ID: 1151564328

View in Genome Browser
Species Human (GRCh38)
Location 17:74889135-74889157
Sequence CAAGCTGGGCCATTGGATCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 138}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151564328_1151564338 16 Left 1151564328 17:74889135-74889157 CCCAGATCCAATGGCCCAGCTTG 0: 1
1: 0
2: 0
3: 13
4: 138
Right 1151564338 17:74889174-74889196 AGACAATCCCAGCAAAAGCTGGG 0: 1
1: 0
2: 2
3: 62
4: 1785
1151564328_1151564337 15 Left 1151564328 17:74889135-74889157 CCCAGATCCAATGGCCCAGCTTG 0: 1
1: 0
2: 0
3: 13
4: 138
Right 1151564337 17:74889173-74889195 GAGACAATCCCAGCAAAAGCTGG 0: 1
1: 0
2: 2
3: 24
4: 291
1151564328_1151564340 23 Left 1151564328 17:74889135-74889157 CCCAGATCCAATGGCCCAGCTTG 0: 1
1: 0
2: 0
3: 13
4: 138
Right 1151564340 17:74889181-74889203 CCCAGCAAAAGCTGGGCACCTGG 0: 1
1: 0
2: 4
3: 34
4: 263
1151564328_1151564342 24 Left 1151564328 17:74889135-74889157 CCCAGATCCAATGGCCCAGCTTG 0: 1
1: 0
2: 0
3: 13
4: 138
Right 1151564342 17:74889182-74889204 CCAGCAAAAGCTGGGCACCTGGG 0: 1
1: 0
2: 1
3: 33
4: 203

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151564328 Original CRISPR CAAGCTGGGCCATTGGATCT GGG (reversed) Intronic
900782324 1:4626193-4626215 CAAGGTGAGCCCTTGGACCTGGG + Intergenic
901953963 1:12770737-12770759 CAGGCTGGGCCAGGGGAGCTTGG + Intergenic
905406002 1:37732773-37732795 CTTGCTGGGCCACTGGACCTGGG - Intronic
906949915 1:50326323-50326345 CAAGCTGGGCCACTTGGTCAAGG + Intergenic
907766558 1:57418084-57418106 CAAACTGTGCAATTGCATCTTGG + Intronic
908601401 1:65744053-65744075 CAACCTGGGACATTTGAGCTTGG - Intergenic
909416614 1:75413759-75413781 AAAACTGTGCCATTGGACCTAGG - Intronic
914209029 1:145561584-145561606 CAACCTGGGACACTGGAGCTTGG - Intergenic
914286632 1:146232869-146232891 CAAGCTGGCCCACTGTAACTAGG + Intergenic
914547663 1:148683610-148683632 CAAGCTGGCCCACTGTAACTAGG + Intergenic
916175409 1:162033922-162033944 CAAGCTGTTCCAGTGAATCTTGG + Intergenic
916242987 1:162658248-162658270 CAGGCTGGGCCATTGGAGGTGGG + Intronic
917133014 1:171761655-171761677 CAAGCTTGGCCACTGGAAATGGG - Intergenic
917512924 1:175683009-175683031 CAAGCTCGCCCATTGTTTCTGGG - Intronic
922033268 1:221824894-221824916 CAAGGTGGGCATTAGGATCTGGG + Intergenic
1066297548 10:34067871-34067893 CAACCTGGGACATGGGAGCTTGG + Intergenic
1067657856 10:48210921-48210943 CAAGCTGGGCCATTTGATTGGGG - Intronic
1071443984 10:85729214-85729236 CAAGCTGCTCCATTTGTTCTTGG - Intronic
1073745879 10:106467622-106467644 CAACCTGGGACACTGGAGCTTGG + Intergenic
1074907509 10:117878083-117878105 GACTCTGGGCCATTGGATCACGG + Intergenic
1078005224 11:7527376-7527398 AGAACTGGCCCATTGGATCTGGG + Intronic
1078146315 11:8723921-8723943 CTTGCTGGGCCATTGTTTCTGGG - Intronic
1078555323 11:12320743-12320765 CAAGCTGGGCCATGGGGAGTTGG - Intronic
1080563274 11:33483958-33483980 TTAGCTTGGCCATTTGATCTTGG + Intergenic
1082799455 11:57403883-57403905 CAAGCTGGGCCCTTCCATCAGGG - Intronic
