:57366813-57366835 GGTCCCAGGGGCCCTGGAGGTGG + Intergenic
1138925065 16:61581115-61581137 GCTCTCAGGAGACCTGAAGTGGG + Intergenic
1138998261 16:62478394-62478416 GCTCTCAGGAGACCTGAAGTTGG - Intergenic
1139590001 16:67928258-67928280 GGTCCCAGGACCTCTGGTGGAGG + Exonic
1140103540 16:71938778-71938800 GTTTTCAGGAAACCTGGAGTTGG - Intronic
1141982922 16:87561044-87561066 GGGGCCAGGACTCCTGGAGGTGG + Intergenic
1142254977 16:89009338-89009360 GGACCCATGACACCTGGCCTTGG + Intergenic
1144837478 17:18164265-18164287 GGTCCCAGGAGCCCTCGAGAGGG - Intronic
1145986910 17:29053170-29053192 GGACCCAGGACACCCAGAGCAGG - Intronic
1146812891 17:35917855-35917877 GGTCGGAGGTCAGCTGGAGTGGG + Intergenic
1146837785 17:36126122-36126144 GGGACCAGGGCACCTGGAGATGG - Intergenic
1146911602 17:36651809-36651831 GGTCCCTGGCCACCTGGGATAGG + Intergenic
1148229296 17:45921307-45921329 GGTGCCAGGACACCAGGTCTGGG - Intronic
1148772413 17:50075130-50075152 GGTGCAAGGAGACCTGGACTGGG + Intronic
1148929881 17:51120073-51120095 GGCCTGAGGACACCTGGGGTTGG - Intronic
1149169490 17:53792433-53792455 GCTCTCAGGAGACCTGAAGTGGG - Intergenic
1149256833 17:54836663-54836685 GTTCTCAGGAGACCTGGAGTGGG + Intergenic
1149597664 17:57873759-57873781 GGGGCCAGGAGACCTGGGGTTGG - Intronic
1150651881 17:67015887-67015909 TGTTCCTGGAGACCTGGAGTAGG - Intronic
1151554811 17:74841446-74841468 GGTGCCAGGACTCCTGTGGTGGG - Intergenic
1151562801 17:74879630-74879652 GGTCCCAGGACACCTGGAGTGGG - Intronic
1151574295 17:74943940-74943962 GCTAGCTGGACACCTGGAGTTGG - Intronic
1151947389 17:77327166-77327188 GGTCCCAGGAGCCCAGGAGAGGG - Intronic
1152612650 17:81323223-81323245 GGGCCCAGAACACCTGGCCTTGG + Intronic
1153427942 18:4987315-4987337 GCTCTCAGGAAACCTGGAGTGGG + Intergenic
1155225504 18:23726095-23726117 GCTCCCAGGATACTTGGTGTAGG - Intronic
1157684568 18:49631889-49631911 GGTCCCAAGAGATCTGGAGGTGG - Intergenic
1157725528 18:49960836-49960858 GTTCTCAGGGCACATGGAGTAGG - Intronic
1160083537 18:75753552-75753574 GGTCTCAGGAGACCTAAAGTGGG + Intergenic
1160560692 18:79754145-79754167 GGTCCCACGAGACATGGACTAGG + Exonic
1160905325 19:1449363-1449385 GCATCCAGGACACCTGGAGATGG + Intronic
1161394300 19:4037224-4037246 GGTCCCTGGACCCCTGCGGTCGG + Intronic
1162099038 19:8328648-8328670 GGTCCAAGGATTACTGGAGTTGG + Intronic
1162476898 19:10905664-10905686 GGTGCGAGGACAGCTGGAGGTGG + Intronic
1162804740 19:13131458-13131480 GCTGCCAGGACCCCTGAAGTAGG + Intronic
1163155538 19:15438202-15438224 GGTCCCACCACTCCTGGACTGGG + Intronic
1163527999 19:17832887-17832909 GGTGCCAGGGCACCAGGTGTGGG + Exonic
1165936997 19:39395456-39395478 GATCCAAGGACGCCTGGACTGGG + Intronic
1167240117 19:48338657-48338679 GGTCCCTGGACACAGGCAGTCGG - Intronic
1168297729 19:55385667-55385689 GGTCCCAGGACCTCTCGAATTGG + Intronic
925120536 2:1415145-1415167 AGTCCCAGGGCCCCTGGAGCAGG + Intronic
