ID: 1151565202

View in Genome Browser
Species Human (GRCh38)
Location 17:74893700-74893722
Sequence CCCCGGGGGCGGGTGTCCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 263
Summary {0: 1, 1: 0, 2: 3, 3: 15, 4: 244}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151565202_1151565213 13 Left 1151565202 17:74893700-74893722 CCTGGGGACACCCGCCCCCGGGG 0: 1
1: 0
2: 3
3: 15
4: 244
Right 1151565213 17:74893736-74893758 CACCCTGGCTCCTCTGCTGCGGG 0: 1
1: 0
2: 3
3: 105
4: 879
1151565202_1151565216 19 Left 1151565202 17:74893700-74893722 CCTGGGGACACCCGCCCCCGGGG 0: 1
1: 0
2: 3
3: 15
4: 244
Right 1151565216 17:74893742-74893764 GGCTCCTCTGCTGCGGGCGCTGG 0: 1
1: 0
2: 0
3: 16
4: 184
1151565202_1151565212 12 Left 1151565202 17:74893700-74893722 CCTGGGGACACCCGCCCCCGGGG 0: 1
1: 0
2: 3
3: 15
4: 244
Right 1151565212 17:74893735-74893757 ACACCCTGGCTCCTCTGCTGCGG 0: 1
1: 0
2: 3
3: 34
4: 317
1151565202_1151565211 -2 Left 1151565202 17:74893700-74893722 CCTGGGGACACCCGCCCCCGGGG 0: 1
1: 0
2: 3
3: 15
4: 244
Right 1151565211 17:74893721-74893743 GGTCAAGGTGCGAGACACCCTGG 0: 1
1: 0
2: 0
3: 10
4: 87
1151565202_1151565218 28 Left 1151565202 17:74893700-74893722 CCTGGGGACACCCGCCCCCGGGG 0: 1
1: 0
2: 3
3: 15
4: 244
Right 1151565218 17:74893751-74893773 GCTGCGGGCGCTGGCGACCCAGG 0: 1
1: 0
2: 2
3: 29
4: 235

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151565202 Original CRISPR CCCCGGGGGCGGGTGTCCCC AGG (reversed) Intronic
900113876 1:1020503-1020525 CCCCGGGAGGGGGGGTCGCCGGG + Intronic
900314703 1:2050900-2050922 CCCCGGGACCGGGTTTCCCTGGG + Intronic
901653460 1:10756038-10756060 CCCTGGGGGAGGGTGTGTCCGGG - Intronic
901738264 1:11325971-11325993 CCCCGGGGGCAGTGGTCACCTGG - Intergenic
902169640 1:14599295-14599317 CCCCGGGTGTGGGGGACCCCGGG - Intronic
902514161 1:16980768-16980790 CTGGGGGGGGGGGTGTCCCCGGG + Exonic
903053445 1:20618633-20618655 CCCACTGGGCAGGTGTCCCCAGG - Exonic
912502277 1:110130348-110130370 CCCTGGGGGCGGGGGACCGCTGG + Intergenic
914505938 1:148288749-148288771 CGGTGGGGGCGGGTGTCCTCCGG - Intergenic
915039690 1:152958366-152958388 CCCAGGGGGCAGGTGCCCCTTGG + Intergenic
918996948 1:191773742-191773764 CCCAGGGGGAGGGGGTACCCAGG - Intergenic
919451186 1:197775095-197775117 CGTCGGGGGCGGGCGTCCCTCGG - Intronic
919753337 1:201051976-201051998 CCCTGGGTGTGGGTGTCCCTAGG + Intronic
919980656 1:202641176-202641198 CCCCTGGAGGGGGAGTCCCCAGG - Intronic
920184632 1:204152181-204152203 CCCTGGGGGCCGGTGACGCCGGG + Intergenic
