ID: 1151563063

View in Genome Browser
Species Human (GRCh38)
Location 17:74881092-74881114
Sequence GGGGTGGGCCAACAGGGATC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 203}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151563054_1151563063 2 Left 1151563054 17:74881067-74881089 CCTGGAAGATGTTGACGTGGAGG 0: 1
1: 0
2: 2
3: 10
4: 130
Right 1151563063 17:74881092-74881114 GGGGTGGGCCAACAGGGATCTGG 0: 1
1: 0
2: 1
3: 13
4: 203
1151563049_1151563063 22 Left 1151563049 17:74881047-74881069 CCCAGGTTGGGGTGGCCTCACCT 0: 1
1: 0
2: 1
3: 21
4: 202
Right 1151563063 17:74881092-74881114 GGGGTGGGCCAACAGGGATCTGG 0: 1
1: 0
2: 1
3: 13
4: 203
1151563047_1151563063 29 Left 1151563047 17:74881040-74881062 CCAGCGCCCCAGGTTGGGGTGGC 0: 1
1: 0
2: 1
3: 14
4: 175
Right 1151563063 17:74881092-74881114 GGGGTGGGCCAACAGGGATCTGG 0: 1
1: 0
2: 1
3: 13
4: 203
1151563045_1151563063 30 Left 1151563045 17:74881039-74881061 CCCAGCGCCCCAGGTTGGGGTGG 0: 1
1: 0
2: 1
3: 13
4: 180
Right 1151563063 17:74881092-74881114 GGGGTGGGCCAACAGGGATCTGG 0: 1
1: 0
2: 1
3: 13
4: 203
1151563048_1151563063 23 Left 1151563048 17:74881046-74881068 CCCCAGGTTGGGGTGGCCTCACC 0: 1
1: 0
2: 1
3: 21
4: 206
Right 1151563063 17:74881092-74881114 GGGGTGGGCCAACAGGGATCTGG 0: 1
1: 0
2: 1
3: 13
4: 203
1151563052_1151563063 7 Left 1151563052 17:74881062-74881084 CCTCACCTGGAAGATGTTGACGT 0: 1
1: 0
2: 0
3: 5
4: 113
Right 1151563063 17:74881092-74881114 GGGGTGGGCCAACAGGGATCTGG 0: 1
1: 0
2: 1
3: 13
4: 203
1151563050_1151563063 21 Left 1151563050 17:74881048-74881070 CCAGGTTGGGGTGGCCTCACCTG 0: 1
1: 0
2: 1
3: 28
4: 466
Right 1151563063 17:74881092-74881114 GGGGTGGGCCAACAGGGATCTGG 0: 1
1: 0
2: 1
3: 13
4: 203

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151563063 Original CRISPR GGGGTGGGCCAACAGGGATC TGG Exonic
901054086 1:6440562-6440584 GGGGCGGGCCTACAGGGGCCTGG + Intronic
901328070 1:8381042-8381064 GGGGTGGGCCAGCAGCAACCAGG - Intronic
902368544 1:15992046-15992068 GGGGTGGCCACAAAGGGATCCGG + Intergenic
902513506 1:16978456-16978478 TGGGTGGGCCAGCAGGGACTGGG - Intronic
903366895 1:22810800-22810822 GGGGTGGGATGACAGGGACCAGG - Intronic
903367059 1:22811636-22811658 GGGGTGGGATGACAGGGACCAGG - Intronic
903387900 1:22941476-22941498 GGAGTTGGTCAACAGGCATCAGG - Intergenic
906460455 1:46032187-46032209 GGGGCTGGCCAACGGGGAGCAGG - Exonic
907300264 1:53482578-53482600 GAGGTGGACCAACAAGGACCTGG - Intergenic
907901896 1:58748695-58748717 GGGGTGGGACAAGGGGGGTCAGG - Intergenic
911053975 1:93695278-93695300 GGGGTGGGCCTGCAGGGTTGTGG - Intronic
912397830 1:109360769-109360791 GGGGTAGGCCCACAAGGATCTGG + Intronic
913237628 1:116798484-116798506 GGGGTGGATCAACTGAGATCAGG + Intergenic
914765769 1:150636407-150636429 GGAGTGAGCCAACAGTTATCTGG + Intergenic
914975208 1:152354886-152354908 GGCTTTGGCCAACATGGATCAGG - Exonic
