ID: 1151566174

View in Genome Browser
Species Human (GRCh38)
Location 17:74899753-74899775
Sequence GTGTTTATCCTGACTGATAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151566174_1151566175 13 Left 1151566174 17:74899753-74899775 CCTGTATCAGTCAGGATAAACAC No data
Right 1151566175 17:74899789-74899811 AAACAACCCCAACATCTCAGTGG No data
1151566174_1151566179 29 Left 1151566174 17:74899753-74899775 CCTGTATCAGTCAGGATAAACAC No data
Right 1151566179 17:74899805-74899827 TCAGTGGCCAAACACAATACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151566174 Original CRISPR GTGTTTATCCTGACTGATAC AGG (reversed) Intergenic
No off target data available for this crispr