922739033 1:228005492-228005514 CCCCTAGGGCCGGTGTCCACAGG + Intergenic
922748374 1:228059730-228059752 CCCTGGGGACGGGGCTCCCCTGG + Exonic
1065614308 10:27504485-27504507 CCCCGGTGGCTGCTGTCTCCTGG + Intronic
1068505111 10:57890820-57890842 CCCGGGGGGGAGGGGTCCCCTGG - Intergenic
1070140209 10:73733049-73733071 CGCCGGGGTCGGGTGACCCGGGG - Intergenic
1070198009 10:74176721-74176743 CCCCGCGCGCGGGCGGCCCCTGG - Intronic
1070570725 10:77637963-77637985 CCCCGGGCGCGGGCGGCCCGCGG - Intronic
1071564168 10:86663047-86663069 CCTCGGGGCCAGGTGTGCCCAGG + Intronic
1073812453 10:107165002-107165024 CCGCGGGGGCGGTCGACCCCGGG + Intergenic
1075430448 10:122375282-122375304 CCCGCGGGGCGCGCGTCCCCGGG + Intronic
1075754797 10:124802033-124802055 CACCGGGGGCGGGAGCCGCCCGG - Intronic
1076747093 10:132519947-132519969 GCCCCGGGGCTGGCGTCCCCTGG - Intergenic
1076904243 10:133354453-133354475 GGCCTGGGGCTGGTGTCCCCGGG - Intergenic
1077017900 11:404995-405017 CCCAGGGGGTGGGTGTCCTCAGG - Intergenic
1077155124 11:1087682-1087704 CAACTGGGGCGGGTGTGCCCCGG + Intergenic
1077160679 11:1111123-1111145 CCCGGGGGTCGGGTGGCCCTGGG + Intergenic
1077223067 11:1425891-1425913 GCCCCGGGGCAGGTGTACCCAGG - Intronic
1077322242 11:1947591-1947613 CCCAGGGGGCGGGCGTGGCCGGG + Intronic
1077480614 11:2812754-2812776 CCCCGGGGGCGTGGGGCCTCGGG - Intronic
1078090741 11:8263096-8263118 CCCGGGGGGCGTGCGGCCCCGGG + Intronic
1082238982 11:49852356-49852378 CGCAGGTGGCGGGTGTCCGCAGG - Intergenic
1083657189 11:64235122-64235144 CGCCGGGGGCGGGGCTCCCTCGG + Intronic
1084546493 11:69817609-69817631 CTCCGGAGGCGCATGTCCCCAGG + Intronic
1084650559 11:70486932-70486954 TCCTGGGGGCGGGTGGCCCCAGG + Intronic
1085519689 11:77130720-77130742 ACCCTGGGGAGGGTGTCCCACGG - Intronic
1087083553 11:94194940-94194962 CCCTGGGGGCTGGGGTTCCCTGG - Intergenic
1088172931 11:107018184-107018206 CCGGCGGGGCGGGAGTCCCCGGG + Exonic
1090699256 11:129279452-129279474 CCCCGGGGACGCGGGTCCTCGGG + Intergenic
1202805260 11_KI270721v1_random:2904-2926 CCCAGGGGGCGGGCGTGGCCGGG + Intergenic
1093894518 12:24562060-24562082 CCCCGGGGGCGGCTGGCCGGGGG - Intergenic
1100539981 12:95548670-95548692 CCCCGGGGCCGGGAGGCACCTGG - Intronic
1102046415 12:109832808-109832830 TCCCGGGGGCGGGTGGCTCCTGG - Intronic
1102297531 12:111748483-111748505 CTCCAGGGGCGGGTCACCCCTGG + Intronic
1103432844 12:120903540-120903562 CCCCGGGGGTGGGAATCCCACGG - Intronic
1104022581 12:125003251-125003273 CCCCGGTGTTGGATGTCCCCGGG + Intronic