1082872141 11:57953387-57953409 CAACCTGGGACACTGGAGCTTGG - Intergenic
1088554544 11:111048543-111048565 CAAGCTGAGACATTGTAGCTTGG - Intergenic
1090830340 11:130416613-130416635 CAAGCTAAGCCGTGGGATCTGGG - Intronic
1091754444 12:3042458-3042480 GAAGCTGGGGCATGGGCTCTAGG + Intergenic
1092798458 12:12138367-12138389 TAAGCTGGGCAATTCGAGCTTGG + Exonic
1094528946 12:31254072-31254094 AAAGCTGGGCAATGGGCTCTTGG + Intergenic
1095778872 12:46037167-46037189 CGAGCTGGGACACTGGAGCTTGG + Intergenic
1096266357 12:50125922-50125944 AAAGCTGGGCCATTAGAGTTAGG - Intergenic
1098040925 12:66353448-66353470 CCAGCTGGGCCAGGAGATCTTGG - Exonic
1099232929 12:80048989-80049011 CTAACTGGGCCTTTGGATCAAGG + Intergenic
1101674256 12:106903406-106903428 CCAGCTGGACCATGGGCTCTCGG - Intergenic
1102443270 12:112979654-112979676 CAAGCTGGACACTTTGATCTGGG - Intronic
1104669590 12:130671211-130671233 GAAGCTGTGACATTGGATCAGGG - Intronic
1105355107 13:19652718-19652740 CAATCTGGGCCACTTGAGCTTGG + Intronic
1106308767 13:28535011-28535033 CAAGTTGTGGCTTTGGATCTGGG + Intergenic
1107808992 13:44181115-44181137 CAAGAAGGGGCAGTGGATCTGGG + Intergenic
1111154634 13:84306761-84306783 CAAGCTGAGAAATTGGAACTTGG - Intergenic
1113594127 13:111519418-111519440 CTTGCAGGGCCATTGGATCGTGG + Intergenic
1114565003 14:23624136-23624158 CAAGCTTGGCCACTGGAGATGGG + Intergenic
1120070884 14:80100820-80100842 CACGCTGACCCATTGGATCCTGG - Intergenic
1121704864 14:95983902-95983924 AGAGCTGGGCCTTTGTATCTAGG - Intergenic
1124649808 15:31466234-31466256 CAAGCTGGACCTTTGCCTCTGGG + Intergenic
1125098417 15:35881113-35881135 CAAGCTCGGCCATGTGAACTTGG + Intergenic
1125639266 15:41216200-41216222 TAAGCTGAGCCATTGCTTCTGGG - Intronic
1126050829 15:44683376-44683398 CAAGCTGGGACACTTGAGCTTGG + Intronic
1126290411 15:47070249-47070271 CAAGCTCAGCTATTGTATCTGGG - Intergenic
1128543356 15:68551889-68551911 GAAGGTGGGCCATCGGTTCTGGG - Intergenic
1129192938 15:73947899-73947921 CAAGGTGGGCCTCTGGGTCTGGG + Exonic
1132295665 15:100732510-100732532 CAAGCTGGGCCTGGGGATTTGGG - Intergenic
1133843153 16:9428602-9428624 GGGGCTGGGCCATTGGATATAGG + Intergenic
1141588091 16:85048432-85048454 CATGCTGCACGATTGGATCTGGG + Intronic
1142399515 16:89852026-89852048 GAAGATGGGCCAGGGGATCTGGG - Intronic
1142399563 16:89852143-89852165 GAAGATGGGCCATGGGATCTGGG - Intronic
1142399593 16:89852221-89852243 GAAGATGGGCCATGGGATCTGGG - Intronic
1142399654 16:89852377-89852399 GAAGATGGGCCATGGGATCTGGG - Intronic
1142399671 16:89852416-89852438 GAAGATGGGCCATGGGATCTGGG - Intronic
1142399701 16:89852494-89852516 GAAGATGGGCCATGGGATCTGGG - Intronic
1148029331 17:44608769-44608791 CAAGCTGGGCCCTGGCACCTAGG - Intergenic
1151564328 17:74889135-74889157 CAAGCTGGGCCATTGGATCTGGG - Intronic
1153947342 18:10029478-10029500 TCAGCTGGGCCATGGGGTCTGGG + Intergenic
1156357369 18:36353825-36353847 CAGGATGGGTCAGTGGATCTGGG + Intronic
1157842211 18:50968614-50968636 CACTCTGGGCCCGTGGATCTCGG - Intronic