915022760 1:152796881-152796903 GGCGGGGGCCAAAAGGGGTCTGG + Intronic
915101876 1:153506856-153506878 CTGGTGGGTCAACAGGGACCAGG - Intergenic
915206324 1:154272983-154273005 GGGGTGATGCAACAGGGACCCGG + Intronic
915218141 1:154353404-154353426 GGGGCGGGGCCACAGGGAGCGGG - Intergenic
915632443 1:157162875-157162897 GGGGAAGGCCAAAAGGGAACTGG - Intergenic
916757746 1:167789667-167789689 TGTGTGAGTCAACAGGGATCAGG + Exonic
917059217 1:171018133-171018155 GGAGTGAGCCCACAGGCATCAGG + Intronic
917312680 1:173693069-173693091 GGGGTGGATCAACAGAGGTCAGG + Intergenic
920451898 1:206065679-206065701 CCTGTGGGACAACAGGGATCAGG + Intronic
922025043 1:221742156-221742178 GGGTTGGGCCAATAAGAATCCGG + Exonic
1067040810 10:42952222-42952244 GGGGTGGGCCTCCTGGGATGGGG - Intergenic
1068626338 10:59252678-59252700 GGGGTGGGTCAACAGTTCTCAGG - Intronic
1070600854 10:77865352-77865374 GGGGTGAGCCATCAGGGAAGTGG - Intronic
1071990930 10:91100263-91100285 AGAGTGAGCCATCAGGGATCAGG + Intergenic
1072039210 10:91591343-91591365 GGGGTGGGCGCAGAGGGGTCAGG - Intergenic
1073096050 10:100980363-100980385 GATCAGGGCCAACAGGGATCAGG - Intronic
1073855162 10:107664965-107664987 GGGGTAGGCCACTTGGGATCAGG - Intergenic
1075742880 10:124706478-124706500 GGGCTGGGGCAACAGGGCACAGG - Intronic
1077036048 11:494987-495009 GTGGTTGGCCAACAGGGTTGCGG + Exonic
1077095369 11:796923-796945 GGGGGGGGCTAGGAGGGATCAGG - Intronic
1077502860 11:2917085-2917107 TGGGTGGGCCAGCAAGGCTCCGG + Intronic
1077736494 11:4797340-4797362 GCTGTGGGCCAACTGGGATGTGG - Intronic
1078924034 11:15858180-15858202 GCAGTGAGCCAACATGGATCCGG + Intergenic
1079884113 11:25964542-25964564 TGGGTGGATCAACAGAGATCAGG + Intergenic
1080315291 11:30940355-30940377 GGGGTTGGTCAACAGGAAGCAGG - Intronic
1081557800 11:44182259-44182281 GGGGTGGGGTAACAGGGAGATGG + Intronic
1081650687 11:44822097-44822119 GGGGTGGGGGTACAGGGATAGGG + Intronic
1085299181 11:75448642-75448664 GGGGTCTGCCACCAGGCATCAGG - Intronic
1086045269 11:82524901-82524923 GGGGTGGGAAAAGAAGGATCAGG - Intergenic
1089590477 11:119537195-119537217 AAGGTGGGACTACAGGGATCAGG - Intergenic
1090939052 11:131371873-131371895 AGGGTGGCCCAGCAGGGCTCCGG + Intronic
1091309205 11:134560908-134560930 GGGGGGGGCCAGCAGGGCCCAGG + Intergenic
1092258947 12:6942168-6942190 GGGGCGCGCACACAGGGATCGGG - Exonic
1092919435 12:13217895-13217917 GGGGTGGGCCAGCAGAGAGCTGG + Exonic
1094783344 12:33818272-33818294 GGGGTGGGCCAGCAGGGATGGGG + Intergenic
1096053797 12:48634008-48634030 TGGGTGGGTCACCAGAGATCAGG + Intergenic
1096798940 12:54096635-54096657 GGGATGGGGAAACAGGGGTCCGG + Intergenic
1103619532 12:122178338-122178360 GGAGAGGGGCAAAAGGGATCAGG - Intronic
1104964744 12:132503852-132503874 GGTGTGAGCCAACAAGGTTCTGG + Intronic
1104967935 12:132517710-132517732 GGGGTGGGCAGACAGGGCTAAGG + Intronic