1104217232 12:126746016-126746038 CCCTGAGGGCAGGAGTCCCCCGG - Intergenic
1104737029 12:131141616-131141638 CCCCGGGAGCCTGTGTCCCAGGG + Intergenic
1104923487 12:132303396-132303418 GCCCGGGTGAGGGTGTGCCCGGG - Intronic
1104923498 12:132303428-132303450 GCCCGGGCGAGGGTGTGCCCGGG - Intronic
1104923523 12:132303508-132303530 GCCCGGGTGAGGGTGTGCCCAGG - Intronic
1104923542 12:132303572-132303594 GCCCGGGCGAGGGTGTGCCCGGG - Intronic
1104923567 12:132303652-132303674 GCCCGGGTGAGGGTGTGCCCAGG - Intronic
1104923584 12:132303700-132303722 GCCCGGGTGAGGGTGTGCCCCGG - Intronic
1104923606 12:132303764-132303786 GCCCGGGTGAGGGTGTGCCCCGG - Intronic
1104923758 12:132304260-132304282 GCCCGGGCGAGGGTGTGCCCGGG - Intronic
1104923783 12:132304340-132304362 GCCCGGGTGAGGGTGTGCCCAGG - Intronic
1104923814 12:132304436-132304458 GCCCGGGCGAGGGTGTGCCCGGG - Intronic
1104923912 12:132304756-132304778 GCCCGGGTGAGGGTGTGCCCGGG - Intronic
1104923928 12:132304804-132304826 GCCCGGGCGAGGGTGTGCCCAGG - Intronic
1104923933 12:132304820-132304842 GCCCGGGCGAGGGTGTGCCCGGG - Intronic
1104923939 12:132304836-132304858 GCCCGGGTGAGGGTGTGCCCGGG - Intronic
1104923978 12:132304964-132304986 GCCCGGGTGAGGGTGTGCCCGGG - Intronic
1104923984 12:132304980-132305002 GCCCGGGTGAGGGTGTGCCCGGG - Intronic
1104924013 12:132305076-132305098 GCCCGGGTGAGGGTGTGCCCAGG - Intronic
1104924094 12:132305348-132305370 GCCCGGGTGAGGGTGTGCCCGGG - Intronic
1104924100 12:132305364-132305386 GCCCGGGTGAGGGTGTGCCCGGG - Intronic
1104924112 12:132305396-132305418 GCCCGGGTGAGGGTGTGCCCCGG - Intronic
1104924117 12:132305412-132305434 GCCCGGGTGAGGGTGTGCCCGGG - Intronic
1104924130 12:132305460-132305482 GCCCGGGTGAGGGTGTGCCCAGG - Intronic
1104924142 12:132305492-132305514 GCCCGGGTGAGGGTGTGCCCCGG - Intronic
1104924152 12:132305524-132305546 GCCCGGGTGAGGGTGTGCCCGGG - Intronic
1104924179 12:132305604-132305626 GCCCGGGTGAGGGTGTGCCCGGG - Intronic
1105290121 13:19048226-19048248 CTCCCAGGGCGGTTGTCCCCTGG - Intergenic
1105705595 13:22965869-22965891 CCCCTGGGGCTGGGGTCCCCTGG + Intergenic
1105858499 13:24390854-24390876 CCCCTGGGTCTGGGGTCCCCTGG + Intergenic
1105943423 13:25170730-25170752 CCCCGGGCGCCGGTGTCGCCGGG + Exonic
1108525348 13:51281204-51281226 CCCCAGGGTCGGCTGGCCCCGGG + Exonic
1113542019 13:111115919-111115941 CGCGGGCGGCGGGGGTCCCCGGG + Intronic
1114649015 14:24271453-24271475 CGCGGGGGGCGGGGGTGCCCGGG - Exonic