926427400 2:12751620-12751642 GGTTCCTGGAAACCTGGAGAAGG - Intergenic
926808777 2:16737990-16738012 GGTCAAAGTCCACCTGGAGTAGG + Intergenic
927133455 2:20080013-20080035 GGTCCCTTGTCAACTGGAGTAGG + Intergenic
929670225 2:43871587-43871609 GCTTCCTGGACAGCTGGAGTTGG + Intronic
930971147 2:57397362-57397384 GCTCCGAGGAGACCTGCAGTGGG + Intergenic
931619465 2:64195272-64195294 AGCTCCAGGACACCTGGAGATGG + Intergenic
932572377 2:72944905-72944927 GGGCCCAGGACTGCTGGGGTTGG + Exonic
933042632 2:77487885-77487907 GGTCTCAGGAGACCCGAAGTGGG - Intronic
935796301 2:106644652-106644674 GCCCCCAGGACACCTGAAGGAGG + Intergenic
936008939 2:108912465-108912487 GGTCCCAGGACACCCATAGAGGG + Intronic
937296001 2:120810279-120810301 CGGCCCAGCACACCTGGACTGGG - Intronic
939654663 2:144808844-144808866 AGTCCCAGGCTAACTGGAGTGGG - Intergenic
943064147 2:183069466-183069488 GCTCTCAGGAGACCTGAAGTGGG - Intergenic
946199692 2:218064552-218064574 GGTCCGGGGAGAGCTGGAGTTGG + Intronic
946689773 2:222301403-222301425 GGTCCCTGGACACCCGGAGAGGG + Intronic
948399779 2:237675155-237675177 GGTCCCAGAAGGCTTGGAGTGGG - Intronic
948462629 2:238137726-238137748 GGTCGCAGCACACCTGGAAATGG + Intergenic
948680697 2:239632684-239632706 TGTCCCTAGACACCTGGAGTTGG + Intergenic
1168836275 20:879836-879858 GGTCACAGAACACCTGGAGGGGG + Exonic
1169030619 20:2403884-2403906 GGCTCCAGGCCACCTGCAGTGGG - Intronic
1169111959 20:3039953-3039975 GGACCCAGGAGACCTGCAGGAGG + Intergenic
1172310409 20:33913616-33913638 GATACCAGGATAGCTGGAGTGGG - Intergenic
1172464671 20:35147139-35147161 GGTCACAGTTCACCTGTAGTGGG + Exonic
1172786034 20:37469509-37469531 GGTCCCAGGAGAACAGGAGAAGG - Intergenic
1174113222 20:48210480-48210502 TGACCCAGGAACCCTGGAGTGGG - Intergenic
1176273452 20:64248456-64248478 AGGCCCAGGACACCTAGAGCGGG + Intergenic
1176623867 21:9075137-9075159 GTTCCCAGGCCACCTGCAATAGG - Intergenic
1178947416 21:36959729-36959751 GCTCTCAGGAGACCTGAAGTGGG - Intronic
1181857225 22:25790798-25790820 GCTCCCAGGACCCAAGGAGTGGG - Intronic
1181879270 22:25964829-25964851 GGTCGCAGGGCAGCTGGAGAAGG + Intronic
1181911613 22:26242825-26242847 GCTCCCAGTCCTCCTGGAGTTGG + Intronic
1182520116 22:30880402-30880424 GGTCCCAGCACCCCTGGTGCAGG - Intronic
1182761885 22:32728999-32729021 GGGCCCAGGATACGTGGGGTGGG + Intronic
1183347995 22:37318561-37318583 GCTCTCAGGACACTTGGGGTAGG - Intergenic
1183541461 22:38431501-38431523 GGGCTCAGGACACCTGCTGTGGG - Intronic
1185414695 22:50703698-50703720 GGACCCAGGACTCCAGGATTTGG + Intergenic
949226414 3:1700369-1700391 GCTCTCAGGAGACCTGCAGTGGG - Intergenic
949786110 3:7743848-7743870 GGTCTCAAGACACTGGGAGTGGG - Intergenic
949892053 3:8740639-8740661 GGACCTAGGACACCTGGGCTGGG - Intronic
954106496 3:48412394-48412416 GGGCCCTGGACAGCTGGAGCTGG - Intronic
954371637 3:50172086-50172108 GGCCCCAAGGCACCTGGAGGGGG - Intronic