1106095778 13:26641629-26641651 GGAGTTGGTCAACAGGGAACAGG + Intronic
1108588512 13:51892071-51892093 GAGGTGGGGAAACAGGGCTCAGG + Intergenic
1110385592 13:74906903-74906925 GGGGTGGTCCAAAAAGAATCTGG - Intergenic
1110852913 13:80264868-80264890 TGGGTGGGCCCACAGAGCTCAGG - Intergenic
1115408111 14:33041829-33041851 GGAGTTGGTCAACAGGGAGCAGG + Intronic
1116247137 14:42429652-42429674 GGAGTTGGTCAACAGGGAGCAGG - Intergenic
1119436272 14:74599836-74599858 GGGTTGGGCCCACAGATATCTGG + Intronic
1122264480 14:100540261-100540283 GGGGTGGGCCAAAGGGACTCTGG + Intronic
1123880439 15:24674454-24674476 GGGATAGGCCAAAATGGATCTGG + Intergenic
1126109768 15:45168423-45168445 AGGGTTGGCCAGCAGGGGTCGGG - Intronic
1128007520 15:64257973-64257995 GGGGTGGGTGGACAGGGAGCAGG - Intronic
1128211792 15:65908550-65908572 AGGGTTGTCAAACAGGGATCTGG - Intronic
1129198502 15:73984874-73984896 GGGGGTGGCCAACAGGGTTGGGG + Intronic
1129514927 15:76151559-76151581 GGGGTGGGGCAAGAGTGTTCAGG - Intronic
1130275251 15:82472888-82472910 GGGTAGGGCCCAAAGGGATCAGG - Intergenic
1130467611 15:84200283-84200305 GGGTAGGGCCCAAAGGGATCAGG - Intergenic
1130496654 15:84473259-84473281 GGGTAGGGCCCAAAGGGATCAGG + Intergenic
1130589903 15:85204881-85204903 GGGTAGGGCCCAAAGGGATCAGG - Intergenic
1131313559 15:91312356-91312378 GTGGTGGGACAAGAGTGATCAGG - Intergenic
1134080684 16:11323046-11323068 GGGCTGGGCCAACAGAGAGCCGG - Intronic
1135711102 16:24718003-24718025 TGGGTGGATCACCAGGGATCAGG - Intergenic
1136158239 16:28400214-28400236 GCAGTGGGCAAACAGGGATCTGG - Intronic
1136204848 16:28715069-28715091 GCAGTGGGCAAACAGGGATCTGG + Intronic
1137456496 16:48621722-48621744 GGGGTGGGCTCACAGGAAACTGG + Intergenic
1137580785 16:49632370-49632392 GGGGTGGGCTAACTGACATCTGG + Intronic
1141533148 16:84660519-84660541 TGGGTGCGGCAACAGGGAACTGG - Intronic
1142029882 16:87833235-87833257 GGGGTGGGCCGAGTGGGATGTGG - Intronic
1143109335 17:4544677-4544699 GGGGTGGGCGCACAGGGAGGCGG + Intronic
1143109344 17:4544699-4544721 GGGGTGGGCGCACAGGGAGGCGG + Intronic
1147275955 17:39316758-39316780 GGGGTGGGCCACCTGAGGTCAGG + Intronic
1147951186 17:44108959-44108981 GGAGTGGGGAGACAGGGATCTGG + Intronic
1149444499 17:56703321-56703343 AGGGTGGGCCAGCTGGGAGCAGG - Intergenic
1151563063 17:74881092-74881114 GGGGTGGGCCAACAGGGATCTGG + Exonic
1151576267 17:74953992-74954014 GGGGCTGGGCAACAGGGATGGGG - Intronic
1152780517 17:82225727-82225749 GGGGTGGCCCTGCTGGGATCTGG + Intergenic
1156449877 18:37260961-37260983 GGGGAGGGCCACCAGAGCTCGGG - Intronic
1157521410 18:48347979-48348001 GGGGCAGGCCAACAGGGCTGTGG - Intronic
1157624698 18:49041707-49041729 GGGGAGGGCAATCAGGGTTCTGG + Exonic
1160611996 18:80096061-80096083 GGGGTGGGCCACCTGGCAGCGGG - Exonic
1160738949 19:677202-677224 GGGGTGGGGCTGCAGGGATGGGG - Intronic
1161030477 19:2055875-2055897 GGGCTATGCCAACAGGGATGGGG + Intergenic
