ID: 1151564555

View in Genome Browser
Species Human (GRCh38)
Location 17:74890532-74890554
Sequence GCCTTTCCTCCCCAGCTTCG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 245
Summary {0: 1, 1: 0, 2: 0, 3: 29, 4: 215}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151564549_1151564555 24 Left 1151564549 17:74890485-74890507 CCACTGCAGTCCACCAGGCAGGT 0: 1
1: 0
2: 3
3: 32
4: 309
Right 1151564555 17:74890532-74890554 GCCTTTCCTCCCCAGCTTCGAGG 0: 1
1: 0
2: 0
3: 29
4: 215
1151564551_1151564555 11 Left 1151564551 17:74890498-74890520 CCAGGCAGGTGTCACGACATGAA 0: 1
1: 0
2: 0
3: 8
4: 69
Right 1151564555 17:74890532-74890554 GCCTTTCCTCCCCAGCTTCGAGG 0: 1
1: 0
2: 0
3: 29
4: 215
1151564550_1151564555 14 Left 1151564550 17:74890495-74890517 CCACCAGGCAGGTGTCACGACAT 0: 1
1: 0
2: 0
3: 8
4: 90
Right 1151564555 17:74890532-74890554 GCCTTTCCTCCCCAGCTTCGAGG 0: 1
1: 0
2: 0
3: 29
4: 215
1151564547_1151564555 25 Left 1151564547 17:74890484-74890506 CCCACTGCAGTCCACCAGGCAGG 0: 1
1: 0
2: 5
3: 37
4: 260
Right 1151564555 17:74890532-74890554 GCCTTTCCTCCCCAGCTTCGAGG 0: 1
1: 0
2: 0
3: 29
4: 215

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151564555 Original CRISPR GCCTTTCCTCCCCAGCTTCG AGG Intronic
900157142 1:1207714-1207736 CCCTTTCCTTCCGAGCGTCGGGG - Intergenic
900987667 1:6082634-6082656 GCCTGCCCTCCCCAGCTCTGAGG - Intronic
901779765 1:11586118-11586140 GCCTTTAATCCCCTGCTTCTTGG + Intergenic
902565666 1:17309773-17309795 TCCTTTTCTCCCCAACTTCTTGG - Intronic
904116382 1:28164867-28164889 GCATTCCCTTCCCAGCTTTGAGG - Intronic
904677105 1:32205418-32205440 GCCTTTCCTCCCGGTCTCCGCGG + Intergenic
905262643 1:36730499-36730521 GCCTTTCCTCCCCAGAGACCAGG + Intergenic
906821970 1:48939516-48939538 GCCTTTCCTCCCCCTCCTGGAGG - Intronic
913308824 1:117464231-117464253 GCCTGTACTCCCCAGCTACTTGG + Intronic
916207682 1:162331354-162331376 GACTTTCCTCCCAGGCTTCTTGG + Intronic
916480736 1:165212187-165212209 TCCTTCCCTCCCCTGCTCCGTGG + Intronic
921187750 1:212684716-212684738 CCCTCTCCTCCCCAGCCTCCCGG + Intergenic
921228667 1:213046579-213046601 GCCTTTTCTCTCAAGCTTCTTGG + Intergenic
1065603780 10:27395004-27395026 GCCTTTCCTCCCTGGCTTATAGG + Intergenic
1065818392 10:29502599-29502621 GCCTTTCCCCACCACATTCGTGG - Intronic
1066302965 10:34113222-34113244 CCCCTTCCTCCCCAGCTTCATGG + Intronic
1072082723 10:92047971-92047993 GCCTTAACTGCCCAGCTTCCAGG + Intronic
1072618451 10:97064658-97064680 GCCTGTCCTCCCCTCCTCCGAGG + Intronic
1073028012 10:100502477-100502499 GCTTTTCCTCACCAGTTTGGAGG - Exonic
1074069010 10:110048222-110048244 GCCTCCCCTCCCCAGCCACGTGG + Intronic