1117353582 14:54902930-54902952 CCCCGGGGGCGGGAGGCCGAGGG - Intergenic
1117920519 14:60722704-60722726 CCCGGGGGGCGGCTGAACCCTGG + Intronic
1118808928 14:69260060-69260082 CCCCGAGCGCGCGCGTCCCCCGG - Exonic
1121939789 14:98059268-98059290 TCCCGGGAGTGGGTGTGCCCTGG + Intergenic
1122864435 14:104597172-104597194 GCCTGGGGGCGGGGGTCGCCTGG - Intronic
1122905939 14:104801575-104801597 CCCCAGGGGCAGGGTTCCCCGGG - Exonic
1129382844 15:75178681-75178703 CCGCTGGGGCGGGAGTCTCCAGG - Intergenic
1132099824 15:99015251-99015273 TCCCGGCGCCCGGTGTCCCCGGG - Intergenic
1132398110 15:101489196-101489218 CTGCGGGGGGGGGTGTCGCCCGG - Intronic
1132513513 16:355132-355154 CCTCGGTGGCAGGTGTCCCCAGG + Intergenic
1132528040 16:427004-427026 CCCCCTGGGGGGGTGTCCCCAGG - Intronic
1132697921 16:1210177-1210199 ACCTGGGGGCGGGGGTCCCGTGG - Intronic
1132757537 16:1493409-1493431 CCTCTGGGGCGGGTCTCCGCGGG - Exonic
1132833670 16:1942107-1942129 CTCCAGGGGAGGCTGTCCCCAGG - Intronic
1132889245 16:2196090-2196112 CCCGGGAGGCGGGTGCCGCCAGG + Intronic
1132968637 16:2673663-2673685 CCCCGGGGGCGGGGCTCTGCGGG + Intergenic
1133157371 16:3884690-3884712 CCCCAGGGGTGGGAGTCCCGGGG + Intergenic
1133271886 16:4614434-4614456 CCGCGGGGCCGCGAGTCCCCCGG - Intronic
1133429250 16:5722493-5722515 CCCCGTGTCCAGGTGTCCCCAGG + Intergenic
1135421735 16:22309513-22309535 ACCCGGGGCTGGGTGTCCCGCGG + Intronic
1135430050 16:22374906-22374928 CCCCTGTGGTGGGTGTCCCGAGG + Intronic
1137280525 16:46973185-46973207 CGCCGGGGGCTGGTATCCCCCGG - Intronic
1138329241 16:56200123-56200145 CCCTGGGGTCAGGTGACCCCAGG - Intronic
1141463352 16:84191389-84191411 CGCGGAGGGCGGGTGGCCCCAGG + Exonic
1141638615 16:85328803-85328825 CCCCGGGGCGGGGAGGCCCCGGG - Intergenic
1141661610 16:85444596-85444618 CCCTGGTTGCAGGTGTCCCCAGG + Intergenic
1142348645 16:89569934-89569956 TCCCCGGGGCCGGTGTCCTCAGG - Intergenic
1142494650 17:299885-299907 CCTAGGGGGCAGGTGTCCCGGGG + Intronic
1143175667 17:4953552-4953574 CCCCCGGGGTGGGGGTTCCCAGG + Intronic
1143387186 17:6538051-6538073 CCCCGGGCGGCGGTGCCCCCTGG - Exonic
1143781146 17:9230397-9230419 CCCCAGGGGCCGGTGACCCCAGG - Intronic
1144519814 17:15945907-15945929 CCCCGTGGGCGGGTGGAGCCCGG + Intronic
1144855514 17:18265240-18265262 CCCCAGGGGCTGGAGTCACCTGG + Exonic
1146305772 17:31728835-31728857 CCCCAGGTGCAGGAGTCCCCAGG - Intergenic
1148685057 17:49496350-49496372 CCCCGGGAGCGGGTTCGCCCCGG - Intronic
1151154594 17:72115954-72115976 CCCGGGGGGCGGGAGGCCCTCGG + Intergenic