957156531 3:76551360-76551382 GCTCTCAGGAGACCTGAAGTGGG - Intronic
957459359 3:80497146-80497168 GCTCTCAGGAGACCTGAAGTGGG + Intergenic
958019611 3:87980213-87980235 GCTCTCAGGCTACCTGGAGTGGG + Intergenic
959897139 3:111617635-111617657 GCTCTCAGGAGACCTGAAGTGGG - Intronic
960939030 3:122921826-122921848 GGACCCGGGAGACCTGGGGTCGG - Intronic
961140457 3:124551460-124551482 GGTGCCAGCACAGCTGGAGATGG + Intronic
961311435 3:126004382-126004404 GCTCTCAGGAGACCCGGAGTGGG - Intergenic
961584390 3:127910222-127910244 CCTCCCAGGAGACCTGGAGGTGG + Intergenic
961681771 3:128604270-128604292 GGGCTCTGGACACCTGGAGGGGG + Intergenic
962318171 3:134371482-134371504 GGCCCCAGAGCACCTGGAGTGGG + Exonic
964075137 3:152684197-152684219 GCTCTCAGGAGACCTGAAGTGGG + Intergenic
966688898 3:182724229-182724251 GGTGCCAGGACCCAGGGAGTAGG - Intergenic
967916528 3:194582604-194582626 GGTGCCAAGACACCTGTAGGAGG + Intergenic
968479803 4:828055-828077 GCTCCAAGCACACCTGGAGCTGG + Intergenic
969179275 4:5424622-5424644 GCTCTCAGGAGACCTGAAGTGGG - Intronic
969600157 4:8171403-8171425 GGGCCCAGGGCAACAGGAGTGGG - Intergenic
969717643 4:8875767-8875789 GTTCCCAGGACAAGTGGAGGAGG + Intergenic
971092463 4:23361153-23361175 GCTCTCAGGAGACCTGCAGTGGG - Intergenic
971478170 4:27091240-27091262 GGTCCCAGAAGGGCTGGAGTGGG + Intergenic
972680705 4:41304372-41304394 GCTCCCAGGAAGCCCGGAGTTGG + Intergenic
974285091 4:59855539-59855561 GCTCAGAGGACACCTGCAGTGGG + Intergenic
974432619 4:61817552-61817574 GCTCTCAGGAGACCTGAAGTGGG - Intronic
979637832 4:122977790-122977812 GCTCTCAGGAGACCTGAAGTGGG + Intronic
983069673 4:163253893-163253915 GCTCTCAGGAGACCTGGAGTGGG + Intergenic
984763855 4:183384687-183384709 GCTCTCAGGAGACCTGAAGTGGG - Intergenic
985560411 5:583299-583321 TGTCCAAGGGCACCAGGAGTGGG - Intergenic
986719566 5:10551421-10551443 GGTCAGAGGACACCCGGGGTGGG + Intergenic
986897874 5:12392821-12392843 GGTCCCAGGAGACCTGGAGTAGG - Intergenic
987130154 5:14852810-14852832 GAACCCAGGACAGCTTGAGTGGG - Intronic
987920774 5:24277445-24277467 CGTCCCAGTAAACCTGGAGTTGG + Intergenic
988346398 5:30042464-30042486 GTTCTCAGGAGACCTGAAGTGGG - Intergenic
988466894 5:31499998-31500020 GGGCCCAGGAAACCTGAAATGGG + Intronic
989537650 5:42582465-42582487 GTTCTCAGGAGACCTGAAGTGGG - Intronic
990878811 5:60517708-60517730 GCTCCCAGGAGACCTGAAGTGGG - Intronic
991994790 5:72376315-72376337 GGTCCCATCACAGCTGGATTGGG - Intergenic
995328277 5:110917152-110917174 CTTCCCAGGACACGGGGAGTTGG + Intergenic
995927058 5:117386754-117386776 GCTCTCAGGAGACCTGAAGTGGG - Intergenic
997579139 5:135006218-135006240 GGACCCATGACAGCTAGAGTTGG - Intronic
997688951 5:135812685-135812707 GGTCCAAGGGCTCCTGGAGGAGG + Intergenic
1002303895 5:178272505-178272527 GGTCCCAGGAGAGTGGGAGTGGG + Intronic
1002347088 5:178555682-178555704 GGCTCCAGGACACGTGGAGTGGG + Intronic