1161057122 19:2196204-2196226 GGTCGGGGCCACCAGGGATCGGG - Intronic
1162464153 19:10830615-10830637 GGGGTGTGCCACCAGGCAGCTGG + Intronic
1163828579 19:19537177-19537199 GGGGTGGGGCAGCAGGACTCTGG + Intronic
1164635564 19:29788673-29788695 GGGGAGGGCCAGCTGGGCTCAGG + Intergenic
1165767314 19:38359603-38359625 GGGGTGGGCAGAGAGGGAACGGG - Intronic
1166870148 19:45865787-45865809 GGGCAGGGCCAACAGGGAAAGGG + Intronic
1167823519 19:51951594-51951616 GGAGTTGGCCAACAGGAATCAGG + Intergenic
1167888684 19:52522686-52522708 GGGGTGGGGCAAGAGGGAGGAGG + Intergenic
1168471601 19:56644611-56644633 GGAGTGGGGCAAGAGAGATCAGG - Intronic
1168614498 19:57826819-57826841 GGTGTGGACCAACAGCGACCTGG + Intronic
925276450 2:2651603-2651625 GTGCTGGGCAAACAGGAATCAGG + Intergenic
926160127 2:10481990-10482012 GAGCTGGGCCAACTGGGTTCAGG - Intergenic
932091423 2:68809328-68809350 GGGAGGGGCTTACAGGGATCAGG + Intronic
932395608 2:71445375-71445397 GGGGTGTACAAACAGGGATTAGG - Intergenic
932577928 2:72972915-72972937 GGGGGGGGCCACCAGGGTTTGGG + Intronic
935572440 2:104676127-104676149 GCTGTGGTCCAAGAGGGATCGGG + Intergenic
946327210 2:218990877-218990899 GGGCTGGGCCAGCAAGGATGTGG - Exonic
947379060 2:229527325-229527347 GGGTTGTGAGAACAGGGATCTGG - Intronic
947605790 2:231484223-231484245 GGGGTGGGGCAAGAGCAATCAGG + Intergenic
949074024 2:242043936-242043958 GGGGCGGGCACACAGGGAACTGG + Intergenic
949074044 2:242043999-242044021 GGGGTGGGCACACGGGGAACTGG + Intergenic
1168904604 20:1393039-1393061 GGCGTGGACCAACAGCGACCTGG + Exonic
1169119022 20:3084372-3084394 GGGGTGGGCCAGAGGGGACCAGG - Intronic
1169287805 20:4324256-4324278 GGAGTTGGCCAACAGGGAGCAGG - Intergenic
1169330470 20:4712182-4712204 CGGGTGGACCACCAGAGATCAGG - Intergenic
1170814651 20:19703288-19703310 TGGATGGGCCAGCAGGGATGTGG - Intronic
1171797482 20:29577715-29577737 GGGATGGGGAAACAGGGGTCTGG - Intergenic
1171850769 20:30306446-30306468 GGGATGGGGAAACAGGGGTCTGG + Intergenic
1172620788 20:36316883-36316905 AGGCTGGGCAAACAGGGAGCTGG + Intronic
1176070148 20:63222088-63222110 GGTGTGGGCACAGAGGGATCAGG - Intergenic
1177879178 21:26671243-26671265 GGAGTTGGTCAACAGGAATCAGG + Intergenic
1178832562 21:36069027-36069049 GGAGTGGGTCAACAGGCATCAGG - Intronic
1179378750 21:40878981-40879003 GGGTTTGGCCAACAGAGACCTGG + Intergenic
1180991620 22:19940816-19940838 AGGGTGGCCCAACAGAGTTCTGG - Intronic
1181572614 22:23775836-23775858 GGGGAGGGCCTACAGGGACAAGG + Intronic
1182283782 22:29232359-29232381 GGGGTGGCCCAACAGGGGCTGGG - Exonic
1183261186 22:36796981-36797003 GGGGTGGGGCAGCAGGGGCCTGG + Intergenic
1185217832 22:49613247-49613269 GGGGTGGGAGAGCAGGGAGCAGG - Intronic
1185220161 22:49625169-49625191 GAAGTGGGCCAACAGGGAGAGGG - Intronic
1185235790 22:49712257-49712279 AGGGTGGGCCAAGAGGGCCCCGG - Intergenic
950231240 3:11277595-11277617 GGGGTGTGCGAACAGGGAGTGGG + Intronic