1158993740 18:62896095-62896117 CAAGCTGGGTAATTGAATGTGGG + Intronic
1160462321 18:79048500-79048522 CAAGGCTGGCCATTGCATCTTGG - Intergenic
1161069739 19:2254099-2254121 GGAGCTGGGTCCTTGGATCTTGG - Intronic
1162447383 19:10731705-10731727 CAAGCTGAGCCAGTGGCTCGTGG - Intronic
1163095492 19:15054273-15054295 TCAGCTGGGGCTTTGGATCTGGG - Intronic
1163241548 19:16066959-16066981 AAGGAGGGGCCATTGGATCTGGG + Intergenic
1166677666 19:44749218-44749240 TAAGCTGTGCCTTGGGATCTGGG + Intronic
1167017364 19:46849952-46849974 CAGGTTGGGGCTTTGGATCTAGG - Intronic
1167215920 19:48164553-48164575 CAGGCTGGGCCAGTGAAACTGGG + Intronic
925381387 2:3428994-3429016 GAAGCTGGGCCCTGGGTTCTAGG - Intronic
925923072 2:8650964-8650986 CAAGCTGAGCCACTGGGGCTGGG + Intergenic
931648771 2:64450139-64450161 CAAGTTGGGCCTTGGGATCATGG + Intergenic
932741218 2:74292416-74292438 CATGCTGGGCCACTGGGTCAGGG + Intronic
935480517 2:103582458-103582480 CAAGTTGGGCCCTTTCATCTAGG - Intergenic
937254804 2:120547649-120547671 CAGGATGGGCCATGGGACCTGGG + Intergenic
940089699 2:149901559-149901581 CAAGCTGAGCCTTTGGTTCATGG - Intergenic
940437318 2:153669938-153669960 CAACCTGGGACACTGGAACTTGG + Intergenic
941112137 2:161427235-161427257 CAGGCTGGGCCACTGGAGCGCGG + Intronic
945919384 2:215739950-215739972 CAAGATGATCCATTGGATCATGG - Intergenic
1171427395 20:25057553-25057575 CGAGCTGGGCACGTGGATCTGGG + Intronic
1172867267 20:38109818-38109840 TAGTCTGGACCATTGGATCTGGG - Intronic
1176124770 20:63470578-63470600 CACGCTGGGCCCTTGGATCATGG + Intronic
1177601760 21:23324787-23324809 CAAGCTATGACATTGTATCTGGG - Intergenic
1177631357 21:23733061-23733083 CATTCTGGGCAATTGGATCTTGG + Intergenic
1180614582 22:17119450-17119472 CCAGCTGGGCCACTGCATCTCGG - Exonic
1182583947 22:31332386-31332408 CAAGCTGCCTCTTTGGATCTTGG - Intronic
1183864868 22:40696028-40696050 TCAGCTGGGACATTGGATTTGGG - Intergenic
1184591281 22:45485004-45485026 CAAGCCTGGCCATTGGAAATGGG + Intergenic
1185131496 22:49041755-49041777 CAGGGTGGCCCATTGGCTCTAGG + Intergenic
951826667 3:26876124-26876146 CGACCTGGGACATTGGAGCTTGG + Intergenic
955088899 3:55730058-55730080 CAAGCTGAACCACTGGAACTGGG + Intronic
955455148 3:59112084-59112106 CAAGCTGGGACATTTGGTATAGG + Intergenic
956716102 3:72081374-72081396 CAAGGTTGGCCATGGGATCGAGG - Intergenic
960361971 3:116723781-116723803 CAAGTGGGGCCTTTGGTTCTAGG - Intronic
961406355 3:126682370-126682392 CCAGCTGGGCCCTTGGGTGTGGG - Intergenic
964844385 3:161029977-161029999 CAAGCTGGCCCATGGAAACTTGG + Intronic
968629288 4:1641880-1641902 CAACCTGGTCCGTTGGGTCTGGG - Intronic
972879975 4:43410718-43410740 CAAGCTGGGCCACTTGGTCAAGG - Intergenic
976064220 4:81165232-81165254 CAATCAGGGCCATTTGTTCTAGG + Intronic
980972362 4:139578659-139578681 TAAGCTGGGCGCTTGGCTCTGGG + Intronic
983632503 4:169863563-169863585 CAAGCTGGGCCATCTGATTAAGG - Intergenic
987337998 5:16914132-16914154 CAAGCTGGGCCAAGGGTTCAAGG + Intronic
988974846 5:36504958-36504980 CTAGCTGGGCCCCTGGATTTTGG - Intergenic