1002450736 5:179317114-179317136 GGACCCAGGCCACGTGGGGTTGG - Intronic
1003624590 6:7729335-7729357 GCTGCCAGGAAACCTGGAGGCGG - Intronic
1006463766 6:34178902-34178924 GCTCTCAGGAGACCCGGAGTGGG + Intergenic
1007997166 6:46320626-46320648 TGTCCCAGGTCACATGGATTGGG + Intronic
1008351807 6:50499976-50499998 GGTCCCTAGACAGCTGGTGTTGG - Intergenic
1010559690 6:77333858-77333880 GTTCTCAGGAGACCTGAAGTGGG - Intergenic
1011822586 6:91271198-91271220 GCTCTCAGGAGACCTGTAGTGGG + Intergenic
1012709598 6:102582268-102582290 GCTCTCAGGAGACCTGAAGTGGG - Intergenic
1012749490 6:103140037-103140059 GCTCCCAGGAGACCTGAAGTGGG + Intergenic
1012786948 6:103642509-103642531 GCTCCCAGGACAGCTGGGGTTGG + Intergenic
1013285329 6:108676461-108676483 GGTCCCTTGAGACCAGGAGTTGG - Intronic
1014384766 6:120786469-120786491 GCTCTCAGGAGACCTGAAGTGGG - Intergenic
1015658380 6:135545726-135545748 GTTCCCTGTATACCTGGAGTAGG - Intergenic
1017737446 6:157378293-157378315 GGTCTTAGTACACATGGAGTGGG + Intergenic
1018417054 6:163610825-163610847 GTTCCCAGGACACCTAAAATGGG - Intergenic
1018559730 6:165089171-165089193 AGTCCCAGGGCACCAGGAGCAGG - Intergenic
1018720157 6:166566152-166566174 CGTCCCAGGAGCCCGGGAGTAGG - Intronic
1019536459 7:1531874-1531896 GGACGCAGGACACCAGGAGAGGG - Intronic
1019747157 7:2707417-2707439 GGGCCCAGGAAACCCGGAGAGGG - Intronic
1021677715 7:23097739-23097761 GCTCTCAGGAGACCTGAAGTGGG - Intergenic
1022423900 7:30249335-30249357 GGTACCAGGAATGCTGGAGTTGG + Intergenic
1023410426 7:39884525-39884547 GATCCCAGGGCACAGGGAGTGGG - Intergenic
1026391989 7:69911583-69911605 GCTCCCAGGAGACCTCAAGTGGG + Intronic
1028053039 7:86208379-86208401 GCTCTCAGGAAACCTGGAGCGGG + Intergenic
1029852657 7:103480988-103481010 TCTCCCAGGTCACCTGGTGTTGG - Intronic
1032917941 7:136512239-136512261 CGTCCCAGGTCACCAGGACTTGG - Intergenic
1032947343 7:136869452-136869474 GGTGCCAGGGCCCTTGGAGTGGG - Intronic
1033569021 7:142608441-142608463 GGTCCCAGAACACCTGAAACTGG - Intergenic
1034106547 7:148495459-148495481 GGATTCAGGACATCTGGAGTGGG - Intergenic
1034964276 7:155381950-155381972 GCTCCCGGGACGCCTGGAGCTGG - Intergenic
1035074728 7:156169911-156169933 TGTCCCAGGCCACCAGGAGCAGG - Intergenic
1035114102 7:156508151-156508173 GGTACCAGAGCACCTGGAGATGG + Intergenic
1036579003 8:10055055-10055077 GGACCCAGGGCACCTGCAGCGGG + Intronic
1036613144 8:10367116-10367138 GGTCTCAGGACAGATGGAGTGGG - Intronic
1037567918 8:20133241-20133263 TGTCTCAGGAAGCCTGGAGTTGG + Intergenic
1037634649 8:20690893-20690915 GGTCCCAGGAGCCCTGGGTTTGG - Intergenic
1037819723 8:22129879-22129901 AGTCCCAGGACAACTGCAGGGGG + Intronic
1037877568 8:22555393-22555415 GTTCCCAGGACCTCTGGACTGGG - Intronic
1039824370 8:41160624-41160646 AGTCCCAGGAGACTTGGAATTGG + Intergenic
1040598255 8:48860797-48860819 GGTCCCATGGCGACTGGAGTGGG + Intergenic