950515626 3:13463175-13463197 GGGGAGGGCAAACAGGGACATGG + Intergenic
953431445 3:42843974-42843996 GAGGTGGGACAACAGGGAGGCGG - Intronic
954264435 3:49461634-49461656 GAGGAGGGGCAACAGGCATCAGG - Intergenic
954675497 3:52313293-52313315 GAGGTGGGGCATCAGGGAGCTGG - Intergenic
954808784 3:53235432-53235454 GGTCTAGGACAACAGGGATCTGG + Intronic
955535920 3:59923704-59923726 GGGGTGGGTGATCAGGGATGAGG - Intronic
960949900 3:122992591-122992613 GAGGTGGGGCATCAGGGAGCTGG - Intronic
961325173 3:126105295-126105317 GGAGTGGGCCAAGGGGGAGCAGG - Intronic
961479535 3:127171092-127171114 GGGGTGGGGCCACAGGGCACAGG + Intergenic
961623546 3:128243629-128243651 CGGGTGGGGCATCAAGGATCAGG + Intronic
962481274 3:135800669-135800691 GGGGAGGGGGAACAGGTATCAGG - Intergenic
965534875 3:169813337-169813359 GGAGTTGGTCAACAGGAATCAGG + Intergenic
968624221 4:1619274-1619296 GGGCTGGGCAAACACGGAGCTGG + Intronic
968961221 4:3744616-3744638 GGGGTGGGGCGAGAGAGATCGGG - Intergenic
969101745 4:4774747-4774769 GGGGTGGGCGAGGAGGGAGCAGG - Intergenic
979775515 4:124583794-124583816 GGGGTGATCCTACAGGCATCAGG + Intergenic
984277610 4:177628493-177628515 TGGGTGGGCCACCTGAGATCAGG - Intergenic
985704518 5:1392647-1392669 GAGATGGGCCAAGAGGCATCAGG + Intergenic
986326861 5:6682226-6682248 GGGGTGGGGGTACAGGGATGGGG + Intergenic
986334354 5:6742206-6742228 GGAGGGAGCCAACAGGGAACAGG - Intronic
986716433 5:10527339-10527361 GGGGAGGGGCAAAAGGCATCTGG + Intergenic
993533362 5:89050537-89050559 GGGGTGCACCAACAGGGAATAGG - Intergenic
993750355 5:91658242-91658264 GGGGTGTACGAACAGGGATTAGG - Intergenic
994595185 5:101823576-101823598 GGGGTTGGTCAACAGAGAGCAGG + Intergenic
997410601 5:133687919-133687941 GGGGTGAGCCATCTGGGACCTGG - Intergenic
997616164 5:135247582-135247604 GGGTTGGGCCCACTGGGGTCAGG + Intronic
997944799 5:138190534-138190556 CGGGTGGGTCATCAGAGATCAGG + Intronic
1000902211 5:166925122-166925144 GTGGTAGGCAAACAGGGAACTGG + Intergenic
1004262570 6:14120994-14121016 GAGCTGGGCCAACAGGAATTGGG - Intronic
1005972830 6:30774855-30774877 GGAGTGTGCCAAGACGGATCAGG - Intergenic
1006082032 6:31573236-31573258 GGGGTGGGAGATCAGGGGTCTGG - Intronic
1006257825 6:32845023-32845045 GGGGTGGGCCTAAGGGGATAGGG + Intronic
1006372965 6:33656758-33656780 GGGGTGGGGCAACAGGGCCCAGG - Intronic
1011222127 6:85065663-85065685 GGGGAGGGGAAAGAGGGATCAGG + Intergenic
1011616425 6:89202019-89202041 ACAGTGGGCCAACAGAGATCAGG - Intronic
1012222415 6:96664904-96664926 GGAGTTGGTCAACAGGCATCAGG + Intergenic
1016077776 6:139817878-139817900 AGAGTAGGGCAACAGGGATCAGG + Intergenic
1017177545 6:151518844-151518866 GGGGTGTACAAACAGGGAGCAGG + Intronic
1018392474 6:163350964-163350986 GGGGTGGTCCTACTGGTATCTGG + Intergenic
1019299593 7:296471-296493 GGGGGGGGGCAAGAGGGACCAGG - Intergenic
1023930356 7:44701559-44701581 GGGGTGGCGCAACAGGGATTTGG - Exonic