995747396 5:115418113-115418135 CAGGCTTGGGTATTGGATCTGGG + Intergenic
997824940 5:137097985-137098007 AAAGCTGGGCCAATGGAGCTAGG + Intronic
997942571 5:138171832-138171854 CAAGCTTGGGAATTAGATCTGGG - Intronic
1000827108 5:166058664-166058686 TACGCTGGGCCATTGCATTTTGG - Intergenic
1000869788 5:166561719-166561741 CAAAATGGGCCATTGAATATTGG - Intergenic
1001634219 5:173198236-173198258 CAGGCTGGGCCACTGGTTCTAGG - Intergenic
1003228640 6:4229303-4229325 CAACCTGGGACACTGGAGCTTGG + Intergenic
1005775747 6:29129622-29129644 CAAGCTGTGGCTGTGGATCTGGG + Intergenic
1006020423 6:31114646-31114668 CAGGCTGGGCCTCTTGATCTAGG + Intergenic
1007858135 6:44879212-44879234 CGAGCTGGGACATTCGAGCTTGG + Intronic
1010118923 6:72350489-72350511 CTATCTGGGCCAGTGAATCTAGG - Intronic
1013805805 6:113994432-113994454 CAAACTGGGTCATTGCACCTTGG - Intronic
1015754068 6:136590198-136590220 GCAGATGGGCCACTGGATCTTGG + Intronic
1017211547 6:151862587-151862609 CAAGCTGGGCCAATTGCCCTTGG - Intronic
1021502393 7:21345609-21345631 CAACCTGGGACACTGGAGCTTGG + Intergenic
1026502129 7:70951885-70951907 GGAGCTGGGCCAGTGGATGTCGG + Intergenic
1026668049 7:72361236-72361258 GAGGCTTGGCCTTTGGATCTGGG - Intronic
1028825034 7:95262223-95262245 TAAGCTGGGTCATGGGAGCTAGG - Intronic
1034108321 7:148511222-148511244 GAAGCTGGGCCATGGTACCTGGG - Intergenic
1034688703 7:152996807-152996829 CAAGCAGAGCCTCTGGATCTGGG + Intergenic
1035175455 7:157046811-157046833 CAAGCTGGGGCACAGGAGCTGGG - Intergenic
1035360626 7:158311042-158311064 CATCCTGGGCCCTTGGAGCTTGG - Intronic
1037582360 8:20253198-20253220 CAAGCTGGGCCACTCGAACAAGG - Exonic
1040484191 8:47854750-47854772 CAAGCAGGGATATTGGATATGGG - Intronic
1042327165 8:67540857-67540879 CAACCTGGGACACTGGAGCTTGG - Intronic
1045025603 8:98083806-98083828 CAGGCTGGGGCATGGTATCTTGG - Intronic
1046867739 8:119169990-119170012 CCAGGTAGGCCCTTGGATCTTGG - Intronic
1047232420 8:123008811-123008833 CAAGCTGGGTCAGTGAGTCTTGG + Intergenic
1054761260 9:69006294-69006316 CATGCTGGGCCCTTGTATCTAGG + Intronic
1057424833 9:94939833-94939855 AAAGCTGGTCCTTTGTATCTGGG + Intronic
1057629915 9:96711183-96711205 CAAGCTGGTACATGGGTTCTGGG + Intergenic
1060668426 9:125447520-125447542 CATGCTGGGCCATAGGACATGGG + Intronic
1061013938 9:127971310-127971332 CAAGCACGGCAATTGGACCTTGG - Intronic
1062147843 9:134999935-134999957 CAAGCTCGGCCACTGGAAATGGG + Intergenic
1187211472 X:17236604-17236626 CTAGCTGGGCCATTGGAAGCTGG - Intergenic
1190753264 X:53380427-53380449 CAGGCAGGGCCATTGCATTTGGG - Intronic
1192340518 X:70259793-70259815 CAAGCTGGACCAAGGGAGCTTGG - Intergenic
1195820874 X:108944233-108944255 CAACCTGGGACACTGGAGCTTGG - Intergenic
1198242777 X:134801531-134801553 CAAGCTCGGCCACTGGAAATGGG - Intronic
1198446337 X:136719886-136719908 AAAGCTGGTCCATTTAATCTAGG - Intronic
1200802506 Y:7399385-7399407 CCAGCCAGGCCTTTGGATCTTGG - Intergenic
1202025050 Y:20512552-20512574 CAAGCTGGGCAATTAGAACAAGG + Intergenic