1074760818 10:116666029-116666051 GCCTTCCCTCCCCAGCTCCAAGG - Intronic
1074908523 10:117886163-117886185 GCCTTTCCTACCCAGGTGAGGGG - Intergenic
1076755881 10:132571389-132571411 CCTTGTCCTCCCCAGCTGCGGGG + Intronic
1076988492 11:256797-256819 GGCTTTCCACCCCACCTTCCGGG + Intergenic
1077218667 11:1405644-1405666 ACCTTTGCTCCCCAGCTTTGAGG + Intronic
1077233096 11:1467374-1467396 GCCTTCCTTTCCCAGCTTCTAGG + Intergenic
1077394646 11:2315093-2315115 GCCTTTCCTCCCCAGGGCCCTGG + Intronic
1078993881 11:16676995-16677017 GCCTTTCTTCCTCAGCTTTTTGG + Intronic
1082098470 11:48151245-48151267 TCCTTGCCTCCGCAGCTTCTGGG + Intronic
1083053820 11:59800756-59800778 GTCTTTCCTCCCCACCTTCCAGG + Intronic
1083637645 11:64129082-64129104 GCCCTTCTTCCCTAGCTTCGAGG - Intronic
1085184443 11:74563593-74563615 GCCTTTACTTCCCACCTTCTGGG + Intronic
1091345317 11:134848836-134848858 GCCTTGCCTTTCCAGCTTCTAGG + Intergenic
1092160423 12:6312555-6312577 GCCTCTCCTGCCCAGCTGCTGGG - Intronic
1093240040 12:16659096-16659118 ACGTTTCCTCCCCAACTTTGAGG + Intergenic
1093667534 12:21832281-21832303 GCTTTTCCTCCCCCGCATTGAGG - Intronic
1094147299 12:27244148-27244170 GCCTTGCCTCCTCGGCTTCTCGG - Intronic
1095265111 12:40147266-40147288 GCCTTTCTCCCCCAGCTGCTTGG + Intergenic
1095455056 12:42374563-42374585 GCCTGTAGTCCCCAGCTTCTTGG - Intronic
1095904329 12:47361824-47361846 GCCTCTCCCCCGCACCTTCGTGG + Intergenic
1097245608 12:57606002-57606024 TCCTTTCTTCCCCAGCTCTGAGG - Intronic
1097514792 12:60591543-60591565 GCCTTTACTCCACAGATTCATGG - Intergenic
1098608716 12:72427364-72427386 GCCTGTCCTCTTCAGCTTCTGGG + Intronic
1101989350 12:109471701-109471723 GCCTTTTCTCCCCCCCTTCGAGG - Intronic
1102414409 12:112748076-112748098 GTCTTTTCTCCCCATCTTCCAGG - Intronic
1102572104 12:113833146-113833168 ACCTGTCCTTCCCAGCTTCCTGG + Intronic
1102681312 12:114692466-114692488 GCCTTCCCTCTCCAGCTACCGGG + Intergenic
1104860181 12:131919457-131919479 GCCTGCCGCCCCCAGCTTCGCGG + Exonic
1106954275 13:34918415-34918437 GCCTGTAATCCCCAGCTACGTGG + Intergenic
1107067591 13:36232151-36232173 GACTTTCATCCCCAGCTCCATGG + Intronic
1110239829 13:73254789-73254811 GGCTTTCCTCTCCAGCCTCCTGG + Intergenic
1112172738 13:96991309-96991331 TTCTTTCCTCCCTAGCTTCAGGG + Intronic
1112474076 13:99715134-99715156 TCCTGTGCTCTCCAGCTTCGGGG + Intronic
1114538319 14:23436835-23436857 CCCTTTCCTCCCCTCCTTTGTGG - Intergenic
1115163701 14:30424493-30424515 TCCTCTCCTCCACAGCTTCATGG - Intergenic
1115362064 14:32514936-32514958 ACCTTTCCTCCTCAGCTTGGTGG + Intronic
1119960280 14:78848044-78848066 TCCTTTCCTCCTCAGATTCTAGG - Intronic