1151565202 17:74893700-74893722 CCCCGGGGGCGGGTGTCCCCAGG - Intronic
1151703880 17:75756870-75756892 CCCCGGGGGCAGGAGTGGCCAGG + Intronic
1152029391 17:77832294-77832316 CCCCCGGGGCTGGGGACCCCTGG - Intergenic
1152395856 17:80032794-80032816 CACCGGGGGCGGGTGGCTCTGGG - Intronic
1152689766 17:81712604-81712626 CCCCGGGCGCGGCGATCCCCGGG - Intronic
1152736439 17:81999683-81999705 CCCCGGCCTCGGCTGTCCCCTGG + Intronic
1153805408 18:8705678-8705700 CCCCGCGGGCGGAGGTGCCCCGG + Intronic
1155068159 18:22286711-22286733 GGCCGTGGGTGGGTGTCCCCCGG + Intergenic
1155100335 18:22604709-22604731 CCACGGGGGCGGGTGGCCGAGGG + Intergenic
1160329310 18:77977578-77977600 CCACGGGGTGGGGGGTCCCCTGG - Intergenic
1160603944 18:80034691-80034713 CCCTAGGGGGCGGTGTCCCCGGG + Intronic
1160772627 19:839862-839884 TCCCGGGAGCTGGGGTCCCCCGG + Intergenic
1160807454 19:998689-998711 CCCCCTGGCCAGGTGTCCCCGGG - Intergenic
1160842779 19:1154022-1154044 CCACGGGGGCGGGTGGAGCCGGG + Intronic
1160847810 19:1174069-1174091 CCCCGGGCGCAGGGGTCCGCGGG + Intronic
1161153609 19:2721467-2721489 CCCCGTGGGCGCGGGTCCCCGGG - Intronic
1161159989 19:2756625-2756647 CCCTGGGGGCGGGAGGCTCCGGG - Intronic
1161264672 19:3358791-3358813 GACCTGGGGCGGGGGTCCCCTGG - Intergenic
1161272485 19:3397708-3397730 CCCAAGGGGCGGGTGTGGCCAGG - Intronic
1161346788 19:3772190-3772212 CCGCTGGGGCAGGTGTCCCGTGG - Exonic
1161594122 19:5142540-5142562 CCCCGGGGCTGGGTTTCTCCTGG + Intronic
1161724160 19:5918802-5918824 CCCCGGGAGCAGGTGTGCCAGGG - Intronic
1162235914 19:9309616-9309638 CCGCGGCGGCGGGAGGCCCCGGG + Intronic
1162302386 19:9851153-9851175 CCCCTGGGGCGGGTCTGGCCTGG - Intergenic
1162798201 19:13097568-13097590 CTCCGGCCGCGGGTCTCCCCGGG + Intronic
1164088048 19:21921934-21921956 CCCCTGGGGGGGGTGTCCCAGGG - Intergenic
1164625414 19:29724401-29724423 CTGCGGGCGCGGGGGTCCCCAGG - Intergenic
1164639417 19:29812845-29812867 CTACGGGGGCGGGGGTCCCTTGG + Intronic
1166193739 19:41193347-41193369 CCCGGGGGGCAGGTGGCCTCGGG - Exonic
1167129150 19:47573072-47573094 CCCCGGGGGCGGGTAAAACCCGG - Intergenic
1167149104 19:47698816-47698838 CCCCACGGGCTGGGGTCCCCTGG - Intronic
925068904 2:951004-951026 GGCCGGGGGCGGGGGTCCCTCGG - Exonic
927476534 2:23418325-23418347 CCCCTTGGGAGGGTGTCCCAAGG + Intronic
927494845 2:23545496-23545518 CCTCGGGGTGGGGTGTCCCCAGG + Intronic
929313684 2:40452760-40452782 ATTCGGGGGAGGGTGTCCCCCGG + Intronic
929598148 2:43188882-43188904 CCCTGGGGCGAGGTGTCCCCAGG + Intergenic