1024903529 7:54350204-54350226 GGGGTGGGCCACCTGAGGTCAGG + Intergenic
1025216616 7:57061275-57061297 GGGTTGCACCAACAGGAATCGGG + Intergenic
1025627369 7:63233725-63233747 GGGTTGCACCAACAGGAATCGGG + Intergenic
1025654763 7:63509455-63509477 GGGTTGCACCAACAGGAATCGGG - Intergenic
1029456103 7:100673398-100673420 GGCGTGGCCCAACCGGGAACTGG + Intergenic
1029503232 7:100946852-100946874 GGGAGGGGCCAACAGGGAGCAGG - Intergenic
1029618348 7:101674074-101674096 AGGGTGGGACAACAGAGAACAGG + Intergenic
1034233147 7:149548298-149548320 GGAGTTGGCCAACAGGCAGCAGG - Intergenic
1035315089 7:157992663-157992685 GGGGTGGCCCAACAGAGAGCAGG + Intronic
1035682793 8:1500649-1500671 TGTGTGGGGCAACAGGGAACTGG - Intergenic
1037527948 8:19745921-19745943 GGAGTTGGCCAACAGGAAGCAGG + Intronic
1038197176 8:25378997-25379019 GGGGTGTACCAACAGGGAGCAGG + Intronic
1040307806 8:46221247-46221269 TGGGTGGGCCAACGGGACTCAGG + Intergenic
1040951390 8:52941214-52941236 CGGGTGGGGCAGCAGGGAGCAGG - Intergenic
1042512117 8:69623128-69623150 GGGGTGGGCGGGCAGGGATGGGG - Intronic
1043874094 8:85464693-85464715 GGGGTCGGACATCAGGAATCGGG + Intronic
1049351139 8:142165448-142165470 GGGGTGGGTCAGCAGGGACTGGG - Intergenic
1049366170 8:142237950-142237972 GGCGTGGGCCAGCAGGGAAACGG - Intronic
1049773787 8:144395554-144395576 GGGGTGGGGGCACAGGGGTCAGG + Intronic
1053788548 9:41669738-41669760 GGGATGGGGAAACAGGGGTCTGG + Intergenic
1053877304 9:42557908-42557930 GGGGTGGGCCACCAGTCTTCAGG - Intergenic
1054156591 9:61645030-61645052 GGGATGGGGAAACAGGGGTCTGG - Intergenic
1054176833 9:61881077-61881099 GGGATGGGGAAACAGGGGTCTGG + Intergenic
1054234389 9:62543814-62543836 GGGGTGGGCCACCAGTCTTCAGG + Intergenic
1054660702 9:67699729-67699751 GGGATGGGGAAACAGGGGTCTGG - Intergenic
1055998893 9:82193488-82193510 TGGGTGGGGCAACAGGCATGGGG - Intergenic
1056006721 9:82279811-82279833 GGGGTGGGGATACAGGGCTCAGG - Intergenic
1056854254 9:90111644-90111666 GGGCTGGGAGAACAGGGATGTGG + Intergenic
1058869485 9:109190159-109190181 GTGCTGGACCAACAGGGAACTGG - Intronic
1060547870 9:124471300-124471322 GGGCTGGGCAAGCAGGGAGCAGG - Intronic
1060977070 9:127771142-127771164 GGGGAGGGCCAGCGGGGAGCAGG - Intronic
1061004205 9:127919166-127919188 GGGGTGAGGCAAGAGGGATTGGG - Intergenic
1062237965 9:135521725-135521747 GGGATGGGGCAGCAGGGGTCTGG + Intronic
1062349252 9:136131175-136131197 GAGGAGGCCAAACAGGGATCAGG + Intergenic
1062428677 9:136517390-136517412 GGGGTGGGGCAACAGTGAGGGGG + Intronic
1062537690 9:137028062-137028084 GGGGTGGGCTCACCGGGCTCCGG + Exonic
1186857125 X:13637105-13637127 GGGGTGTATGAACAGGGATCAGG + Intergenic
1187064313 X:15818387-15818409 GACCTGGACCAACAGGGATCAGG + Intronic
1187827567 X:23347145-23347167 GGGGAGAGTCAACAGGGGTCAGG + Intronic
1200886570 Y:8278054-8278076 AGGGTGGGGCAGCAGGGATGGGG - Intergenic