1121013093 14:90533412-90533434 GCCCTTCCTGCCCTGCTTCAGGG + Exonic
1121449273 14:93997116-93997138 GCCCTTTCTCCCCATCTTCTTGG + Intergenic
1121478971 14:94244772-94244794 GCCTTTTCTCCCCTTCTTCTTGG + Intronic
1122244167 14:100389812-100389834 GCCTTTCCTCGCCAGGATTGGGG + Intronic
1122265619 14:100545313-100545335 GCCTTCCCTTCCCATCTTCAGGG - Intronic
1122846080 14:104499949-104499971 GCCTTTCCTCCCCAGGTGGCAGG - Intronic
1122856982 14:104564671-104564693 GCACTGCCTCCGCAGCTTCGTGG + Intronic
1123032406 14:105458191-105458213 GCCTCTCCTCCCCGGGTGCGGGG - Intronic
1124213480 15:27783955-27783977 GCCTCTCCTCCCCTGCTTTAAGG - Intronic
1124576106 15:30909801-30909823 TCCTTTCCTTCCCCGCTGCGTGG + Intronic
1127989515 15:64102533-64102555 GCCTTCCCTTCTCAGCTTCTGGG + Intronic
1128688314 15:69703701-69703723 GCCTTTCCTTGCCAGCAACGCGG + Intergenic
1129175613 15:73837786-73837808 TCCTTTCCTCCCCATCTCCCAGG - Intergenic
1129337170 15:74859528-74859550 GCCTTTACCCCCCAGCTATGTGG - Intronic
1130208778 15:81903524-81903546 ACCTTTCTTCCCCAGATTTGGGG + Intergenic
1131012485 15:89030530-89030552 TCCTTTCCTCCCAAGCTCCTGGG + Intergenic
1132175869 15:99713940-99713962 GCCTTTTCCCCCCAGATTGGCGG - Exonic
1134398004 16:13882946-13882968 ATCTTTCCTCCTCAGCTTCCTGG - Intergenic
1136122835 16:28150990-28151012 GCCTTCCCTCCCCTGCTCCCAGG + Intronic
1136584732 16:31177099-31177121 GCCTTTCCTCCCTTGCTGCTTGG + Intergenic
1141170277 16:81686629-81686651 GCCTTTCCTCAGAAGCTTCCAGG + Intronic
1141554414 16:84827443-84827465 CCCATTCCTCCCCAGCTTCATGG + Intronic
1141601134 16:85127002-85127024 GACTTTCCTCCCCAGCTCTCAGG + Intergenic
1143152967 17:4818527-4818549 GCCCTTACTCCCTGGCTTCGAGG + Exonic
1143612700 17:8028831-8028853 GCCTTTGTTCCCCATCTTCCTGG + Intergenic
1143769350 17:9158151-9158173 CCCTTCCCTCCCCTGCTTCTTGG - Intronic
1143830793 17:9648757-9648779 GCCTTTCCTCCCCAGCCAAGTGG - Intronic
1144952809 17:19003353-19003375 AGGTTTCCTCCCCACCTTCGTGG - Intronic
1146394645 17:32454482-32454504 GCCTTTCCTACAGAGCTTGGAGG + Exonic
1147044340 17:37742555-37742577 GCCTTTCCTCCCCCGCTCCCGGG - Intronic
1148742795 17:49902209-49902231 GCCTTTCATCAGCAGCTTGGCGG - Intergenic
1149088105 17:52744124-52744146 GCCTTGACTCCCCTGCTTCAAGG - Intergenic
1149245327 17:54698860-54698882 GCCTTTCACCCCTAGCTTCCAGG - Intergenic
1149989801 17:61376587-61376609 GCCTTACCTCTCCAACTTCCTGG + Intronic
1150214803 17:63461065-63461087 CCCTCTCCTCCCCTGCTTCCTGG + Intergenic
1151564555 17:74890532-74890554 GCCTTTCCTCCCCAGCTTCGAGG + Intronic
1151654815 17:75490938-75490960 GCCTCTCCACCCCAACTTCGTGG + Intronic
1151704316 17:75758592-75758614 CTCTTTCCTCCCCAGCTGCCAGG - Exonic