1043798600 8:84578562-84578584 GCTCTCAGGAGACCTGAAGTGGG + Intronic
1045300684 8:100907902-100907924 GCTCTCAGGAGACCTGAAGTGGG + Intergenic
1045448731 8:102296554-102296576 GGTCTCAGGTCCCCTGTAGTGGG - Intronic
1045741281 8:105362959-105362981 GGTGCTAAGACAGCTGGAGTGGG + Intronic
1045770562 8:105733953-105733975 AGTCACAGGACACCTGGAAGAGG + Intronic
1045888066 8:107123230-107123252 GCTCTCAGGAGACCTGGAGTGGG - Intergenic
1046195772 8:110860978-110861000 GCTCTCAGGAGACCTGAAGTGGG - Intergenic
1047543904 8:125797266-125797288 GCTCTCAGGAGACCTGAAGTAGG + Intergenic
1048547897 8:135404370-135404392 GCTCTCAGGAGACCTGAAGTGGG + Intergenic
1049710506 8:144060936-144060958 TTGCCCAGGACACCTGGAGGTGG - Intronic
1052691496 9:31821314-31821336 GTTCTCAGGAGACCTGAAGTGGG - Intergenic
1059104853 9:111502160-111502182 GCTCTCAGGAGACCTGAAGTGGG - Intergenic
1059721866 9:116967809-116967831 GGCAGCAGGACACGTGGAGTAGG - Intronic
1060109669 9:120897451-120897473 GGTTTCAGGTCACATGGAGTGGG + Intergenic
1060894358 9:127208184-127208206 GGGACCAGGAGACCTGGAGGTGG + Intronic
1061278065 9:129580922-129580944 CTTCCCAGGAAACCTGGAGAGGG - Intergenic
1062102253 9:134734379-134734401 GGCCCCAGGACACTTGGAGCAGG - Intronic
1062440136 9:136566092-136566114 ATTCCCAGGACAGCTGGAGCAGG - Intergenic
1062546981 9:137068282-137068304 AGTCCCAGGACACCTGGGCCCGG + Intronic
1062625883 9:137441382-137441404 GGGTCCAGGACAGCTGGGGTGGG + Exonic
1203747051 Un_GL000218v1:45565-45587 GTTCCCAGGCCACCTGCAATAGG - Intergenic
1203563053 Un_KI270744v1:73915-73937 GTTCCCAGGCCACCTGCAATAGG + Intergenic
1185572869 X:1147773-1147795 GGCCCCAGGAAACCAGGAGGCGG - Intergenic
1187704575 X:21997107-21997129 GGTCCCATGACTCCTGGGATAGG + Intergenic
1190997396 X:55623762-55623784 GGTCCCAGGGCTGCTGGACTGGG + Exonic
1192368367 X:70493939-70493961 CTTCCCAGGATCCCTGGAGTTGG + Intronic
1193264556 X:79453190-79453212 GGTCTCAAGGCAGCTGGAGTTGG - Intergenic
1193659321 X:84237830-84237852 AGTCCCAAGACACCTCTAGTAGG - Intergenic
1195293328 X:103450072-103450094 AGCCCCAGGACACCTCGAGCAGG - Intergenic
1195438913 X:104878889-104878911 GGACCCAGGATACCTGAAGTTGG + Intronic
1199972559 X:152871832-152871854 TGTCCCAGGACACCTGACCTAGG - Intergenic
1200011438 X:153123642-153123664 CTGCCCAGGGCACCTGGAGTAGG + Intergenic
1200011547 X:153124344-153124366 CCGCCCAGGTCACCTGGAGTAGG + Intergenic
1200012065 X:153126900-153126922 CCTCGCAGGGCACCTGGAGTAGG + Intergenic
1200027535 X:153273019-153273041 CCTCGCAGGGCACCTGGAGTAGG - Intergenic
1200028054 X:153275575-153275597 CCGCCCAGGTCACCTGGAGTAGG - Intergenic
1200028162 X:153276280-153276302 CTGCCCAGGGCACCTGGAGTAGG - Intergenic
1200122485 X:153797715-153797737 GGCTCCAGGACACCTGGGTTGGG - Exonic
1200424827 Y:3009221-3009243 GCTCTCAGGAGACCTGCAGTGGG + Intergenic
1201160379 Y:11160577-11160599 GTTCCCAGGCCACCTGCAATAGG - Intergenic