932152719 2:69387439-69387461 GCCCCGGGGCGGGCGTCTCCAGG - Intergenic
932526570 2:72475902-72475924 CCCCTGGTGTGGGTGGCCCCTGG + Intronic
932699785 2:73984856-73984878 TCCCGGGCGGGGGAGTCCCCGGG + Intergenic
932804117 2:74768555-74768577 CCCTGAGGGTGGGTGTACCCTGG + Intergenic
934545018 2:95207430-95207452 CCCCGGGAGCAGGTGGCCGCAGG + Intergenic
935653166 2:105399148-105399170 CGCGGGGGGCGGGCGCCCCCAGG + Intronic
946024926 2:216665932-216665954 GCCCCGGGGCTGCTGTCCCCAGG + Intergenic
946395522 2:219442091-219442113 CTCCGGGGGCGGGCGGCGCCGGG + Intronic
946412616 2:219522706-219522728 CGACGGGGGCGGGGGTCCCGAGG - Intronic
948981465 2:241496956-241496978 CCCCGAGGGTGGGTGACACCCGG - Intronic
1170011141 20:11725416-11725438 CCCTGGGGAAGGGGGTCCCCTGG - Intergenic
1171430761 20:25082008-25082030 CCCCGGGGGCGCGAGCCCCTAGG + Exonic
1172100876 20:32483518-32483540 GCCCGGGGGCGGGGGTGGCCAGG + Intronic
1173614088 20:44391309-44391331 CCCAGTGGGAAGGTGTCCCCTGG - Intronic
1174475905 20:50795361-50795383 CTCCGGGGCCCGGTGTCGCCCGG - Intronic
1175333485 20:58179994-58180016 CCCCGCGCGTGGGTGGCCCCCGG + Intergenic
1175733508 20:61370169-61370191 CCCCGAGGGTGGGTGGCCCTGGG + Intronic
1175908782 20:62394817-62394839 CCCCAGGTGCGGCTGCCCCCGGG - Intronic
1176044289 20:63084301-63084323 GCCCGGGGGGGGGTGCTCCCGGG + Intergenic
1176171346 20:63697725-63697747 CCCCAGGGGAGGCTGTGCCCTGG - Intronic
1179162487 21:38909720-38909742 TCCCTGGGGTGGGGGTCCCCAGG + Intergenic
1179561762 21:42219837-42219859 GTCCGGGAGAGGGTGTCCCCGGG - Intronic
1179581568 21:42347767-42347789 CCCCGGGGGAGGCCGTCCCGGGG - Intronic
1179581584 21:42347807-42347829 CCCCGGGGGAGGCGGTCCCAGGG - Intronic
1179655502 21:42842042-42842064 CCCCGGGGTCAGGTGGCCACAGG - Intergenic
1179804091 21:43826202-43826224 CCCTGGGAGCAGCTGTCCCCAGG + Intergenic
1179822005 21:43942500-43942522 CCGCAGGGGCGGGCGTCTCCAGG - Intronic
1179830752 21:43994529-43994551 CCTCGGGGGCGGGTGTGGACAGG - Intergenic
1179985638 21:44919151-44919173 CCCCGGGGTCAGGTGGCCACAGG + Intronic
1180488559 22:15821531-15821553 GCCCGGCGGGGGGTGACCCCGGG + Intergenic
1180738265 22:18034920-18034942 CCCCCGTGGCGGGGCTCCCCTGG + Intergenic
1181843542 22:25686740-25686762 TCCAGGTGGTGGGTGTCCCCAGG - Intronic
1183504491 22:38201848-38201870 CCCCGGGGGCGGGGCTTCCAGGG + Intronic
1183629798 22:39026133-39026155 CCCCCGGGCCGGGTGCCCACAGG + Intronic
1183633240 22:39045992-39046014 CCCCCGGGCCGGGTGCCCACAGG + Intronic
1183650906 22:39152757-39152779 CCCCGGGGGCGGGGTTCCGATGG - Intergenic