1151728519 17:75897779-75897801 GCCTTGCCTGCTCAGCTTCAGGG - Intergenic
1152090011 17:78241176-78241198 ACCTTTCCTCCCAAGCTGAGAGG - Intergenic
1152363216 17:79841839-79841861 CCCCTTCCTCCCCAGCTCCGCGG - Intergenic
1153307844 18:3649223-3649245 TCCTCTCCTCCCCACCTTCCAGG + Intronic
1154317438 18:13315994-13316016 GCCTTTTCTCCACATCTCCGTGG - Intronic
1155529861 18:26756189-26756211 GCCTTTTCCCCCCAACTTCCTGG + Intergenic
1157200830 18:45658161-45658183 GCCATCCCTCCCCAGCTTCCTGG - Intronic
1157674709 18:49560770-49560792 CCCCTTCCTCCCTAGCGTCGAGG - Intronic
1160031111 18:75260831-75260853 GCCTTACCTCTCCAAGTTCGAGG + Intronic
1160911082 19:1474105-1474127 CCCATCCCTCCCCAGCTTCCGGG + Exonic
1160973582 19:1781128-1781150 GTCCTCCCTCCCCAGCCTCGAGG - Intergenic
1161103267 19:2431843-2431865 GCCCTTCCACACCAGCGTCGAGG + Exonic
1161590456 19:5127021-5127043 GCCACTCCTCCCCAGCGCCGGGG - Intronic
1161708121 19:5831779-5831801 GGCGTTCCTCCACAGCTTCTCGG + Exonic
1161710335 19:5844048-5844070 GGCGTTCCTCCACAGCTTCTCGG + Exonic
1161714338 19:5866895-5866917 GGCGTTCCTCCACAGCTTCTCGG + Exonic
1162384651 19:10353726-10353748 GCCTTCCCTCCCGACCTTGGAGG - Intronic
1162921693 19:13906669-13906691 GCCTTGGCTCCCCAGCTCCTGGG + Intronic
1163055551 19:14714912-14714934 GCTTTTCCTCCCCGGCTGCCTGG - Intronic
1164813628 19:31177419-31177441 CCCTTGCCTTCCCAGCCTCGGGG + Intergenic
1166938673 19:46350155-46350177 GCCTCTCCTGCCCAGGTTCCTGG - Intronic
1168502039 19:56900859-56900881 GACTTTAATCCCCAGCTTCACGG + Intergenic
927332173 2:21878375-21878397 ATCTTTCCTCCTCAGCTTGGAGG + Intergenic
927872949 2:26635128-26635150 CCCTTTCCGCCCTAGCATCGGGG - Intronic
929786094 2:44993246-44993268 GCCTTTCCTCCCAAGCTTTTGGG + Intergenic
929787254 2:45001694-45001716 GCCTTTCCTAGGCAGCTTTGAGG + Intergenic
930839224 2:55826472-55826494 ACGTTCCCTCCCCAGCTTGGAGG - Intergenic
932463200 2:71896673-71896695 GCCCTTCCTCCCCAGCAGCAGGG + Intergenic
935615895 2:105081437-105081459 GCCTTTCATCCCAAGTTTCACGG + Intronic
936045786 2:109186823-109186845 GCCTCACCTCCCCAGCTATGGGG + Intronic
939625936 2:144477498-144477520 GCTTTTCCTTTCCAACTTCGTGG - Intronic
940847820 2:158660467-158660489 TCCTTTTCTCCACAGCTTCTGGG - Intronic
940933730 2:159467415-159467437 GCCTTTCCCCCCCAGGTTTCTGG + Intronic
941754513 2:169170660-169170682 GCCTTTCCTTTCCAGCTCCCCGG - Exonic
942257895 2:174124498-174124520 GCCTTTCCTCATCAGTTTTGTGG + Intronic
942276305 2:174326461-174326483 TCCTCTCCTCCGCAGCTGCGGGG - Intergenic
943273195 2:185834089-185834111 GACATTCCTTCCCAGCTTCTTGG - Intergenic
943411107 2:187549328-187549350 GTCCTTCCTCCCCTGCTTCTTGG - Intronic
944165761 2:196718598-196718620 CCCTGTCCTCCACAGCCTCGAGG - Exonic
944440702 2:199740555-199740577 CCCTCCCTTCCCCAGCTTCGTGG + Intergenic
946019401 2:216630658-216630680 GCCTTTCATTCCCAGCTCCTGGG + Intergenic
946870738 2:224082556-224082578 TCCTATCCTCCCCAGCTCCATGG + Intergenic
1169046105 20:2535807-2535829 GCTTTTCCTCCCTGGCTTCAGGG - Intergenic
1169171692 20:3470779-3470801 GCCTTTCGTCCCCGGCGGCGGGG - Intergenic
1171100677 20:22380833-22380855 ACTTTTCCTCCCCACCTTCATGG - Intergenic
1171233286 20:23504850-23504872 TCCTGACCTCCCCAGCTTTGGGG - Intergenic
1171439370 20:25148289-25148311 GCCTTCCCTCCCCAACTGAGGGG - Intergenic
1172199106 20:33112959-33112981 CCCTTCCCTCCGCAGCTTCCTGG + Intergenic
1172868851 20:38122042-38122064 GACTTTCCTCCACAGCTGGGAGG - Intronic
1174204887 20:48831087-48831109 GCTTTTCCTCCCAAGCTTTAGGG + Intergenic
1174341603 20:49900587-49900609 GCCTTTGGTCCCCAGCTACTTGG - Intergenic
1175770949 20:61623897-61623919 GTCTTTCCTCCTCAGATTCTGGG - Intronic
1177957169 21:27613176-27613198 GCCTTTTCTCCCCAATTTCTTGG + Intergenic
1179981178 21:44896776-44896798 GCCTTTCCTGGTCACCTTCGGGG - Intronic
1180136099 21:45863013-45863035 GCCTTTCCACCCCACCTACCTGG + Intronic
1181632224 22:24157220-24157242 CCCTTTCCTCCCAACCTTAGGGG + Intronic
1182756326 22:32682521-32682543 GCCCTTCCTCCCTGGCTTCCAGG - Intronic
1184557624 22:45241482-45241504 GCCTTGCCTCCCCAACATGGGGG + Intergenic
1184766818 22:46576661-46576683 GCCTTTCCTCGACCGCCTCGCGG - Intronic
1184910100 22:47526105-47526127 GCCATTGCACCCCAGCCTCGGGG + Intergenic
950033469 3:9867193-9867215 GCCCTTCCTCCGTAGCATCGAGG + Exonic
951609120 3:24471578-24471600 GGCTCTCCTTCCCAGCTTTGTGG + Intronic
953703603 3:45215069-45215091 GCTTTCCCTCCCCATCTTCCAGG - Intergenic
954985009 3:54782788-54782810 GCCTTTCCTCTCAAGCTTCTTGG - Intronic
955215376 3:56981091-56981113 GTCTTCCCTCCCCATCTTCCTGG + Intronic
955408683 3:58642144-58642166 GCCGTTCCTCTGCAGCTTTGAGG - Intronic
956741516 3:72279706-72279728 GCCTTTCCTACCCAGCATCCTGG - Intergenic
956851319 3:73230703-73230725 GCCTTTGCTCCTCAGGTTCTGGG + Intergenic
958992737 3:100865936-100865958 ACCTTTCATCCCCACCTTCATGG - Intronic
962742121 3:138369561-138369583 GACTTTCCTCCTCAGCATTGTGG + Intronic
965810959 3:172591716-172591738 ATGTTTCCTCCCCAGCTTGGAGG + Intergenic
966355442 3:179073809-179073831 GCATTTCCTTCCCTGCCTCGGGG + Intergenic
967501225 3:190200362-190200384 GCCTTGCCTCCCCAGCAGCTGGG + Intergenic
968480334 4:830365-830387 CCCTTTCCTCCACAGCCTCTGGG - Intergenic
969087807 4:4669506-4669528 GCCTTTCCTGACCAGCTTATGGG + Intergenic