1184131539 22:42519581-42519603 CCCCGGTGGCCCGTGGCCCCAGG - Intronic
1184141761 22:42581797-42581819 CCCCGGTGGCCCGTGGCCCCAGG - Intergenic
1184242329 22:43217755-43217777 CCCAGCGGGCGGGTGTGCGCTGG - Intronic
1185021896 22:48381441-48381463 CCCCTGGGTCGATTGTCCCCTGG - Intergenic
1185330986 22:50251930-50251952 CGCGGGGGCAGGGTGTCCCCTGG - Intronic
950457121 3:13099485-13099507 CCCCCGAGCTGGGTGTCCCCGGG + Intergenic
951543768 3:23806430-23806452 CCCCAGGGGCGGGGGTTCGCGGG + Intronic
952309595 3:32176256-32176278 CCCCGGAGGCTGGCGTGCCCAGG - Intergenic
954689789 3:52389594-52389616 CCCCAGGGGCAGGAGTGCCCAGG + Intronic
954748490 3:52800496-52800518 CACCGTGGGAGGGTGTCCTCAGG - Intronic
961345167 3:126259562-126259584 CCCCAGGGACTGGTGTCTCCTGG + Intergenic
966712008 3:182980693-182980715 CCCCGGGCGCGGGGGTCCCCCGG + Intronic
966773118 3:183521458-183521480 CCTCCGGGGAGGGTGTCCTCAGG - Intronic
968901667 4:3435038-3435060 CTCCTGGGGCTGGGGTCCCCTGG + Intronic
968958951 4:3733208-3733230 CCAGGAGGGCGGGTGTCCTCTGG - Intergenic
969928090 4:10604002-10604024 TCCTGAGGGCAGGTGTCCCCGGG + Intronic
985273770 4:188218687-188218709 CCCCGGGGGCGCGTGTTACAAGG + Intergenic
985548942 5:523767-523789 CCCCGGGGCCGGGTTTCCTTCGG - Intronic
985661591 5:1159935-1159957 GCCCAGGTGCGGGTGACCCCTGG - Intergenic
987340459 5:16935499-16935521 CACCTGGCGCGGGTGTCCCAGGG + Intronic
987340549 5:16935907-16935929 CCCCGCGGGCGCGCGTCCTCGGG - Exonic
990545460 5:56816423-56816445 GCCCCCGGACGGGTGTCCCCGGG + Intronic
991054601 5:62306855-62306877 CCTCCCGGGCTGGTGTCCCCGGG - Intronic
1002593065 5:180304466-180304488 CCCTGGGGCAGGGTTTCCCCAGG - Intronic
1002929601 6:1624278-1624300 ACCCGGGGTGGGGTGTCACCAGG - Intronic
1004395774 6:15245558-15245580 CCCCGGGGCCGGGCGTCCTGGGG + Intergenic
1006116605 6:31779170-31779192 CCTGGGGGGCGGGAGCCCCCAGG + Exonic
1007077694 6:39078397-39078419 CCAAGGGGGCGGGTGTGCCCAGG + Intronic
1007633485 6:43285212-43285234 CCCCGGGGCGGGGGGACCCCGGG - Exonic
1010205075 6:73315173-73315195 CCCTGGTGTTGGGTGTCCCCTGG + Intergenic
1010832738 6:80551114-80551136 CCCAGGTGGCGGAGGTCCCCAGG - Intergenic
1014736417 6:125099908-125099930 CCGGGAGGGCGGATGTCCCCTGG + Intergenic
1015880463 6:137866595-137866617 CCACGGGGTCGGGTGTCCCCTGG + Intergenic
1016386772 6:143537114-143537136 CCGCGGGGGCTCGGGTCCCCGGG - Intronic
1017484564 6:154890808-154890830 TCCAGGGGGTGGGTGTCTCCAGG - Intronic
1017842241 6:158231915-158231937 GGCCGGGGGCGGGGGTCTCCCGG + Intergenic