969482074 4:7452008-7452030 GCCTTCTCTCCCCAGCTGCCCGG + Intronic
969647583 4:8441305-8441327 GGCCTTCCTCACCAGCTCCGGGG + Exonic
970777658 4:19695316-19695338 GCATTTCCTCCCCAACTTCCCGG - Intergenic
972686851 4:41360569-41360591 TCTTCTCCTCCCCACCTTCGAGG - Intronic
977313273 4:95413243-95413265 GCCTCTCCTCCTCTGCTTCCAGG + Intronic
979457724 4:120945105-120945127 GCATTTCATCCCCATCTTCGTGG - Intergenic
980371689 4:131882233-131882255 ACCTTTCCTCCCCAGTCTAGTGG - Intergenic
980406877 4:132365424-132365446 GTCTTTCCTTGCCAGCTTCAAGG + Intergenic
980896399 4:138864781-138864803 GACTTTCATCCTCAGCTTTGTGG - Intergenic
985744467 5:1638299-1638321 ACCCTTGCTCCCCAGCTTCCTGG + Intergenic
986670412 5:10138593-10138615 TCCTTTTCTCCCTAGCATCGCGG - Intergenic
988524959 5:31978899-31978921 CCCTGTCCTCTCCAGCTTCCTGG - Intronic
989047291 5:37285251-37285273 GCCATTCCACCCCAGCCTGGGGG + Intergenic
989281163 5:39645110-39645132 TCCTTTCCTCCCCATCTTAAGGG - Intergenic
992633763 5:78707677-78707699 GCCTTGACTTCCCAGGTTCGAGG + Intronic
994067090 5:95555332-95555354 GCCTCTGCTCCCCTGCTCCGGGG - Exonic
998407104 5:141880142-141880164 GCATTTCCTGCCCAGCTCTGCGG - Intergenic
999529306 5:152444830-152444852 GCTTTTCCTCCCCAACTTTGAGG - Intergenic
1001056747 5:168455849-168455871 GCATTTCCTTCCCACCTTCAGGG + Intronic
1002574069 5:180161653-180161675 GCCTCGCCTCCCCAGCCCCGCGG + Intronic
1004071451 6:12301664-12301686 TCCTATCCTCCCCAACTTCTGGG + Intergenic
1006125678 6:31836348-31836370 GTCTTTCCACCTCAGCTTCCTGG + Intronic
1010486214 6:76417668-76417690 GCCTTTACTCCCCAGCTACTTGG + Intergenic
1012464425 6:99501826-99501848 GGCTTTTCTCCCCAGGTTCCTGG + Intronic
1012691067 6:102311848-102311870 GCATTGCCTCCCCAGCATGGTGG - Intergenic
1015329239 6:131957887-131957909 GCCTTTCCTTCCAAACTTCACGG + Intergenic
1017442025 6:154473516-154473538 GCCATTCTCCCCCAGCATCGTGG - Intronic
1018001842 6:159586516-159586538 GCCCTTCCTCCCCAGGTCCCTGG - Intergenic
1018994214 6:168698986-168699008 TCCTTTCCTCCACAGCTTGGAGG + Intergenic
1019296310 7:277344-277366 GTCTTTCCTCCCAAGCTTTATGG + Intergenic
1020274159 7:6615074-6615096 GCCTGCCCTCCCCAGCCCCGGGG + Intergenic
1020929542 7:14375596-14375618 GCCTTTCCTCCTCACCTTCCAGG + Intronic
1023133746 7:37030070-37030092 TACTTTCCTCTCCAGCTTCTTGG + Intronic
1023573991 7:41605286-41605308 GCCTGTAATCCCCAGCTTCTTGG + Intergenic
1024008524 7:45245974-45245996 GTCCTTCCTCCCCAGCTCAGTGG + Intergenic
1025146904 7:56513085-56513107 GCCTTTCCTTCTCATCTTCATGG + Intergenic
1025260595 7:57415138-57415160 GCCTGGCTTCCCCAGCTTAGGGG - Intergenic
1025604843 7:63032001-63032023 GCCTGTCCTCCCCAGATTCCCGG - Intergenic
1027361842 7:77416827-77416849 GCCTATTCGCCCCAGCTTCGAGG + Intergenic
1028670334 7:93395029-93395051 GCCTTTCCTCTTCAGCTGCCAGG - Intergenic
1029460144 7:100689583-100689605 GCCTTTCCTCCTCAGCACCCTGG - Intergenic
1030169674 7:106588808-106588830 GGCTTTCCCTCCCAGCTTCCTGG + Intergenic
1030207527 7:106965507-106965529 GCCCTTCCTCCTCAGGTTGGTGG + Intergenic
1034065116 7:148128940-148128962 GCCTTTCCTCCCCATCGTGGAGG + Intronic
1034452248 7:151143259-151143281 TCCTTTCCTGCCCACCTTCCTGG + Intronic
1035824156 8:2626859-2626881 GAGTTTCCTCCCCAGGTTTGTGG - Intergenic
1036780117 8:11641104-11641126 GCCTGTCCTCCCCAGATTCCCGG + Intergenic
1037274837 8:17166730-17166752 CCCTTTCCTCCCCAGGTTTCAGG - Intronic
1037951189 8:23019560-23019582 CCCTTTCGTCCACAGCTTCCGGG - Intronic
1041061076 8:54035167-54035189 GCCTTTCCTCCCAGGCTTTTTGG + Intergenic
1042745675 8:72103188-72103210 TCCTTTCCTGCCTAGCTTGGTGG + Intronic
1050669963 9:7984988-7985010 GCATTTCCCCCCAAGCTCCGTGG + Intergenic
1051700902 9:19822885-19822907 GCCTTTCTTCTCCAGCTTTTTGG - Intergenic
1052325758 9:27215288-27215310 CCCTTTCCTCCCCAGCCCCAAGG - Intronic
1052331153 9:27269967-27269989 CCCTTCCCTTCCCAGCTTAGTGG + Intergenic
1057368895 9:94451880-94451902 GCCTTGCCTCCTCAGCTCAGGGG + Intronic
1058814637 9:108671922-108671944 GCCTTTCCCCCCCACATTCCTGG - Intergenic
1059438647 9:114290551-114290573 TCCTTTCCTCCCCTGCCTGGTGG + Intronic
1060672738 9:125484576-125484598 CCTTTTCCTCCCCAGGTTCAAGG - Exonic
1061543375 9:131290100-131290122 GCCTTTCTGCCCGAGCTGCGGGG - Exonic
1061806262 9:133139336-133139358 GTGTTTCCTTCCCAGCTTCTGGG - Intronic
1185559772 X:1050592-1050614 GCCTTTCTTCCCCTGCTGCTGGG - Intergenic
1187175049 X:16888693-16888715 GCCTTGCCTCCCCTGCCTCGGGG - Intergenic
1187234041 X:17450028-17450050 GCTTTTCCTGCCAAGCTGCGGGG + Intronic
1189707992 X:43778675-43778697 GCCTTACCTCCAGAGCTTCTAGG + Exonic
1195210671 X:102650889-102650911 GCGTTTCTTTCCCAGCTTCGTGG - Intergenic
1195216813 X:102711854-102711876 GCGTTTCTTTCCCAGCTTCGTGG - Intergenic
1195220957 X:102745466-102745488 GCGTTTCTTTCCCAGCTTCATGG - Intronic
1195262565 X:103147745-103147767 GTCTTCCCTCCCCACCTTCTGGG + Intergenic
1195306192 X:103585983-103586005 AACTCTCCTCCCCAGCCTCGCGG - Exonic
1197249718 X:124202319-124202341 GCCTCTCCTCCCAAGCTTTTCGG - Intronic
1198111092 X:133503221-133503243 GCCCTTCCTTCCCAGTTTCAGGG - Intergenic
1199409951 X:147509899-147509921 GACTTTCTTCCCCAGCTGCTAGG + Intergenic
1201252297 Y:12071682-12071704 TCCTTTCCTCCTCAGATTCTTGG + Intergenic
1201673916 Y:16558050-16558072 TCTTTTCCTTCCCATCTTCGAGG - Intergenic