1019177282 6:170166565-170166587 CCCCGGGTGCCGGGGTCACCTGG - Intergenic
1029445946 7:100612837-100612859 CCCCCTGGGCGGGGGTCCCGGGG + Exonic
1032068666 7:128791117-128791139 CCCCGGGGTCTGCTGTGCCCAGG - Intronic
1032455969 7:132073831-132073853 CCCCGGGTCCGGGTGTGGCCTGG - Intergenic
1035350324 7:158241004-158241026 CCCCGTGGGCAGGTGCCCTCAGG + Intronic
1038417463 8:27407629-27407651 CCCGGGAGGTGGGTCTCCCCAGG + Intronic
1040515546 8:48131142-48131164 TCCACGGGGCGGGCGTCCCCGGG + Intergenic
1048939308 8:139384538-139384560 CCCTGGGTGTGGGTGTCCTCTGG + Intergenic
1049578028 8:143398511-143398533 CCCCGGGTTCTGGTGCCCCCAGG - Intergenic
1049621105 8:143598667-143598689 CCCCGGGCGCAGGGGACCCCGGG + Exonic
1053149262 9:35732430-35732452 CCCCGAGGGCGGGGGTTCCGGGG - Exonic
1056406653 9:86282086-86282108 TCCCGGGGGTGGGCGTCCCCGGG - Intronic
1056459717 9:86797915-86797937 CCCCTGGGGATGGTCTCCCCTGG - Intergenic
1057337404 9:94166534-94166556 TCCAGCGGGCGGGTGGCCCCGGG + Intergenic
1057696316 9:97325189-97325211 CCCCGGGTGTGGGTCTCACCTGG - Exonic
1058866596 9:109167009-109167031 CCCGGGGGGCCGGGGACCCCGGG - Exonic
1060508313 9:124214737-124214759 CCCTGGGGGAGGGCCTCCCCTGG + Intergenic
1061010135 9:127949876-127949898 CCCCGGGGGCAGGTTTCCAGTGG - Intronic
1061294138 9:129667748-129667770 CTCTGGTGGCGGGTTTCCCCGGG + Intronic
1061415571 9:130445220-130445242 CGGCGGGGGCGCGAGTCCCCGGG + Intronic
1061415576 9:130445236-130445258 CCCCGGGGGCGCGAGTCCCCGGG + Intronic
1062047529 9:134431410-134431432 CCCCAGGGCCTGGTGTCCCTGGG - Intronic
1062166844 9:135112239-135112261 CCCACAGGGCGGGTGGCCCCTGG - Intronic
1062252091 9:135603358-135603380 CCCAGGGGGAGGGTGTCCAGAGG - Intergenic
1062321502 9:135992608-135992630 CCCAGGTGGCAGGTGGCCCCTGG + Intergenic
1062625940 9:137441562-137441584 CCCCGGGGGCGGGGCGACCCTGG - Intronic
1062652825 9:137587078-137587100 CACCGGGGGGGCGTGGCCCCGGG - Exonic
1189230823 X:39451156-39451178 GCCCGGGTGGGGGTGTCTCCAGG + Intergenic
1190245657 X:48688795-48688817 GCCTGGGGGTGGGGGTCCCCGGG - Exonic
1190511146 X:51175530-51175552 CTCGAGGAGCGGGTGTCCCCAGG - Intergenic
1192533868 X:71911603-71911625 CCCCAGGGTCGGGAGTCCCAAGG - Intergenic
1192584113 X:72306619-72306641 CCCCGGGGTCGGGTGGCCAACGG - Intronic
1192809346 X:74535820-74535842 TCCCGGGGGCGAGAGTCGCCCGG + Intergenic
1199975815 X:152894375-152894397 CCCTGGAGGCAGGGGTCCCCAGG - Intergenic
1200233510 X:154457901-154457923 CCCCGGTGGCAGGTGACCCCGGG + Intergenic